Next Article in Journal
Procalcitonin as a Potential Biomarker in the Study of Babesiosis Caused by B. microti
Next Article in Special Issue
Assessment of the Impact of Early Diagnosis and Early Treatment in the Integrated Control of East Coast Fever (ECF) Involving Acquired Immunity Induced by Natural Infection in Ankole Cattle
Previous Article in Journal
Loop-Mediated Isothermal Amplification (LAMP) for the Rapid and Sensitive Detection of Alternaria alternata (Fr.) Keissl in Apple Alternaria Blotch Disease with Aapg-1 Encoding the Endopolygalacturonase
Previous Article in Special Issue
Tetratrichomoniasis in the Geese Flock—Case Report
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Occurrence and Genetic Diversity of the Zoonotic Enteric Protozoans and Enterocytozoon bieneusi in Père David’s Deer (Elaphurus davidianus) from Beijing, China

1
National Research Center for Wildlife-Born Diseases, Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China
2
Beijing Milu Ecological Research Center, Beijing 100076, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Pathogens 2022, 11(11), 1223; https://doi.org/10.3390/pathogens11111223
Submission received: 12 September 2022 / Revised: 1 October 2022 / Accepted: 19 October 2022 / Published: 23 October 2022
(This article belongs to the Special Issue Parasitic Diseases of Domestic, Wild, and Exotic Animals (Volume II))

Abstract

:
Cryptosporidium spp., Blastocystis, Giardia duodenalis, Balantioides coli, Pentatrichomonas hominis, and Enterocytozoon bieneusi are enteric protozoan parasites and fungal species in humans and animals. Père David’s deer is an endangered species in China, but the prevalence of enteric protozoans in this species still needs to be further studied. Thus, we investigated the prevalence and genetic diversity of zoonotic parasites in Père David’s deer during the period of 2018–2021. Among the 286 fecal samples collected from Père David’s deer in the Nanhaizi Nature Reserve, 83 (29.0%) were positive for Blastocystis, 70 (24.5%) were positive for E. bieneusi, while other protozoan parasites were negative. Based on a phylogenetic analysis, three Blastocystis subtypes (ST10, ST14, and ST21) and ten E. bieneusi genotypes (Genotype D, MWC_d1, HLJD-V, Peru6, BEB6, BJED-I to BJED-I V) were identified. In addition, the Blastocystis subtype ST14 and the E. bieneusi genotype D and Peru6 were first detected in Père David’s deer. Our study first reports the presence of two enteric protozoans in Père David’s deer during a 4-year active surveillance and provides more information about zoonotic subtypes/genotypes of Blastocystis and E. bieneusi in deer.

1. Introduction

Parasitic protists and fungal species, including Cryptosporidium spp., Blastocystis, Giardia duodenalis, Balantioides coli, Pentatrichomonas hominis, and Enterocytozoon bieneusi, can infect a broad spectrum of hosts, including humans, domestic animals, and wildlife [1,2,3,4]. These pathogens are mainly transmitted via the fecal–oral route through the consumption of contaminated food and water and are associated with profuse or chronic diarrhea in the host. Wildlife animals are recognized as an environmental reservoir of human pathogenic enteric pathogens [5,6,7]. Frequent contact with different hosts can promote the cross-species transmission of zoonotic enteric protozoans [8]. Recently, molecular epidemiological studies have identified the common enteric protozoans and fungal species in captive and wild deer [9,10,11,12,13,14,15]. Several zoonotic species/genotypes of Cryptosporidium spp. and E. bieneusi, including C. parvum, C. hominis, E. bieneusi genotype D and IV, were previously detected in cervids [11,12]. More than ten Blastocystis subtypes have been identified in cervids, including zoonotic ST1, ST3, ST4, and ST10 [13]; four genetic assemblages of G. duodenalis, including zoonotic assemblage A and B and animal-specific assemblage D and E, are occasionally found in cervids [14]. B. coli and P. hominis, which are zoonotic but usually neglected protozoa, have undergone host range expansion in ruminants in the recent past [15,16]. To date, B. coli has been identified in ruminants (camels, cattle, sheep, and goat), while P. hominis infection has also been detected in sika deer from China.
Père David’s deer (Elaphurus davidianus) is presently classified as a Class I National Key Protected Species of China. It was extirpated in the wild in China at the end of the 19th century. Fortunately, 38 Père David’s deer were reintroduced to China from Britain in 1985 and were raised in the Nanhaizi Nature Reserve [17]. With the government taking steps toward population rejuvenation (three major populations), ex situ conservation, and a reintroduction into the wild, the population has reached more than 9000 individuals in 2021, with at least 2800 living in the wild [17]. However, there is little information on the occurrence and genetic diversity of enteric protozoan parasites in Père David’s deer. In the present study, we further investigated the molecular epidemiology, genetic diversity, and temporal dynamics of enteric protozoans in free-ranging Père David’s deer in Beijing, China. These findings could expand the host range of enteric protozoans and improve our understanding of the ecological distribution characteristics of zoonotic parasitic diseases.

