Occurrence and Genetic Diversity of the Zoonotic Enteric Protozoans and Enterocytozoon bieneusi in Père David’s Deer (Elaphurus davidianus) from Beijing, China
Abstract
:1. Introduction
2. Materials and Methods
2.1. Specimens Collection
2.2. DNA Extraction and PCR Amplification
2.3. Sequencing and Phylogenetic Analysis
2.4. Statistical Analysis
3. Results and Discussion
3.1. Prevalence of Enteric Protozoans
3.2. Molecular Typing and Phylogenetic Analysis of Enteric Protozoans
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ahmed, A.; Ijaz, M.; Ayyub, R.M.; Ghaffar, A.; Ghauri, H.N.; Aziz, M.U.; Ali, S.; Altaf, M.; Awais, M.; Naveed, M.; et al. Balantidium coli in domestic animals: An emerging protozoan pathogen of zoonotic significance. Acta Trop. 2020, 203, 105298. [Google Scholar] [CrossRef] [PubMed]
- Hublin, J.S.Y.; Maloney, J.G.; Santin, M. Blastocystis in domesticated and wild mammals and birds. Res. Veter Sci. 2021, 135, 260–282. [Google Scholar] [CrossRef] [PubMed]
- Maritz, J.M.; Land, K.M.; Carlton, J.M.; Hirt, R.P. What is the importance of zoonotic trichomonads for human health? Trends Parasitol. 2014, 30, 333–341. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.X.; Zhang, Z.Z.; Ai, S.T.; Wang, X.Q.; Zhang, R.Y.; Duan, Z.Y. Cryptosporidium spp., Enterocytozoon bieneusi, and Giardia duodenalis from animal sources in the Qinghai-Tibetan Plateau Area (QTPA) in China. Comp. Immunol. Microbiol. Infect. Dis. 2019, 67, 101346. [Google Scholar] [CrossRef]
- Amer, S.; Kim, S.; Han, J.-I.; Na, K.-J. Prevalence and genotypes of Enterocytozoon bieneusi in wildlife in Korea: A public health concern. Parasites Vectors 2019, 12, 160. [Google Scholar] [CrossRef] [PubMed]
- Masuda, A.; Wada, M.; Saho, H.; Tokunaga, K.; Kikuchi, Y.; Yamasaki, F.; Matsumoto, J. Prevalence and molecular characterization of the zoonotic enteric protozoans Cryptosporidium spp., Enterocytozoon bieneusi, and Blastocystis from pallas's squirrels (Callosciurus erythraeus) in Kanagawa prefecture, Japan. Microbiol. Spectr. 2021, 9, e0099021. [Google Scholar] [CrossRef]
- Leśniańska, K.; Perec-Matysiak, A. Wildlife as an environmental reservoir of Enterocytozoon bieneusi (Microsporidia)—Analyses of data based on molecular methods. Ann. Parasitol. 2017, 63, 265–281. [Google Scholar] [CrossRef]
- Li, W.; Feng, Y.; Santin, M. Host Specificity of Enterocytozoon bieneusi and public health implications. Trends Parasitol. 2019, 35, 436–451. [Google Scholar] [CrossRef]
- Zhang, Q.X.; Zhong, Z.Y.; Xia, Z.Q.; Meng, Q.H.; Shan, Y.F.; Guo, Q.Y.; Cheng, Z.B.; Zhang, P.Y.; He, H.X.; Bai, J.D. Molecular epidemiology and genetic diversity of Enterocytozoon bieneusi in cervids from Milu park in Beijing, China. Animals 2022, 12, 1539. [Google Scholar] [CrossRef]
- Zhao, W.; Xu, J.; Xiao, M.; Cao, J.; Jiang, Y.; Huang, H.; Zheng, B.; Shen, Y. Prevalence and characterization of Cryptosporidium species and genotypes in four farmed deer species in the northeast of China. Front. Veter Sci. 2020, 7, 430. [Google Scholar] [CrossRef]
