Loop-Mediated Isothermal Amplification (LAMP) for the Rapid and Sensitive Detection of Alternaria alternata (Fr.) Keissl in Apple Alternaria Blotch Disease with Aapg-1 Encoding the Endopolygalacturonase
Abstract
1. Introduction
2. Results
2.1. LAMP Primers
2.2. Specificity and Sensitivity of LAMP Detection
2.3. LAMP Detection of the Minimum Pathogenic Concentration of A. alternata Conidia in Apple Leaves
2.4. LAMP, PCR and Traditional Isolation Method to Detect A. alternata in Leaf Samples Collected from the Field
3. Discussion
4. Materials and Methods
4.1. Fungal Isolates, Culture Conditions and DNA Extraction
4.2. LAMP Primers Design and Screen
4.3. LAMP and PCR Reaction Mixtures and Conditions
4.4. Assay of Specificity and Sensitivity of LAMP and PCR Detection
4.5. Inoculation of Apple Leaves with A. alternata Conidia
4.6. Detection of A. alternata from Artificially Infested Leaves
4.7. Detection of A. alternata from Leaves Collected in Fields
4.8. Verification of A. alternata Isolated from Leaf Samples by Koch’s Rule
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Zhang, B. Analysis on the annual output, processing and trade status of apple industry in China in recent 7 years. China Fruits 2018, 4, 106–108. [Google Scholar]
- Chen, X.K.; Zhang, J.Y.; Zhang, Z.; Du, X.L.; Du, B.B.; Qu, S.C. Overexpressing MhNPR1 in transgenic Fuji apples enhances resistance to apple powdery mildew. Mol. Biol. Rep. 2012, 39, 8083–8089. [Google Scholar] [CrossRef] [PubMed]
- Roberts, J.W. Morphological characters of Alternaria mali Roberts. J. Agric. Res. 1924, 27, 699–712. [Google Scholar]
- Miyamoto, Y.; Ishii, Y.; Tsuge, M.; Yamamoto, M.; Ohtani, K.; Fukumoto, T.; Gomi, K.; Peever, T.L.; Akimitsu, K. Function of genes encoding acyl-CoA synthetase and enoyl-CoA hydratase for host-selective ACT-toxin biosynthesis in the tangerine pathotype of Alternaria alternata. Phytopathology 2009, 99, 369–377. [Google Scholar] [CrossRef]
- Li, Y.; Zhang, L.Y.; Zhang, Z.; Cheng, Z.M. A simple sequence repeat marker linked to the susceptibility of apple to Alternaria blotch caused by Alternaria alternata apple pathotype. J. Am. Soc. Hortic. Sci. 2011, 136, 109–115. [Google Scholar] [CrossRef]
- Zhao, L.; Zhao, Z.Y.; Dang, Z.G.; Zhang, K.; Zhang, X.Q. Heredity analysis on the hybrid of Qinguan and Fuji apple resistance to early defoliation disease. Acta. Agric. Boreali-Occident. Sin. 2008, 17, 197–201. [Google Scholar]
- Hu, T.L.; Cao, K.Q.; Wang, S.T.; Zhen, W.C. Study on the main factor for the epidemic of Alternaria blotch on apple. Acta. Phytopathol. Sin. 2005, 4, 374–377. [Google Scholar]
- Zhao, J.C.; Gong, X.; Liu, L.J.; Wang, K.; Hong, Y.M. Investigation on the incidence of spotted leaf disease in different varieties of apple. South China Fruits 2001, 6, 58–59. [Google Scholar]
- Dang, J.L.; Gleason, M.L.; Li, L.N.; Wang, C.; Niu, C.K.; Zhang, R.; Sun, G.Y. Alternaria Malicola sp. nov., a new pathogen causing fruit spot on apple in China. Plant Dis. 2018, 102, 1273–1282. [Google Scholar] [CrossRef]
- Zong, Z.R.; Tian, Y.; Zhang, L.Y.; Han, X.L.; Zhang, C.X.; Cong, P.H. Cloning and function identification of apple Alternaria blotch resistant gene Mal d 1. Acta Hortic. Sin. 2017, 44, 343–354. [Google Scholar]