2. Materials and Methods

2.1. Specimens Collection

From August 2018 to December 2021, a total of 286 fresh fecal specimens were collected from Père David’s deer in the Nanhaizi Nature Reserve in Beijing, China. The sample numbers for 2018, 2019, 2020, and 2021 were 42, 26, 96, and 122, respectively. Fresh specimens were immediately collected using individual polyethylene gloves and were transported to the laboratory in an ice box and stored in a sterile cryopreservation tube at −80 °C before DNA extraction.

2.2. DNA Extraction and PCR Amplification

Total DNA was extracted from each fecal sample (200 mg) using a TIANamp Stool DNA Kit (TIANGEN BIOTECH, Beijing, China), following the manufacturer’s instruction. The extracted DNA was stored at −20 °C for further PCR analysis. For the detection of Blastocystis and E. bieneusi, previously described nested PCR assays were used to amplify the 18S rRNA gene and the internal transcribed spacer (ITS), respectively. Cryptosporidium spp. were identified using nested PCR that amplified partial SSU rRNA and the 60 kDa glycoprotein (gp60) gene. Giardia duodenalis was identified by nested PCR, which amplified the partial SSU rRNA and the beta giardin (bg) gene. P. hominis was identified by the targeting of the ITS and 18S rRNA gene by nested PCR. The presence of B. coli was determined by using conventional PCR to target the ITS1-5.8S rRNA-ITS2 gene region of rRNA. All primers used in this study are listed in Table 1. The secondary PCR products were visualized on a 1.0% agarose gel using a UV transilluminator.

2.3. Sequencing and Phylogenetic Analysis

Positive products were sent to BGI Sequencing (BGI, Beijing, China) for sequencing. The sequences were assembled using the Seqman 7.1.0 software. The nucleotide sequences and reference sequences from the NCBI database were aligned by ClustalX to identify the genotypes. The SSU rRNA gene sequence of Blastocystis and the ITS sequences of E. bieneusi in this study as well as the representative sequences available in the GenBank database were used for phylogenetic analyses. A phylogenetic tree was constructed with MEGA 10.0 using the neighbor-joining (NJ) method in the Kimura 2-parameter model with 1000 bootstrap replicates.

2.4. Statistical Analysis

The variations in Blastocystis and E. bieneusi prevalence from different years were calculated by chi-squared test using SPSS 25.0. The results were considered statistically significant when p < 0.05.

3. Results and Discussion

3.1. Prevalence of Enteric Protozoans

A total of 286 fecal specimens from Père David’s deer were analyzed using nested/conventional PCR assays targeting six pathogens. The most prevalent protozoan parasite and fungus was Blastocystis, with a prevalence of 29.0% (83/286), followed by E. bieneusi (24.5%, 70/286) (Table 2). The remaining parasites were not detected at all. For Blastocystis, the infection rate in the period of 2018–2021 was 33.3% (14/42), 23.1% (6/26), 24.0% (23/96), and 33.6% (41/122), respectively. No significant difference between the years were observed (p > 0.05). In view of the molecular epidemiological research on Blastocystis in more than ten deer species worldwide, the infection rate ranged considerably from 6.7% to 88.8% [2]. The prevalence of Blastocystis observed in the present study was lower than those in white-tailed deer (88.8%, 71/80) in the USA [13], in Yezo sika deer (45.5%, 60/132) in Japan [26], and in water deer (40.8%, 51/125) in Korea [27]. However, the current findings were much higher than the Blastocystis prevalence in red deer (2.0%, 1/50) in Australia [28], in spotted deer (3.3%, 1/30) in Bangladesh [29], in sika deer (0.8%, 6/760) in northern China [30], and in sika deer (14.6%, 12/82) and reindeer (6.7%, 7/104) in several provinces of China [31]. To our knowledge, there was only one previous report of Blastocystis infection in Père David’s deer (56.3%, 72/128) in Hubei, China [32], which was much higher than our study. The significant difference in prevalence indicates that the different breeds and living conditions of Père David’s deer might have different sensitivities to Blastocystis [32,33].
The overall positive rate of E. bieneusi was 24.5% (70/286), and the infection rate in 2018–2021 was 42.9% (18/42), 34.6% (9/26), 9.4% (9/96), and 27.9% (34/122), respectively (Table 2). Similarly, the prevalence here was correlated with 35.2% (45/128) in Père David’s deer in Hubei [33], 34.0% (16/47) in Henan [34], and 30.0% (24/80) in Beijing [9]. Notably, the prevalence during the four years ranged from 9.4 to 42.9%, and the difference was statistically significant (p < 0.01), which may have been caused by differences in the season in which the specimens were collected. The samples from 2018 and 2019 were collected in summer, samples from 2021 were collected in spring and winter, while samples from 2020 were collected in winter. Our previous research on Père David’s deer parasites identified that gastrointestinal parasite prevalence, burden, and diversity were at their highest in summer and their lowest in winter [35]. The high protozoa prevalence is correlated with wetter seasons [36], which means that during summer, the deer may have greater exposure to protozoal pathogens. Typically, winters are drier than summers in Beijing Milu park, which might limit the transmission of protozoa between different individuals. Moreover, the farrowing and mating period for Père David’s deer peaks between March and September (wetter season), resulting in increased contact between females and newborns, both males and females. This increase in activity might have resulted in more chances for parasite transmission during the wetter seasons [7]. A more accurate analysis of the different seasons may yield further information on the temporal dynamics of E. bieneusi in Père David’s deer.
Four protozoa parasites, including Cryptosporidium spp., G. duodenalis, B. coli, and P. hominis, are common zoonotic infectious agents and pose a risk to public health. Although these pathogens were negative in the present study, some of these pathogens were commonly found in ruminants [37]. Previous studies have evidenced Cryptosporidium spp. infection in Père David’s deer, although at a low prevalence [33,38]. In addition, the current increase in the amount of information regarding the presence of G. duodenalis, B. coli, and P. hominis in deer might be due to the increased awareness of the rising zoonotic potential of these parasites [15,39,40,41].