- Lv, X.-Q.; Qin, S.-Y.; Lyu, C.; Leng, X.; Zhang, J.-F.; Gong, Q.-L. A systematic review and meta-analysis of Cryptosporidium prevalence in deer worldwide. Microb. Pathog. 2021, 157, 105009. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Koehler, A.V.; Wang, T.; Haydon, S.R.; Gasser, R.B. First detection and genetic characterisation of Enterocytozoon bieneusi in wild deer in Melbourne’s water catchments in Australia. Parasites Vectors 2018, 11, 2. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Maloney, J.G.; Jang, Y.; Molokin, A.; George, N.S.; Santin, M. Wide genetic diversity of Blastocystis in white-tailed deer (Odo-coileus virginianus) from Maryland, USA. Microorganisms 2021, 9, 1343. [Google Scholar] [CrossRef] [PubMed]
- Cui, Z.; Wang, Q.; Huang, X.; Bai, J.; Zhu, B.; Wang, B.; Guo, X.; Qi, M.; Li, J. Multilocus genotyping of giardia duodenalis in alpine musk deer (Moschus chrysogaster) in China. Front. Cell Infect. Microbiol. 2022, 12, 856429. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Li, J.; Zhang, X.; Yang, Z.; Yang, J.; Gong, P. Prevalence of Pentatrichomonas hominis infections in six farmed wildlife species in Jilin, China. Veter Parasitol. 2017, 244, 160–163. [Google Scholar] [CrossRef] [PubMed]
- Ponce-Gordo, F.; Garcia-Rodriguez, J.J. Balantioides coli. Res. Vet. Sci. 2021, 135, 424–431. [Google Scholar] [CrossRef]
- Cheng, Z.B.; Tian, X.H.; Zhong, Z.Y.; Li, P.F.; Sun, D.M.; Bai, J.D.; Meng, Y.P.; Zhang, S.M.; Zhang, Y.Y.; Wang, L.B.; et al. Reintroduction, distribution, population dynamics and conservation of a species formerly extinct in the wild: A review of thirty-five years of successful Milu (Elaphurus davidianus) reintroduction in China. Glob. Ecol. Conserv. 2021, 31, e01860. [Google Scholar] [CrossRef]
- Wang, W.; Cuttell, L.; Bielefeldt-Ohmann, H.; Inpankaew, T.; Owen, H.; Traub, R.J. Diversity of Blastocystis subtypes in dogs in different geographical settings. Parasites Vectors 2013, 6, 215. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nolan, M.J.; Jex, A.R.; Haydon, S.R.; Stevens, M.A.; Gasser, R.B. Molecular detection of Cryptosporidium cuniculus in rabbits in Australia. Infect. Genet. Evol. 2010, 10, 1179–1187. [Google Scholar] [CrossRef]
- Li, N.; Xiao, L.; Alderisio, K.; Elwin, K.; Cebelinski, E.; Chalmers, R.; Santin, M.; Fayer, R.; Kvac, M.; Ryan, U.; et al. Subtyping Cryptosporidium ubiquitum, a zoonotic pathogen emerging in humans. Emerg. Infect. Dis. 2014, 20, 217–224. [Google Scholar] [CrossRef]
- Lalle, M.; Pozio, E.; Capelli, G.; Bruschi, F.; Crotti, D.; Cacciò, S.M. Genetic heterogeneity at the Betagiardin locus among human and animal isolates of Giardia duodenalis and identification of potentially zoonotic subgenotypes. Int. J. Parasitol. 2005, 35, 207–213. [Google Scholar] [CrossRef]