- Johnson, R.D.; Johnson, L.; Kohmoto, K.; Otani, H.; Lane, C.R.; Kodama, M. A polymerase chain reaction-based method to specifically detect Alternaria alternata apple pathotype (A. mali), the causal agent of Alternaria blotch of apple. Phytopathology 2000, 90, 973–976. [Google Scholar] [CrossRef] [PubMed]
- Harimoto, Y.; Tanaka, T.; Kodama, M.; Yamamoto, M.; Otani, H.; Tsuge, T. Multiple copies of AMT2 are prerequisite for the apple pathotype of Alternaria alternata to produce enough AM-toxin for expressing pathogenicity. J. Gen. Plant Pathol. 2008, 74, 222–229. [Google Scholar] [CrossRef]
- Yamagishi, D.; Otani, H.; Kodama, M. G protein signaling mediates developmental processes and pathogenesis of Alternaria alternata. Mol. Plant Microbe Interact. 2006, 19, 1280–1288. [Google Scholar] [CrossRef][Green Version]
- Kohmoto, K.; Taniguchi, T.; Nishimura, S. Correlation between the susceptibility of apple cultivars to Alternaria mali and their sensitivity to AM-Toxin I. Jpn. J. Phytopathol. 1977, 43, 65–68. [Google Scholar] [CrossRef]
- Abe, K.; Iwanami, H.; Kotoda, N.; Moriya, S.; Takahashi, S. Evaluation of apple genotypes and Malus species for resistance to Alternaria blotch caused by Alternaria alternata apple pathotype using detached-leaf method. Plant Breed. 2010, 129, 208–218. [Google Scholar] [CrossRef]
- Xue, J.; Sun, J.L.; Wang, X.Y. Study on the occurrence regularity of apple Alternaria blotch disease. Deciduous Fruits 2006, 1, 36–37. [Google Scholar]
- Song, Y.H. Occurrence and control of apple Alternaria blotch disease. Agric. Dnpt. Eqpt. 2013, 3, 114–115. [Google Scholar]
- Filajdić, N.; Sutton, T. Chemical control of Alternaria blotch of apples caused by Alternaria mali. Plant Dis. 1992, 76, 126–130. [Google Scholar] [CrossRef]
- Sun, Y.Y.; Lin, M.L.; Chen, Y.Z.; Chen, X.; Cai, Y.; Luo, H.B.; Zhou, T. A study of the major pathogens causing fruit rots of apple in shelf life in Hangzhou, Zhejiang Province, China. Am. J. Plant Sci. 2019, 10, 2070–2085. [Google Scholar] [CrossRef][Green Version]
- Elfar, K.; Zoffoli, J.P.; Latorre, B.A. Occurrence of Alternaria blotch associated with Alternaria alternata, A. arborescens, A. infectoria and A. tenuissima on apples in Chile. Plant Dis. 2018, 102, 1668. [Google Scholar] [CrossRef]
- Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28, e63. [Google Scholar] [CrossRef] [PubMed]
- Tian, Y.L.; Liu, D.; Zhao, Y.Q.; Wu, J.; Hu, B.S.; Walcott, R.R. Visual detection of Didymella bryoniae in cucurbit seeds using a loop-mediated isothermal amplification assay. Eur. J. Plant Pathol. 2017, 147, 255–263. [Google Scholar] [CrossRef]
- Tian, Q.; Lu, C.C.; Wang, S.S.; Xiong, Q.; Zhang, H.F.; Wang, Y.C.; Zheng, X.B. Rapid diagnosis of soybean anthracnose caused by Colletotrichum truncatum using a loop-mediated isothermal amplification (LAMP) assay. Eur. J. Plant Pathol. 2017, 148, 785–793. [Google Scholar] [CrossRef]
- Wong, Y.P.; Othman, S.; Lau, Y.L.; Radu, S.; Chee, H.Y. Loop-mediated isothermal amplification (LAMP): A versatile technique for detection of micro-organisms. J. Appl. Microbiol. 2018, 3, 124. [Google Scholar] [CrossRef]
- Soroka, M.; Wasowicz, B.; Rymaszewska, A. Loop-mediated isothermal amplification (LAMP): The better sibling of PCR? Cells 2021, 8, 1931. [Google Scholar] [CrossRef] [PubMed]
- Ogura, A. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. Biotechniques 2009, 46, 167–172. [Google Scholar]