3.2. Molecular Typing and Phylogenetic Analysis of Enteric Protozoans

According to the SSU rRNA gene sequence analysis, three Blastocystis subtypes (ST10, ST14, and ST21) were identified in our study, with ST10 being the predominant subtype (48.8%, 41/84), followed by ST14 (42.9%, 36/84) and ST21 (8.3%, 7/84) (Table 2). Phylogenetic analysis implied that the isolates could be classified into animal-specific subtypes (ST10, ST14, and ST21), which shows limited zoonotic potential (Figure 1). According to a recent report on Père David’s deer in Hubei, five Blastocystis subtypes (ST10, ST21, ST23, ST25, and ST26) had been identified, with ST21 being the most prevalent subtype [32]. ST10 and ST14 have been commonly detected in pigs, horses, and ruminants such as cattle, sheep, goats, and deer [42,43]. ST21 seems specific to ruminants (cattle, goats, sheep, and deer), according to the previous studies [13,44,45].
Our study identified 10 distinct E. bieneusi genotypes (D, MWC_d1, HLJD-V, Peru6, BEB6, BJED-I to BJED-V) by ITS sequence analysis, which were classified into zoonotic Group 1 and Group 2. Genotype D belongs to subgroup 1a; MWC_d1, Peru6, and BJED-V belong to subgroup 1b; HLJD-V, BEB6, and BJED-I-IV belong to Group 2 (Figure 2). In our study, genotypes HLJD-V and MWC_d1 were the most prevalent genotypes in Père David’s deer, which was similar to the results of previous studies [9,33]. On the contrary, the genotypes carried by Père David’s deer in Henan are rather different (Type IV, EbpC, EbpA, BEB6, COS-I, and COS-II) [34]. After a 4-year active surveillance of enteric protozoans, zoonotic Genotype D and Peru6 were first identified in Père David’s deer. Genotype D is known as the most prevalent zoonotic genotype and is widely distributed in humans and animals worldwide [36,46]. Peru6 is found in humans and many kinds of animals [47,48]. Our previous study identified five new genotypes (BJED-I to BJED-V) in Père David’s deer [9], which were proven to be widespread during our 4-year active surveillance in the present study. In addition, Genotype BEB6 is also commonly found in ruminants, including deer [36,46,49], and it has also been detected in humans [50], which shows its zoonotic transmission risk. Research has shown that Blastocystis and E. bieneusi can cause diarrheal disease in humans and ruminants [49,50]. However, in the related studies mentioned above, fecal samples that were mainly collected from healthy deer showed no clinical signs of illness at the time of sampling. These results indicate that deer could serve as reservoirs and could play a role in the transmission of those pathogens between wildlife and humans or domestic animals.

4. Conclusions

In conclusion, our study broadens the knowledge on enteric protozoans and E. bieneusi infections in Père David’s deer from Beijing. Three Blastocystis subtypes and ten E. bieneusi genotypes were identified. Our study first reports the Blastocystis subtype ST14 and zoonotic E. bieneusi genotype D and Peru6 in Père David’s deer. The occurrence of zoonotic genotypes in E. bieneusi suggests that the deer may serve as a potential source of infection in human populations.

Author Contributions

H.H. and Q.Z. conceived and designed the study and critically revised the manuscript. P.Z. and Q.Z. conducted the laboratory experiments, analyzed the data, and drafted the manuscript. S.H. and G.Y. performed the sample collection and DNA extraction. J.B. analyzed the data and revised the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This study was financially supported by the Strategic Priority Research Program of the Chinese Academy of Sciences (XDA19050204), Beijing Wildlife Rescue Center, Beijing Milu Ecological Research Center, and Beijing Financial Project (11000022T000000440795).

Institutional Review Board Statement

The nondestructive sampling procedures were approved by the Animal Ethics Committee of the Beijing Milu Ecological Research Center, approval code GZR-2022-02, approval date 14 March 2022.