- Appelbee, A.J.; Frederick, L.M.; Heitman, T.L.; Olson, M.E. Prevalence and genotyping of Giardia duodenalis from beef calves in Alberta, Canada. Veter Parasitol. 2003, 112, 289–294. [Google Scholar] [CrossRef]
- Ponce-Gordo, F.; Jimenez-Ruiz, E.; Martínez-Díaz, R.A. Genetic heterogeneity in internal transcribed spacer genes of Balan-tidium coli (Litostomatea, Ciliophora). Protist 2011, 162, 774–794. [Google Scholar] [CrossRef] [PubMed]
- Li, W.-C.; Ying, M.; Gong, P.-T.; Li, J.-H.; Yang, J.; Li, H.; Zhang, X.-C. Pentatrichomonas hominis: Prevalence and molecular characterization in humans, dogs, and monkeys in northern China. Parasitol. Res. 2016, 115, 569–574. [Google Scholar] [CrossRef]
- Kamaruddin, M.; Tokoro, M.; Rahman, M.M.; Arayama, S.; Hidayati, A.P.; Syafruddin, D.; Asih, P.B.; Yoshikawa, H.; Ka-wahara, E. Molecular characterization of various trichomonad species isolated from humans and related mammals in Indonesia. Korean J. Parasitol. 2014, 52, 471–478. [Google Scholar] [CrossRef] [PubMed]
- Shirozu, T.; Morishita, Y.-K.; Koketsu, M.; Fukumoto, S. Molecular detection of Blastocystis sp. subtype 14 in the Yezo sika deer (Cervus nippon yesoensis) in Hokkaido, Japan. Veter Parasitol. Reg. Stud. Rep. 2021, 25, 100585. [Google Scholar] [CrossRef]
- Kim, K.T.; Noh, G.; Lee, H.; Kim, S.H.; Jeong, H.; Kim, Y.; Jheong, W.H.; Oem, J.K.; Kim, T.H.; Kwon, O.D.; et al. Genetic diversity and zoonotic potential of Blastocystis in Korean water deer, hydropotes inermis argyropus. Pathogens 2020, 9, 955. [Google Scholar] [CrossRef]
- Roberts, T.; Stark, D.; Harkness, J.; Ellis, J. Subtype distribution of Blastocystis isolates from a variety of animals from new south Wales, Australia. Veter Parasitol. 2013, 196, 85–89. [Google Scholar] [CrossRef]
- Li, J.; Karim, R.; Li, D.; Sumon, S.M.R.; Siddiki, S.F.; Rume, F.I.; Sun, R.; Jia, Y.; Zhang, L. Molecular characterization of Blastocystis sp. in captive wildlife in Bangladesh National Zoo: Non-human primates with high prevalence and zoonotic significance. Int. J. Parasitol. Parasites Wildl. 2019, 10, 314–320. [Google Scholar] [CrossRef]
- Ni, H.-B.; Gong, Q.-L.; Zhang, N.-Z.; Zhao, Q.; Tao, W.-F.; Qiu, H.-Y.; Fei, Y.-C.; Zhang, X.-X. Molecular detection of Blastocystis in black bears and sika deer in northern China. Parasitol. Res. 2021, 120, 1481–1487. [Google Scholar] [CrossRef]
- Wang, J.; Gong, B.; Liu, X.; Zhao, W.; Bu, T.; Zhang, W.; Liu, A.; Yang, F. Distribution and genetic diversity of Blastocystis subtypes in various mammal and bird species in northeastern China. Parasites Vectors 2018, 11, 522. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ni, F.; Yu, F.; Yang, X.; An, Z.; Ge, Y.; Liu, X.; Qi, M. Identification and genetic characterization of Blastocystis subtypes in Père David's deer (Elaphurus davidianus) from Shishou, China. Veter Res. Commun. 2022, 1–6. [Google Scholar] [CrossRef] [PubMed]