- Ma, X.J.; Shu, Y.L.; Nie, K.; Qin, M.; Wang, D.Y.; Gao, R.B.; Wang, M.; Wen, L.Y.; Han, F.; Zhou, S.M.; et al. Visual detection of pandemic infuenza A H1N1 virus 2009 by reverse-transcription loop-mediated isothermal amplification with hydroxynaphthol blue dye. J. Virol. Methods. 2010, 167, 214–217. [Google Scholar] [CrossRef]
- Tomlinson, J.; Boonham, N. Potential of LAMP for detection of plant pathogens. In CAB Reviews: Perspectives in Agriculture, Veterinary Science, Nutrition and Natural Resources; CAB International: Oxfordshire, UK, 2008; Volume 3, p. 66. [Google Scholar]
- Oeser, B.; Heidrich, P.M.; Müller, U.; Tudzynski, P.; Tenberge, K.B. Polygalacturonase is a pathogenicity factor in the Claviceps purpurea/rye interaction. Fungal. Genet. Biol. 2002, 36, 176–186. [Google Scholar] [CrossRef]
- Ajayabhai, C.D.; Nath, K.; Bekriwala, T.; Bala, M. Management of Alternaria leaf blight of groundnut caused by Alternaria alternata. Indian Phytopathol. 2018, 71, 543–548. [Google Scholar] [CrossRef]
- Xu, X.H.; Qu, X.X.; Wang, D.X. Diagnosis and chemical control of early defoliation diseases in apple. Plant Doc. 2015, 5, 13–14. [Google Scholar]
- Lee, D.; Back, C.; Win, N.K.K.; Choi, K.H.; Kim, K.M.; Kang, I.K.; Choi, C.; Yoon, T.M.; Uhm, J.Y.; Jung, H.Y. Biological characterization of Marssonina coronaria associated with apple blotch disease. Mycobiology 2011, 39, 200–205. [Google Scholar] [CrossRef] [PubMed]
- Li, Q.M.; Yue, D.C.; Jiang, Y.J.; Li, Q.; Liu, J.W.; Shi, G.L.; Han, J.H.; Li, P.P. The occurrence and control of apple early defoliation diseases in Pingliang area. Anhui Agri. Sci. Bull. 2020, 13, 114–116. [Google Scholar]
- White, T.J.; Burns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protoc. 1990, 18, 315–322. [Google Scholar]
- Wang, X.D.; Zheng, Q.M.; Chen, T.; Liu, X.M.; Cai, S.H.; Fan, G.C.; Lei, Y. Establishment and application of visual loop-mediated amplification assay on Colletotrichum gloeosporioides. J. Fruit Sci. 2016, 3, 366–373. [Google Scholar]
- Isshiki, A.; Akimitsu, K.; Yamamoto, M.; Yamamoto, H. Endopolygalacturonase is essential for citrus black rot caused by Alternaria citri but not brown spot caused by Alternaria alternata. Mol. Plant Microbe Interact. 2001, 14, 749–757. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.Y.; Dai, D.J.; Wang, H.D.; Zhang, C.Q. One-step loop-mediated isothermal amplification (LAMP) for the rapid and sensitive detection of Fusarium fujikuroi in bakanae disease through NRPS31, an important gene in the gibberellic acid bio-synthesis. Sci. Rep. 2019, 9, 3726. [Google Scholar] [CrossRef]
- Panek, J.; Frac, M. Loop-mediated isothermal amplification (LAMP) approach for detection of heat-resistant Talaromyces flavus species. Sci. Rep. 2019, 9, 5846. [Google Scholar] [CrossRef]
- Wu, W.J.; Yin, C.C.; Yue, A.Q.; Niu, J.P.; Du, W.L.; Liu, D.B.; Zhao, J.Z. Rapid and visual detection of soybean mosaic virus SC7 with a loop-mediated isothermal amplification strategy. Sens. Actuators Chem. 2022, 373, 132733. [Google Scholar] [CrossRef]
- Lian, W.X.; Wang, M.; Zhang, Y.; Liang, X.Y. Development and application of a loop-mediated isothermal amplification assay for detection of Colletotrichum gloeosporioides species complex on rubber trees. Acta Phytopathol. Sin. 2015, 45, 93–96. [Google Scholar]
- Zhao, W.; Wang, T.; Qi, R.D. Rapid detection of Phytophthora capsici by loop-mediated isothermal amplification (LAMP) assay. Acta Phytopathol. Sin. 2015, 45, 93–96. [Google Scholar]