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets presented in this study can be found in the article.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Ahmed, A.; Ijaz, M.; Ayyub, R.M.; Ghaffar, A.; Ghauri, H.N.; Aziz, M.U.; Ali, S.; Altaf, M.; Awais, M.; Naveed, M.; et al. Balantidium coli in domestic animals: An emerging protozoan pathogen of zoonotic significance. Acta Trop. 2020, 203, 105298. [Google Scholar] [CrossRef] [PubMed]
  2. Hublin, J.S.Y.; Maloney, J.G.; Santin, M. Blastocystis in domesticated and wild mammals and birds. Res. Veter Sci. 2021, 135, 260–282. [Google Scholar] [CrossRef] [PubMed]
  3. Maritz, J.M.; Land, K.M.; Carlton, J.M.; Hirt, R.P. What is the importance of zoonotic trichomonads for human health? Trends Parasitol. 2014, 30, 333–341. [Google Scholar] [CrossRef] [PubMed]
  4. Zhang, Q.X.; Zhang, Z.Z.; Ai, S.T.; Wang, X.Q.; Zhang, R.Y.; Duan, Z.Y. Cryptosporidium spp., Enterocytozoon bieneusi, and Giardia duodenalis from animal sources in the Qinghai-Tibetan Plateau Area (QTPA) in China. Comp. Immunol. Microbiol. Infect. Dis. 2019, 67, 101346. [Google Scholar] [CrossRef]
  5. Amer, S.; Kim, S.; Han, J.-I.; Na, K.-J. Prevalence and genotypes of Enterocytozoon bieneusi in wildlife in Korea: A public health concern. Parasites Vectors 2019, 12, 160. [Google Scholar] [CrossRef] [PubMed]
  6. Masuda, A.; Wada, M.; Saho, H.; Tokunaga, K.; Kikuchi, Y.; Yamasaki, F.; Matsumoto, J. Prevalence and molecular characterization of the zoonotic enteric protozoans Cryptosporidium spp., Enterocytozoon bieneusi, and Blastocystis from pallas's squirrels (Callosciurus erythraeus) in Kanagawa prefecture, Japan. Microbiol. Spectr. 2021, 9, e0099021. [Google Scholar] [CrossRef]
  7. Leśniańska, K.; Perec-Matysiak, A. Wildlife as an environmental reservoir of Enterocytozoon bieneusi (Microsporidia)—Analyses of data based on molecular methods. Ann. Parasitol. 2017, 63, 265–281. [Google Scholar] [CrossRef]
  8. Li, W.; Feng, Y.; Santin, M. Host Specificity of Enterocytozoon bieneusi and public health implications. Trends Parasitol. 2019, 35, 436–451. [Google Scholar] [CrossRef]
  9. Zhang, Q.X.; Zhong, Z.Y.; Xia, Z.Q.; Meng, Q.H.; Shan, Y.F.; Guo, Q.Y.; Cheng, Z.B.; Zhang, P.Y.; He, H.X.; Bai, J.D. Molecular epidemiology and genetic diversity of Enterocytozoon bieneusi in cervids from Milu park in Beijing, China. Animals 2022, 12, 1539. [Google Scholar] [CrossRef]
  10. Zhao, W.; Xu, J.; Xiao, M.; Cao, J.; Jiang, Y.; Huang, H.; Zheng, B.; Shen, Y. Prevalence and characterization of Cryptosporidium species and genotypes in four farmed deer species in the northeast of China. Front. Veter Sci. 2020, 7, 430. [Google Scholar] [CrossRef]
  11. Lv, X.-Q.; Qin, S.-Y.; Lyu, C.; Leng, X.; Zhang, J.-F.; Gong, Q.-L. A systematic review and meta-analysis of Cryptosporidium prevalence in deer worldwide. Microb. Pathog. 2021, 157, 105009. [Google Scholar] [CrossRef] [PubMed]
  12. Zhang, Y.; Koehler, A.V.; Wang, T.; Haydon, S.R.; Gasser, R.B. First detection and genetic characterisation of Enterocytozoon bieneusi in wild deer in Melbourne’s water catchments in Australia. Parasites Vectors 2018, 11, 2. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Maloney, J.G.; Jang, Y.; Molokin, A.; George, N.S.; Santin, M. Wide genetic diversity of Blastocystis in white-tailed deer (Odo-coileus virginianus) from Maryland, USA. Microorganisms 2021, 9, 1343. [Google Scholar] [CrossRef] [PubMed]
  14. Cui, Z.; Wang, Q.; Huang, X.; Bai, J.; Zhu, B.; Wang, B.; Guo, X.; Qi, M.; Li, J. Multilocus genotyping of giardia duodenalis in alpine musk deer (Moschus chrysogaster) in China. Front. Cell Infect. Microbiol. 2022, 12, 856429. [Google Scholar] [CrossRef] [PubMed]