- Xie, F.; Zhang, Z.; Zhao, A.; Jing, B.; Qi, M.; Wang, R. Molecular characterization of Cryptosporidium and Enterocytozoon bieneusi in Pere David's deer (Elaphurus davidianus) from Shishou, China. Int. J. Parasitol. Parasites Wildl. 2019, 10, 184–187. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Huang, J.; Karim, M.R.; Zhao, J.; Dong, H.; Ai, W.; Li, F.; Zhang, L.; Wang, R. Zoonotic Enterocytozoon bieneusi genotypes in Pere David's deer (Elaphurus davidianus) in Henan, China. Exp. Parasitol. 2015, 155, 46–48. [Google Scholar] [CrossRef] [PubMed]
- Xu, S.; Zhang, S.; Hu, X.; Zhang, B.; Yang, S.; Hu, X.; Liu, S.; Hu, D.; Bai, J. Temporal and spatial dynamics of gastrointestinal parasite infection in Père David’s deer. Peer J. 2021, 9, e11335. [Google Scholar] [CrossRef]
- Cebra, C.K.; Mattson, D.E.; Baker, R.J.; Sonn, R.J.; Dearing, P.L. Potential pathogens in feces from unweaned llamas and alpacas with diarrhea. J. Am. Veter Med. Assoc. 2003, 223, 1806–1808. [Google Scholar] [CrossRef]
- Fayer, R.; Santin, M.; Macarisin, D. Detection of concurrent infection of dairy cattle with Blastocystis, Cryptosporidium, Giardia, and Enterocytozoon by molecular and microscopic methods. Parasitol. Res. 2012, 111, 1349–1355. [Google Scholar] [CrossRef]
- Huang, S.Y.; Fan, Y.M.; Yang, Y.; Ren, Y.J.; Gong, J.Z.; Yao, N.; Yang, B. Prevalence and molecular characterization of Cryp-tosporidium spp. in Père David's deer (Elaphurus davidianus) in Jiangsu, China. Rev. Bras. Parasitol. Veter 2020, 29, e017919. [Google Scholar] [CrossRef]
- Huang, J.; Zhang, Z.; Zhang, Y.; Yang, Y.; Zhao, J.; Wang, R.; Jian, F.; Ning, C.; Zhang, W.; Zhang, L. Prevalence and molecular characterization of Cryptosporidium spp. and Giardia duodenalis in deer in Henan and Jilin, China. Parasites Vectors 2018, 11, 239. [Google Scholar] [CrossRef] [Green Version]
- Santin, M.; Fayer, R. Enterocytozoon bieneusi, Giardia, and Cryptosporidium infecting white-tailed deer. J. Eukaryot Microbiol. 2015, 62, 34–43. [Google Scholar] [CrossRef]
- Solarczyk, P.; Majewska, A.C.; Moskwa, B.; Cabaj, W.; Dabert, M.; Nowosad, P. Multilocus genotyping of Giardia duodenalis isolates from red deer (Cervus elaphus) and roe deer (Capreolus capreolus) from Poland. Folia Parasitol. 2012, 59, 237–240. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Song, J.-K.; Hu, R.-S.; Fan, X.-C.; Wang, S.-S.; Zhang, H.-J.; Zhao, G.-H. Molecular characterization of Blastocystis from pigs in Shaanxi province of China. Acta Trop. 2017, 173, 130–135. [Google Scholar] [CrossRef] [PubMed]
- Zhu, W.; Tao, W.; Gong, B.; Yang, H.; Li, Y.; Song, M.; Lu, Y.; Li, W. First report of Blastocystis infections in cattle in China. Veter Parasitol. 2017, 246, 38–42. [Google Scholar] [CrossRef] [PubMed]