- Wang, S.L.; Qu, H.H.; Wang, Y.Z.; Wang, P.S.; Luan, B.H.; Wang, G.H. Development of a loop-mediated isothermal amplification assay for rapid detection of apple ring rot pathogen Botryosphaeria dothidea. J. Plant Protect. 2020, 47, 127–133. [Google Scholar]
- Feng, L.P.; Ni, X.; Wu, X.H.; Lu, C.Z.; Wu, C.P.; Luan, J. Loop-mediated isothermal amplification (LAMP) for detection of Pantoeastewartii subsp. stewartii. J. Plant Protect. 2015, 42, 347–352. [Google Scholar]
- Shi, Y.J.; Wang, Y.Z.; Wang, Z.Y.; Yuan, H.X.; Sun, B.J.; Chen, L.L.; Shi, Y.; Li, H.L. Loop mediated isothermal amplification assay for sensitive and rapid detection of Fusarium pseudograminearum. Acta Phytopathol. Sin. 2016, 46, 566–568. [Google Scholar]
- Jing, X.K.; Lv, S.; Liu, X.Y.; Wang, Y.; Wu, T.; Zhang, X.Z.; Han, Z.H.; Li, T.H. Mapping quantitative trait loci associated with Alternaria leaf blotch susceptibility in a Malus asiatica × M. domestica interspecific population. J. China Agric. Univ. 2014, 6, 140–147. [Google Scholar]
- Zhang, C.X.; Tian, Y.; Cong, P.H. Proteome analysis of pathogen-responsive proteins from apple leaves induced by the Alternaria blotch Alternaria alternata. PLoS ONE 2015, 10, 6. [Google Scholar]
Primer Name | Purpose | Sequence (5′-3′) |
---|---|---|
F3 | LAMP detection | AAGATCACTGTCAAGGGCG |
B3 | LAMP detection | ATGGTAAGACCATCGCAGC |
FIP (F1c-F2) * | LAMP detection | TGGGCTTGGTCTTTCCACCATTCCGAGGGATCTGTTCTCAAC |
BIP (B1c-B2) * | LAMP detection | TTCTCCGCTCACAAACTGACCGAACGACTTGGACGGGAGG |
LF | LAMP detection | ACCAACGAGCACCATCACC |
LB | LAMP detection | ACTCCACCATCACCGGCAT |
aapg-1-F | PCR detection | CGTCCCTTCAGGCACAACTT |
aapg-1-R | PCR detection | AAACCTTAGCGCCATCAATG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, B.; Li, Z.; Du, J.; Zhang, W.; Che, X.; Zhang, Z.; Chen, P.; Wang, Y.; Li, Y.; Wang, S.; et al. Loop-Mediated Isothermal Amplification (LAMP) for the Rapid and Sensitive Detection of Alternaria alternata (Fr.) Keissl in Apple Alternaria Blotch Disease with Aapg-1 Encoding the Endopolygalacturonase. Pathogens 2022, 11, 1221. https://doi.org/10.3390/pathogens11111221
Liu B, Li Z, Du J, Zhang W, Che X, Zhang Z, Chen P, Wang Y, Li Y, Wang S, et al. Loop-Mediated Isothermal Amplification (LAMP) for the Rapid and Sensitive Detection of Alternaria alternata (Fr.) Keissl in Apple Alternaria Blotch Disease with Aapg-1 Encoding the Endopolygalacturonase. Pathogens. 2022; 11(11):1221. https://doi.org/10.3390/pathogens11111221
Chicago/Turabian StyleLiu, Baoyou, Zhiwei Li, Jianfeng Du, Wei Zhang, Xiaozhi Che, Ziran Zhang, Ping Chen, Yingzi Wang, Yang Li, Shaoli Wang, and et al. 2022. "Loop-Mediated Isothermal Amplification (LAMP) for the Rapid and Sensitive Detection of Alternaria alternata (Fr.) Keissl in Apple Alternaria Blotch Disease with Aapg-1 Encoding the Endopolygalacturonase" Pathogens 11, no. 11: 1221. https://doi.org/10.3390/pathogens11111221
APA StyleLiu, B., Li, Z., Du, J., Zhang, W., Che, X., Zhang, Z., Chen, P., Wang, Y., Li, Y., Wang, S., & Ding, X. (2022). Loop-Mediated Isothermal Amplification (LAMP) for the Rapid and Sensitive Detection of Alternaria alternata (Fr.) Keissl in Apple Alternaria Blotch Disease with Aapg-1 Encoding the Endopolygalacturonase. Pathogens, 11(11), 1221. https://doi.org/10.3390/pathogens11111221