  15. Li, X.; Li, J.; Zhang, X.; Yang, Z.; Yang, J.; Gong, P. Prevalence of Pentatrichomonas hominis infections in six farmed wildlife species in Jilin, China. Veter Parasitol. 2017, 244, 160–163. [Google Scholar] [CrossRef] [PubMed]
  16. Ponce-Gordo, F.; Garcia-Rodriguez, J.J. Balantioides coli. Res. Vet. Sci. 2021, 135, 424–431. [Google Scholar] [CrossRef]
  17. Cheng, Z.B.; Tian, X.H.; Zhong, Z.Y.; Li, P.F.; Sun, D.M.; Bai, J.D.; Meng, Y.P.; Zhang, S.M.; Zhang, Y.Y.; Wang, L.B.; et al. Reintroduction, distribution, population dynamics and conservation of a species formerly extinct in the wild: A review of thirty-five years of successful Milu (Elaphurus davidianus) reintroduction in China. Glob. Ecol. Conserv. 2021, 31, e01860. [Google Scholar] [CrossRef]
  18. Wang, W.; Cuttell, L.; Bielefeldt-Ohmann, H.; Inpankaew, T.; Owen, H.; Traub, R.J. Diversity of Blastocystis subtypes in dogs in different geographical settings. Parasites Vectors 2013, 6, 215. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  19. Nolan, M.J.; Jex, A.R.; Haydon, S.R.; Stevens, M.A.; Gasser, R.B. Molecular detection of Cryptosporidium cuniculus in rabbits in Australia. Infect. Genet. Evol. 2010, 10, 1179–1187. [Google Scholar] [CrossRef]
  20. Li, N.; Xiao, L.; Alderisio, K.; Elwin, K.; Cebelinski, E.; Chalmers, R.; Santin, M.; Fayer, R.; Kvac, M.; Ryan, U.; et al. Subtyping Cryptosporidium ubiquitum, a zoonotic pathogen emerging in humans. Emerg. Infect. Dis. 2014, 20, 217–224. [Google Scholar] [CrossRef]
  21. Lalle, M.; Pozio, E.; Capelli, G.; Bruschi, F.; Crotti, D.; Cacciò, S.M. Genetic heterogeneity at the Betagiardin locus among human and animal isolates of Giardia duodenalis and identification of potentially zoonotic subgenotypes. Int. J. Parasitol. 2005, 35, 207–213. [Google Scholar] [CrossRef]
  22. Appelbee, A.J.; Frederick, L.M.; Heitman, T.L.; Olson, M.E. Prevalence and genotyping of Giardia duodenalis from beef calves in Alberta, Canada. Veter Parasitol. 2003, 112, 289–294. [Google Scholar] [CrossRef]
  23. Ponce-Gordo, F.; Jimenez-Ruiz, E.; Martínez-Díaz, R.A. Genetic heterogeneity in internal transcribed spacer genes of Balan-tidium coli (Litostomatea, Ciliophora). Protist 2011, 162, 774–794. [Google Scholar] [CrossRef] [PubMed]
  24. Li, W.-C.; Ying, M.; Gong, P.-T.; Li, J.-H.; Yang, J.; Li, H.; Zhang, X.-C. Pentatrichomonas hominis: Prevalence and molecular characterization in humans, dogs, and monkeys in northern China. Parasitol. Res. 2016, 115, 569–574. [Google Scholar] [CrossRef]
  25. Kamaruddin, M.; Tokoro, M.; Rahman, M.M.; Arayama, S.; Hidayati, A.P.; Syafruddin, D.; Asih, P.B.; Yoshikawa, H.; Ka-wahara, E. Molecular characterization of various trichomonad species isolated from humans and related mammals in Indonesia. Korean J. Parasitol. 2014, 52, 471–478. [Google Scholar] [CrossRef] [PubMed]
  26. Shirozu, T.; Morishita, Y.-K.; Koketsu, M.; Fukumoto, S. Molecular detection of Blastocystis sp. subtype 14 in the Yezo sika deer (Cervus nippon yesoensis) in Hokkaido, Japan. Veter Parasitol. Reg. Stud. Rep. 2021, 25, 100585. [Google Scholar] [CrossRef]
  27. Kim, K.T.; Noh, G.; Lee, H.; Kim, S.H.; Jeong, H.; Kim, Y.; Jheong, W.H.; Oem, J.K.; Kim, T.H.; Kwon, O.D.; et al. Genetic diversity and zoonotic potential of Blastocystis in Korean water deer, hydropotes inermis argyropus. Pathogens 2020, 9, 955. [Google Scholar] [CrossRef]
  28. Roberts, T.; Stark, D.; Harkness, J.; Ellis, J. Subtype distribution of Blastocystis isolates from a variety of animals from new south Wales, Australia. Veter Parasitol. 2013, 196, 85–89. [Google Scholar] [CrossRef]