- Higuera, A.; Herrera, G.; Jimenez, P.; Garcia-Corredor, D.; Pulido-Medellin, M.; Bulla-Castaneda, D.M.; Pinilla, J.C.; More-no-Perez, D.A.; Maloney, J.G.; Santin, M.; et al. Identification of multiple Blastocystis subtypes in domestic animals from Colombia using amplicon-based next generation sequencing. Front Veter Sci. 2021, 8, 732129. [Google Scholar] [CrossRef] [PubMed]
- Jiménez, P.A.; Jaimes, J.E.; Ramírez, J.D. A summary of Blastocystis subtypes in north and south America. Parasites Vectors 2019, 12, 376. [Google Scholar] [CrossRef] [PubMed]
- Rahimi, H.M.; Mirjalali, H.; Zali, M.R. Molecular epidemiology and genotype/subtype distribution of Blastocystis sp., Enterocytozoon bieneusi, and Encephalitozoon spp. in livestock: Concern for emerging zoonotic infections. Sci. Rep. 2021, 11, 17467. [Google Scholar] [CrossRef]
- Sulaiman, I.M.; Bern, C.; Gilman, R.; Cama, V.; Kawai, V.; Vargas, D.; Ticona, E.; Vivar, A.; Lxiao, L. A molecular biologic study of Enterocytozoon bieneusi in HIV-infected patients in Lima, Peru. J. Eukaryot. Microbiol. 2003, 50, 591–596. [Google Scholar] [CrossRef]
- Gong, B.; Yang, Y.; Liu, X.; Cao, J.; Xu, M.; Xu, N.; Yang, F.; Wu, F.; Li, B.; Liu, A.; et al. First survey of Enterocytozoon bieneusi and dominant genotype Peru6 among ethnic minority groups in southwestern China’s Yunnan province and assessment of risk factors. PLoS Negl. Trop. Dis. 2019, 13, e0007356. [Google Scholar] [CrossRef] [Green Version]
- Zhao, W.; Wang, J.; Yang, Z.; Liu, A. Dominance of the Enterocytozoon bieneusi genotype BEB6 in red deer (Cervus elaphus) and Siberian roe deer (Capreolus pygargus) in China and a brief literature review. Parasite 2017, 24, 54. [Google Scholar] [CrossRef] [Green Version]
- Wang, L.; Xiao, L.; Duan, L.; Ye, J.; Guo, Y.; Guo, M.; Liu, L.; Feng, Y. Concurrent infections of Giardia duodenalis, Enterocytozoon bieneusi, and Clostridium difficile in children during a cryptosporidiosis outbreak in a pediatric hospital in China. PLoS Negl. Trop. Dis. 2013, 7, e2437. [Google Scholar] [CrossRef]
Pathogens | Target Gene | Primer Names | Sequence | Reference |
---|---|---|---|---|
Blastocystis | 18S rRNA | RD3 | GGGATCCTGATCCTTCCGCAGGTTCACCTAC | [18] |
RD5 | GGAAGCTTATCTGGTTGATCCTGCCAGTA | |||
BlF | GGAGGTAGTGACAATAAATC | |||
BlR | CGTTCATGATGAACAATTAC | |||
E. bieneusi | ITS | EBITS3 | GGTCATAGGGATGAAGAG | [9] |
EBITS4 | TTCGAGTTCTTTCGCGCTC | |||
EBITS1 | GCTCTGAATATCTATGGCT | |||
EBITS2.4 | ATCGCCGACGGATCCAAGTG | |||
Cryptosporidium spp. | SSU rRNA | XF2f | GGAAGGGTTGTATTTATTAGATAAAG | [19] |
XF2r | AAGGAGTAAGGAACAACCTCCA | |||
pSSUf | AAAGCTCGTAGTTGGATTTCTGTT | |||
pSSUr | ACCTCTGACTGTTAAATACRAATGC | |||
gp60 | 18S-F1 | TTTACCCACACATCTGTAGCGTCG | [20] | |
18S-R1 | ACGGACGGAATGATGTATCTGA | |||
18S-F2 | ATAGGTGATAATTAGTCAGTCTTTAAT | |||
18S-R2 | TCCAAAAGCGGCTGAGTCAGCATC | |||
Giardia duodenalis | bg | G7 | AAGCCCGACGACCTCACCCGCAGTGC | [21] |
G759 | GAGGCCGCCCTGGATCTTCGAGACGAC | |||
2005F | GAACGAACGAGATCGAGGTCCG | |||
2005R | CTCGACGAGCTTCGTGTT | |||