  29. Li, J.; Karim, R.; Li, D.; Sumon, S.M.R.; Siddiki, S.F.; Rume, F.I.; Sun, R.; Jia, Y.; Zhang, L. Molecular characterization of Blastocystis sp. in captive wildlife in Bangladesh National Zoo: Non-human primates with high prevalence and zoonotic significance. Int. J. Parasitol. Parasites Wildl. 2019, 10, 314–320. [Google Scholar] [CrossRef]
  30. Ni, H.-B.; Gong, Q.-L.; Zhang, N.-Z.; Zhao, Q.; Tao, W.-F.; Qiu, H.-Y.; Fei, Y.-C.; Zhang, X.-X. Molecular detection of Blastocystis in black bears and sika deer in northern China. Parasitol. Res. 2021, 120, 1481–1487. [Google Scholar] [CrossRef]
  31. Wang, J.; Gong, B.; Liu, X.; Zhao, W.; Bu, T.; Zhang, W.; Liu, A.; Yang, F. Distribution and genetic diversity of Blastocystis subtypes in various mammal and bird species in northeastern China. Parasites Vectors 2018, 11, 522. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  32. Ni, F.; Yu, F.; Yang, X.; An, Z.; Ge, Y.; Liu, X.; Qi, M. Identification and genetic characterization of Blastocystis subtypes in Père David's deer (Elaphurus davidianus) from Shishou, China. Veter Res. Commun. 2022, 1–6. [Google Scholar] [CrossRef] [PubMed]
  33. Xie, F.; Zhang, Z.; Zhao, A.; Jing, B.; Qi, M.; Wang, R. Molecular characterization of Cryptosporidium and Enterocytozoon bieneusi in Pere David's deer (Elaphurus davidianus) from Shishou, China. Int. J. Parasitol. Parasites Wildl. 2019, 10, 184–187. [Google Scholar] [CrossRef] [PubMed]
  34. Zhang, Z.; Huang, J.; Karim, M.R.; Zhao, J.; Dong, H.; Ai, W.; Li, F.; Zhang, L.; Wang, R. Zoonotic Enterocytozoon bieneusi genotypes in Pere David's deer (Elaphurus davidianus) in Henan, China. Exp. Parasitol. 2015, 155, 46–48. [Google Scholar] [CrossRef] [PubMed]
  35. Xu, S.; Zhang, S.; Hu, X.; Zhang, B.; Yang, S.; Hu, X.; Liu, S.; Hu, D.; Bai, J. Temporal and spatial dynamics of gastrointestinal parasite infection in Père David’s deer. Peer J. 2021, 9, e11335. [Google Scholar] [CrossRef]
  36. Cebra, C.K.; Mattson, D.E.; Baker, R.J.; Sonn, R.J.; Dearing, P.L. Potential pathogens in feces from unweaned llamas and alpacas with diarrhea. J. Am. Veter Med. Assoc. 2003, 223, 1806–1808. [Google Scholar] [CrossRef]
  37. Fayer, R.; Santin, M.; Macarisin, D. Detection of concurrent infection of dairy cattle with Blastocystis, Cryptosporidium, Giardia, and Enterocytozoon by molecular and microscopic methods. Parasitol. Res. 2012, 111, 1349–1355. [Google Scholar] [CrossRef]
  38. Huang, S.Y.; Fan, Y.M.; Yang, Y.; Ren, Y.J.; Gong, J.Z.; Yao, N.; Yang, B. Prevalence and molecular characterization of Cryp-tosporidium spp. in Père David's deer (Elaphurus davidianus) in Jiangsu, China. Rev. Bras. Parasitol. Veter 2020, 29, e017919. [Google Scholar] [CrossRef]
  39. Huang, J.; Zhang, Z.; Zhang, Y.; Yang, Y.; Zhao, J.; Wang, R.; Jian, F.; Ning, C.; Zhang, W.; Zhang, L. Prevalence and molecular characterization of Cryptosporidium spp. and Giardia duodenalis in deer in Henan and Jilin, China. Parasites Vectors 2018, 11, 239. [Google Scholar] [CrossRef] [Green Version]
  40. Santin, M.; Fayer, R. Enterocytozoon bieneusi, Giardia, and Cryptosporidium infecting white-tailed deer. J. Eukaryot Microbiol. 2015, 62, 34–43. [Google Scholar] [CrossRef]
  41. Solarczyk, P.; Majewska, A.C.; Moskwa, B.; Cabaj, W.; Dabert, M.; Nowosad, P. Multilocus genotyping of Giardia duodenalis isolates from red deer (Cervus elaphus) and roe deer (Capreolus capreolus) from Poland. Folia Parasitol. 2012, 59, 237–240. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  42. Song, J.-K.; Hu, R.-S.; Fan, X.-C.; Wang, S.-S.; Zhang, H.-J.; Zhao, G.-H. Molecular characterization of Blastocystis from pigs in Shaanxi province of China. Acta Trop. 2017, 173, 130–135. [Google Scholar] [CrossRef] [PubMed]