SSU rRNA | Gia2029F | AAGTGTGGTGCAGACGGACTC | [22] | |
Gia2150c | CTGCTGCCGTCCTTGGATGT | |||
RH11 | CATCCGGTCGATCCTGCC | |||
RH4 | AGTCGAACCCTGATTCTCCGCCCAGG | |||
Balantidium coli | ITS1-5.8S rRNA-ITS2 | B5D | GCTCCTACCGATACCGGGT | [23] |
B5RC | GCGGGTCATCTTACTTGATTTC | |||
Pentatrichomonas hominis | 18S rRNA | Ph1 | ATGGCGAGTGGTGGAATA | [24] |
Ph2 | CCCAACTACGCTAAGGATT | |||
Ph3 | TGTAAACGATGCCGACAGAG | |||
Ph5 | CAACACTGAAGCCAATGCGAGC | |||
ITS | ITS-F1 | CGGTAGGTGAACCTGCCGTT | [25] | |
ITS-R1 | TGCTTCAGTTCAGCGGGTCT | |||
ITS-F2 | GGTGAACCTGCCGTTGGATC | |||
ITS-R2 | TTCAGTTCAGCGGGTCTTCC |
Year | No. of Samples | Blastocystis | Enterocytozoon bieneusi | ||
---|---|---|---|---|---|
No. of Positive (%) | ITS Genotypes (No.) | No. of Positive (%) | Subtype (No.) | ||
2018 | 42 | 14 (33.3) | ST10 (n = 5), ST14 (n = 4), ST21 (n = 5) | 18 (42.9) | HLJD-V (n = 11),MWC_d1 (n = 2), Peru6 (n = 1), BJED-I (n = 1), BJED-II (n = 1), BJED-IV (n = 1), BJED-V (n = 1) |
2019 | 26 | 6 (23.1) | ST10 (n = 2), ST14 (n = 4) | 9 (34.6) | HLJD-V (n = 6), MWC_d1 (n = 1), BJED-II (n = 1), BJED-III (n = 1) |
2020 | 96 | 23 (24.0) | ST10 (n = 7), ST14 (n = 16) | 9 (9.4) | HLJD-V (n = 4), MWC_d1 (n = 1), D (n = 2), BEB6 (n = 2) |
2021 | 122 | 41 (33.6) | ST10 (n = 27), ST14 (n = 12), ST21 (n = 2) | 34 (27.9) | HLJD-V (n = 14), MWC_d1 (n= 10), BEB6 (n = 1), BJED-I (n = 1), BJED-II (n = 3), BJED-III (n = 1), BJED-IV (n = 1), BJED-V (n = 3) |
Total | 286 | 83 (29.0) | ST10 (n = 41), ST14 (n = 36), ST21 (n = 7) | 70 (24.5) | HLJD-V (n = 35), MWC_d1 (n = 14), BEB6 (n = 3), D (n = 2), Peru6 (n = 1), BJED-I (n = 2), BJED-II (n = 5), BJED-III (n = 2), BJED-IV (n = 2), BJED-V (n = 4) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, P.; Zhang, Q.; Han, S.; Yuan, G.; Bai, J.; He, H. Occurrence and Genetic Diversity of the Zoonotic Enteric Protozoans and Enterocytozoon bieneusi in Père David’s Deer (Elaphurus davidianus) from Beijing, China. Pathogens 2022, 11, 1223. https://doi.org/10.3390/pathogens11111223
Zhang P, Zhang Q, Han S, Yuan G, Bai J, He H. Occurrence and Genetic Diversity of the Zoonotic Enteric Protozoans and Enterocytozoon bieneusi in Père David’s Deer (Elaphurus davidianus) from Beijing, China. Pathogens. 2022; 11(11):1223. https://doi.org/10.3390/pathogens11111223
Chicago/Turabian StyleZhang, Peiyang, Qingxun Zhang, Shuyi Han, Guohui Yuan, Jiade Bai, and Hongxuan He. 2022. "Occurrence and Genetic Diversity of the Zoonotic Enteric Protozoans and Enterocytozoon bieneusi in Père David’s Deer (Elaphurus davidianus) from Beijing, China" Pathogens 11, no. 11: 1223. https://doi.org/10.3390/pathogens11111223
APA StyleZhang, P., Zhang, Q., Han, S., Yuan, G., Bai, J., & He, H. (2022). Occurrence and Genetic Diversity of the Zoonotic Enteric Protozoans and Enterocytozoon bieneusi in Père David’s Deer (Elaphurus davidianus) from Beijing, China. Pathogens, 11(11), 1223. https://doi.org/10.3390/pathogens11111223