  43. Zhu, W.; Tao, W.; Gong, B.; Yang, H.; Li, Y.; Song, M.; Lu, Y.; Li, W. First report of Blastocystis infections in cattle in China. Veter Parasitol. 2017, 246, 38–42. [Google Scholar] [CrossRef] [PubMed]
  44. Higuera, A.; Herrera, G.; Jimenez, P.; Garcia-Corredor, D.; Pulido-Medellin, M.; Bulla-Castaneda, D.M.; Pinilla, J.C.; More-no-Perez, D.A.; Maloney, J.G.; Santin, M.; et al. Identification of multiple Blastocystis subtypes in domestic animals from Colombia using amplicon-based next generation sequencing. Front Veter Sci. 2021, 8, 732129. [Google Scholar] [CrossRef] [PubMed]
  45. Jiménez, P.A.; Jaimes, J.E.; Ramírez, J.D. A summary of Blastocystis subtypes in north and south America. Parasites Vectors 2019, 12, 376. [Google Scholar] [CrossRef] [PubMed]
  46. Rahimi, H.M.; Mirjalali, H.; Zali, M.R. Molecular epidemiology and genotype/subtype distribution of Blastocystis sp., Enterocytozoon bieneusi, and Encephalitozoon spp. in livestock: Concern for emerging zoonotic infections. Sci. Rep. 2021, 11, 17467. [Google Scholar] [CrossRef]
  47. Sulaiman, I.M.; Bern, C.; Gilman, R.; Cama, V.; Kawai, V.; Vargas, D.; Ticona, E.; Vivar, A.; Lxiao, L. A molecular biologic study of Enterocytozoon bieneusi in HIV-infected patients in Lima, Peru. J. Eukaryot. Microbiol. 2003, 50, 591–596. [Google Scholar] [CrossRef]
  48. Gong, B.; Yang, Y.; Liu, X.; Cao, J.; Xu, M.; Xu, N.; Yang, F.; Wu, F.; Li, B.; Liu, A.; et al. First survey of Enterocytozoon bieneusi and dominant genotype Peru6 among ethnic minority groups in southwestern China’s Yunnan province and assessment of risk factors. PLoS Negl. Trop. Dis. 2019, 13, e0007356. [Google Scholar] [CrossRef] [Green Version]
  49. Zhao, W.; Wang, J.; Yang, Z.; Liu, A. Dominance of the Enterocytozoon bieneusi genotype BEB6 in red deer (Cervus elaphus) and Siberian roe deer (Capreolus pygargus) in China and a brief literature review. Parasite 2017, 24, 54. [Google Scholar] [CrossRef] [Green Version]
  50. Wang, L.; Xiao, L.; Duan, L.; Ye, J.; Guo, Y.; Guo, M.; Liu, L.; Feng, Y. Concurrent infections of Giardia duodenalis, Enterocytozoon bieneusi, and Clostridium difficile in children during a cryptosporidiosis outbreak in a pediatric hospital in China. PLoS Negl. Trop. Dis. 2013, 7, e2437. [Google Scholar] [CrossRef]
Figure 1. Phylogenetic reconstruction with the SSU rRNA nucleotide sequences of Blastocystis sp. obtained in this study and reference subtypes. The subtypes identified in this study are marked with a ▲ and highlighted in bold.
Figure 1. Phylogenetic reconstruction with the SSU rRNA nucleotide sequences of Blastocystis sp. obtained in this study and reference subtypes. The subtypes identified in this study are marked with a ▲ and highlighted in bold.
Pathogens 11 01223 g001
Figure 2. Phylogenetic tree of E. bieneusi genotypes identified in this study, and known genotypes based on the neighbor-joining analysis of the internally transcribed spacer of the rRNA gene. The new genotypes identified in this study are marked with a ▲ and highlighted in bold. Other genotype sequences identified in this study that are identical to those in our previous studies are marked with a ● and highlighted in bold.
Figure 2. Phylogenetic tree of E. bieneusi genotypes identified in this study, and known genotypes based on the neighbor-joining analysis of the internally transcribed spacer of the rRNA gene. The new genotypes identified in this study are marked with a ▲ and highlighted in bold. Other genotype sequences identified in this study that are identical to those in our previous studies are marked with a ● and highlighted in bold.
Pathogens 11 01223 g002
Table 1. Primers for enteric protozoan parasites used in this study.
Table 1. Primers for enteric protozoan parasites used in this study.
PathogensTarget GenePrimer NamesSequenceReference
Blastocystis18S rRNARD3GGGATCCTGATCCTTCCGCAGGTTCACCTAC[18]
RD5GGAAGCTTATCTGGTTGATCCTGCCAGTA
BlFGGAGGTAGTGACAATAAATC
BlR CGTTCATGATGAACAATTAC
E. bieneusiITSEBITS3GGTCATAGGGATGAAGAG[9]
EBITS4TTCGAGTTCTTTCGCGCTC
EBITS1GCTCTGAATATCTATGGCT
EBITS2.4ATCGCCGACGGATCCAAGTG
Cryptosporidium spp.SSU rRNAXF2fGGAAGGGTTGTATTTATTAGATAAAG[19]
XF2rAAGGAGTAAGGAACAACCTCCA
pSSUfAAAGCTCGTAGTTGGATTTCTGTT
pSSUrACCTCTGACTGTTAAATACRAATGC
gp6018S-F1TTTACCCACACATCTGTAGCGTCG[20]
18S-R1ACGGACGGAATGATGTATCTGA
18S-F2ATAGGTGATAATTAGTCAGTCTTTAAT
18S-R2TCCAAAAGCGGCTGAGTCAGCATC
Giardia duodenalisbgG7AAGCCCGACGACCTCACCCGCAGTGC[21]
G759GAGGCCGCCCTGGATCTTCGAGACGAC
2005FGAACGAACGAGATCGAGGTCCG
2005RCTCGACGAGCTTCGTGTT
SSU rRNAGia2029FAAGTGTGGTGCAGACGGACTC[22]
Gia2150cCTGCTGCCGTCCTTGGATGT
RH11CATCCGGTCGATCCTGCC
RH4AGTCGAACCCTGATTCTCCGCCCAGG
Balantidium coliITS1-5.8S rRNA-ITS2B5DGCTCCTACCGATACCGGGT[23]
B5RCGCGGGTCATCTTACTTGATTTC
Pentatrichomonas hominis18S rRNAPh1ATGGCGAGTGGTGGAATA[24]
Ph2CCCAACTACGCTAAGGATT
Ph3TGTAAACGATGCCGACAGAG
Ph5CAACACTGAAGCCAATGCGAGC
ITSITS-F1CGGTAGGTGAACCTGCCGTT[25]
ITS-R1TGCTTCAGTTCAGCGGGTCT
ITS-F2GGTGAACCTGCCGTTGGATC
ITS-R2TTCAGTTCAGCGGGTCTTCC
Table 2. Prevalence and genotype/subtype distribution of E. bieneusi and Blastocystis infection in Père David’s deer in Beijing, China.
Table 2. Prevalence and genotype/subtype distribution of E. bieneusi and Blastocystis infection in Père David’s deer in Beijing, China.
YearNo. of SamplesBlastocystisEnterocytozoon bieneusi
No. of Positive (%)ITS Genotypes (No.)No. of Positive (%)Subtype (No.)
20184214 (33.3)ST10 (n = 5), ST14 (n = 4), ST21 (n = 5)18 (42.9)HLJD-V (n = 11),MWC_d1 (n = 2), Peru6 (n = 1), BJED-I (n = 1), BJED-II (n = 1), BJED-IV (n = 1), BJED-V (n = 1)
2019266 (23.1)ST10 (n = 2), ST14 (n = 4)9 (34.6)HLJD-V (n = 6), MWC_d1 (n = 1), BJED-II (n = 1), BJED-III (n = 1)
20209623 (24.0)ST10 (n = 7), ST14 (n = 16)9 (9.4)HLJD-V (n = 4), MWC_d1 (n = 1), D (n = 2), BEB6 (n = 2)
202112241 (33.6)ST10 (n = 27), ST14 (n = 12), ST21 (n = 2)34 (27.9)HLJD-V (n = 14), MWC_d1 (n= 10), BEB6 (n = 1), BJED-I (n = 1), BJED-II (n = 3), BJED-III (n = 1), BJED-IV (n = 1), BJED-V (n = 3)
Total28683 (29.0)ST10 (n = 41), ST14 (n = 36), ST21 (n = 7)70 (24.5)HLJD-V (n = 35), MWC_d1 (n = 14), BEB6 (n = 3), D (n = 2), Peru6 (n = 1), BJED-I (n = 2), BJED-II (n = 5), BJED-III (n = 2), BJED-IV (n = 2), BJED-V (n = 4)
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Zhang, P.; Zhang, Q.; Han, S.; Yuan, G.; Bai, J.; He, H. Occurrence and Genetic Diversity of the Zoonotic Enteric Protozoans and Enterocytozoon bieneusi in Père David’s Deer (Elaphurus davidianus) from Beijing, China. Pathogens 2022, 11, 1223. https://doi.org/10.3390/pathogens11111223

AMA Style

Zhang P, Zhang Q, Han S, Yuan G, Bai J, He H. Occurrence and Genetic Diversity of the Zoonotic Enteric Protozoans and Enterocytozoon bieneusi in Père David’s Deer (Elaphurus davidianus) from Beijing, China. Pathogens. 2022; 11(11):1223. https://doi.org/10.3390/pathogens11111223

Chicago/Turabian Style

Zhang, Peiyang, Qingxun Zhang, Shuyi Han, Guohui Yuan, Jiade Bai, and Hongxuan He. 2022. "Occurrence and Genetic Diversity of the Zoonotic Enteric Protozoans and Enterocytozoon bieneusi in Père David’s Deer (Elaphurus davidianus) from Beijing, China" Pathogens 11, no. 11: 1223. https://doi.org/10.3390/pathogens11111223

APA Style

Zhang, P., Zhang, Q., Han, S., Yuan, G., Bai, J., & He, H. (2022). Occurrence and Genetic Diversity of the Zoonotic Enteric Protozoans and Enterocytozoon bieneusi in Père David’s Deer (Elaphurus davidianus) from Beijing, China. Pathogens, 11(11), 1223. https://doi.org/10.3390/pathogens11111223

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop