Next Article in Journal
Fluorescent Light Energy in the Management of Multi Drug Resistant Canine Pyoderma: A Prospective Exploratory Study
Previous Article in Journal
Antagonism of Rhizosphere Streptomyces yangpuensis CM253 against the Pathogenic Fungi Causing Corm Rot in Saffron (Crocus sativus L.)
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genetic Correlation of Virulent Salmonella Serovars (Extended Spectrum β-Lactamases) Isolated from Broiler Chickens and Human: A Public Health Concern

1
Department of Microbiology, Faculty of Veterinary Medicine, Cairo University, Giza 12211, Egypt
2
Department of Bacteriology, Mycology and Immunology, Faculty of Veterinary Medicine, Beni-Suef University, Beni-Suef 62511, Egypt
3
Department of Poultry Diseases, National Research Centre, Giza 12622, Egypt
4
Agricultural Research Center (ARC), Animal Health Research Institute-Mansoura Provincial Lab (AHRI-Mansoura), Giza 12618, Egypt
5
Department of Animal Hygiene and Zoonoses, Faculty of Veterinary Medicine, New Valley University, El Kharga 72511, Egypt
6
Department of Poultry and Fish Diseases, Faculty of Veterinary Medicine, Damanhour University, Damanhour 22511, Egypt
*
Authors to whom correspondence should be addressed.
Pathogens 2022, 11(10), 1196; https://doi.org/10.3390/pathogens11101196
Submission received: 10 September 2022 / Revised: 4 October 2022 / Accepted: 14 October 2022 / Published: 17 October 2022
(This article belongs to the Special Issue Detection of Foodborne Pathogens by Means of Omics Technologies)

Abstract

This study aimed to detect the virulent Salmonella serovars (including ESBLs producing) isolated from broiler chickens and humans. Three hundred broilers and sixty human fecal samples were bacteriologically examined. Thirty (10%) and fourteen (23.4%) Salmonella isolates were recovered from broiler and human samples, respectively. The most predominant serovar was S. enteritidis and S. typhimurium. All Salmonella isolates were confirmed by conventional PCR-based invA and ompA genes. Multidrug resistant (MDR) isolates were screened for the detection of adrA and csgD biofilm-associated genes, which were found in all isolated serovars except one S. typhimurium and 2 S. infantis of chicken isolates that were devoid of the adrA gene. Moreover, MDR isolates were screened for detection of seven resistance genes including ESBLs and other classes of resistance genes. Chicken isolates harbored blaTEM, int1, blaCTX and qnrS genes as 100, 27.8, 11.1 and 11.1%, respectively, while all human isolates harbored blaTEM, int1 and int3 genes. The genetic correlations between virulent Salmonella serovars (including antimicrobial resistance) avian and human origins were compared. In conclusion, the high prevalence of virulent ESBL producing Salmonella serovars in broilers and humans with genetic correlations between them might be zoonotic and public health hazards.

1. Introduction

Salmonellae are very important bacterial pathogens affecting the poultry industry and human health [1]. Their principal habitat is the intestinal tract of humans, animals and birds, causing significant morbidity and mortality worldwide [2]. The Centers for Disease Control and Prevention (CDC) divided genus Salmonella into two species—Salmonella enterica and Salmonella bongori [3]. There are approximately 2600 serovars of Salmonella have been identified depending on the differences in their lipopolysaccharide layer with regard to their somatic (O) and flagellar (H) antigens [4]. The identification of salmonellae biochemically and serologically are time consuming; therefore, molecular methods based on DNA technology are recommended [5].
Salmonellae are invasive bacteria and their ability to infect and invade a host depends on the existence of many virulence factors. At least 60 genes are located on Salmonella pathogenicity islands (SPIs), which play the main role in Salmonella pathogenicity—especially SPI-1 and SPI-2—encoding structural proteins forming needle-like complexes allowing the insertion of the bacterial proteins into the host cells and modulating the cellular functions and immune pathways [1]. The invasion-related (invA) gene is located within SPI-1 on the chromosome encoding inner membrane protein of the bacteria specific for invasion of the epithelial cells of the host [6]. The invA gene is one of the most common PCR targeting genes and its amplification is considered an international standard for the determination of Salmonella [7]. Moreover, among outer membrane proteins (OMPs), OmpA is a major Salmonella antigenic protein, which is common to the majority of the stimulatory fractions; therefore, the ompA gene is highly specific for the detection of Salmonella serovars [8].
Antimicrobial misuse in therapy, prophylaxis, or as growth promoters has been implicated as a risk factor in the development and spreading of antimicrobial resistance (AMR) [1] leading to the limitation of therapeutic options available for the human salmonellosis treatment [9]. Β-lactams; penicillins and cephalosporins, are drugs of choice for the treatment of Salmonella [10]. The extended spectrum β-lactamases (ESBLs) and plasmid-mediated ampC β-lactamase are essential causes of antimicrobial resistance (AMR) [11]. In Enterobacteriaceae, resistance to cephalosporins is connected with the production of large spectrum β-lactamase as ESBLs and ampC β-lactamase [11]. ESBLs are widely reported all over the world and have been associated with successful enterobacterial clones having huge epidemic potential [12,13]. ESBLs are plasmid-mediated β-lactamase enzymes that hydrolyze penicillins, 3rd and 4th generation cephalosporins and monobactams with an oxyimino side chain [14]. ESBLs coding plasmids also carry resistance genes for other antimicrobial classes as aminoglycosides [15].
As it is very important to have knowledge about the behavior of Salmonella strains against antimicrobial agents, this study was planned to record the updates of virulence and ESBL among Salmonella serovars recovered from broiler chickens as well as of human origin and seeking the detection of correlations between broiler and human Salmonellae.

2. Materials and Methods

2.1. Ethical Approval

The study was approved from Beni-Suef University, Institutional Animal Care and Use Committee [BSU-IACU/ http://www.bsu.edu.eg (accessed on 1 January 2019)].

2.2. Samples

A total of 360 fecal samples (300 from broiler chickens and 60 from humans) were collected in plastic screw-top tubes containing sterile 10 mL buffered peptone water (BPW) (Oxoid Ltd., Basingstoke, UK) under complete hygienic conditions and transported in an ice box to the laboratory of the Faculty of Veterinary Medicine, Beni-Suef University, for bacteriological examination. Regarding the history of chicken samples, they were collected from 30 broiler chicken flocks resembling five Egyptian governorates during 2019–2020 with a total no. of 300,000 birds aged 1 to 14 days that were suffering from diarrhea, unabsorbed yolk sac, enteritis, arthritis and conjunctivitis. For human samples, all were collected from 60 patients aged 30–40 years during 2020, who were suffering from enteritis and hepatic problems.

2.3. Isolation, Identification and Serotyping of Salmonella Isolates

Next, 0.1 mL of BPW broth was transferred into tubes containing 10 mL Rappaport Vassiliadis broth (RVB) medium and was incubated at 41.5 °C for 24 h. A loopful from RVB was streaked onto xylose-lysine-deoxycholate (XLD) agar plates (Oxoid Ltd., Basingstoke, UK) and was incubated at 37 °C for 24 h. The colonies were examined for their cultural characteristics and morphological appearance. The suspected Salmonella colonies, red colonies with black centers, were subjected to Gram’s staining and biochemical identification [16]. Moreover, suspected Salmonella isolates were serotyped according to the Kauffman–White scheme using slide agglutination with standard “O” and “H” antisera (Difco, Sparks, MD, USA) [16].

2.4. Antimicrobial Susceptibility Testing

All Salmonella isolates were tested for their antimicrobial susceptibility against 13 different antimicrobial agents using the Kirby–Bauer disc diffusion method on Mueller Hinton Agar (Oxoid Ltd., Basingstoke, UK) according to the guidelines of CLSI [17]. The antimicrobials selected were those commonly used in the poultry industry, namely Cephalosporin group (Cefotaxime CTX, Ceftazidime CAZ, Ceftriaxone CRO, Cephalexin CL; 30 µg), Penicillins (Ampicillin AM; 10 μg, Ampicillin-Sulbactam SAM; 10 μg, Amoxicillin-clavulanic AMC; 30 µg), Carbapenems (Impenem IPM; 10 μg), Monobactams (Aztreonam ATM; 30 µg), Potentiated Sulfonamides (Sulfamethoxazole-trimethoprim SXT; 25 μg), Fluoroquinolones (Ciprofloxacin CIP; 5 μg) and Aminoglycosides (Amikacin AK; 30 μg, and Gentamicin CN; 10 μg) (Oxoid Ltd., Basingstoke, UK). Resistance to two or more antimicrobials of different classes was considered to be multidrug resistant (MDR) [1].

2.5. Conventional Polymerase Chain Reaction (cPCR) on Salmonella Isolates

All Salmonella isolates were confirmed by cPCR using invA and ompA virulence genes. Moreover, MDR Salmonella serovars were screened for their existence in 2 adrA and csgD biofilm-associated genes as well as 7 resistance genes including ESBL genes; blaTEM, blaOXA-1, blaCTX, blaMOX and class 1, 2 and 3 integrons (int1, int2, int3), as well as the quinolone resistance gene (qnrA and qnrS).
Genomic DNA of the selected Salmonella isolates was extracted using the QIAamp DNA mini kit (Qiagen, Germany, Gmbh) according to the manufacturer’s instructions. The primers sequences and amplified products for the targeted genes for Salmonella isolates are depicted in Table 1.

3. Results

3.1. Occurrence of Salmonella Serovars in Chicken and Human Fecal Samples

Out of 300 broiler chicken fecal samples, 30 Salmonella isolates (10%) were recovered and serotyped. The most frequent serotype was S. enteritidis as six isolates (20%), then S. infantis (n = 5; 16.6%), each of S. typhimurium, S. kentucky, S. heidelberg, S. hader and S. newport (n = 3; 10% for each), S. blegdam (n = 2; 6.6%) and finally S. maloe and S. geueletepee (n = 1; 3.3% for each). Regarding the human fecal samples (n = 60); 14 Salmonella serotypes (23.4%) were identified and serotyped as five S. enteritidis and S. typhimurium (35.7% for each), three S. anatum (21.4%) and one S. derby (7.1%) (Table 2).

3.2. Antimicrobial Susceptibility Profiles

The results in Table 3 show that broiler chicken Salmonella serovars exhibited resistance to imipenem (83.3%), cefotaxime (80%), ceftriaxone (73.3%), aztreonam (70%), sulphamethoxazol-trimethoprim and ciprofloxacin (66.6% for each) and amikacin (60%). On the other hand, they showed sensitivity to cephalexin (73.3%) and gentamicin (70%). Eighteen Salmonella isolates (60%) were MDR. Meanwhile, human Salmonella serovars exhibited complete sensitivity to ceftazidime, amikacin and sulphamethoxazol-trimethoprim (100%) and high sensitivity to the other antimicrobials (78.5–92.8%). Four Salmonella isolates (28.6%) were MDR.

3.3. PCR for Screening Virulence and Resistance Genes in Salmonella Isolates

All the chicken and human Salmonella serovars were confirmed using PCR as they all harbored both invA and ompA genes (100%). Regarding adrA and csgD biofilm-associated genes in MDR Salmonella serovars, all tested chicken isolates (n = 18) harbored the csgD gene (100%) while 15 (83.3%) harbored the adrA gene. Meanwhile, all human isolates harbored both genes (100%) (Table 4).
Regarding resistance genes in MDR Salmonella serovars, all tested chicken isolates harbored the blaTEM gene (100%) while five (27.8%) harbored the int1 gene and two isolates harbored both blaCTX and qnrS genes (11.1% for each). On the other hand, blaOXA-1, blaMOX, int2, int3 and qnrA genes were not found. Meanwhile, all human isolates harbored blaTEM, int1 and int3 genes (100%) while the other resistance genes were not found (Table 4).

3.4. Correlation between Virulence Genes and Antimicrobial Resistance among Salmonella Isolates from Broilers and Human

The results in Table 5 revealed that the virulence genes—invA, ompA, csgD and adrA—existed in all MDR Salmonella serovars recovered from broiler chicken and human fecal samples except one S. typhimurium and two S. infantis isolates from broiler chickens, which did not have the adrA gene. A detailed analysis displayed an association of resistance phenotypes with potential virulence genes. The present study confirmed the relation between AMR and virulence genes in Salmonella serovars of avian and human origins.

4. Discussion

Avian Salmonellosis causes great morbidity, mortalities and consequently great economic losses in poultry industries with public health and zoonotic hazards [25]. This study included bacteriological examination of 300 broiler chicken and 60 human fecal samples and a molecular characterization of major virulence and AMR-associated genes. The obtained results showed that 30 Salmonella serovars (10%) were recovered from broilers while 14 serovars (23.4%) were recovered from 60 human fecal samples with a total percentage of 12.2%. The total prevalence was slightly lower than that reported by Tegegne [26] who recovered Salmonella from different sources with an overall prevalence of 16.9%. Regarding broilers, the obtained results were nearly similar to those of other studies [27]; 9.2%, and [28] 12%, while it was much lower than that recorded by other authors; [29] 30.5% and [26] 42.9%. The most frequent serovars in broilers were S. enteritidis (20%), S. infantis (16.6%), S. typhimurium and S. kentucky (10% for each). The most prevalent serotypes were S. enteritidis, S. typhimurium, S. pullorum, S. vejle, S. amsterdam, S. infantis, S. petersburg, and S. atakpame [30]. These results run parallel to those recorded by [1,28] as S. enteritidis, S. typhimurium and S. kentuky and S. infantis were the most frequent broiler chicken isolated serovars. For human samples, such prevalence was double that recorded in Ethiopia (11.3%) [26]. The most frequent human serovars were S. enteritidis and S. typhimurium (35.7% for each), S. anatum (21.4%) and S. derby (7.1%). These results coincided with those recorded by other authors [26,31] who recorded that S. enteritidis, S. typhimurium and S. derby were the most dominant non-typhoidal Salmonella serotypes in humans.
The virulence of Salmonella is related to its capability to invade a host cell, replicate and resist both digestion by macrophages and destruction by complement components of plasma [1,6]. The invA gene-based PCR assay is considered an international standard procedure for the detection and confirmation of Salmonella spp. and mostly reduces the number of false-negative results commonly occurring in diagnostic laboratories [7]. Recently in Nigeria, 75% of Salmonella isolated from hospitalized febrile patients harbored the invA gene [32]. Moreover, the ompA virulence gene plays an important role in bacterial adaptation to external environment stresses, which cause adhesion, invasion and host tissue damage [33]. The ompA gene was conserved among various Salmonella serovars and can be used, with high sensitivity and specificity, for Salmonella detection in food and clinical samples [8,34]. In our study, all the isolated Salmonella serovars were confirmed by cPCR using invA and ompA virulence genes. Additionally, MDR Salmonella serovars were screened for the presence of adrA and csgD biofilm-associated genes which are responsible for cellulose production. The four tested genes were found in almost all chicken and human Salmonella isolates except for one S. typhimurium and two S. infantis chicken isolates which lack the adrA gene. The high expression of adrA and csgD genes, which are necessary for regulating cellulose production in Salmonella spp., showed a strong biofilm production capacity. These results are supported by those recorded by previous studies [35] in which all Salmonella isolates harbored the invA gene while 90% contained csgD gene. Ćwiek et al. [36] recorded the prevalence of adrA and csgD as 100.0% for S. enteritidis. The obtained results were consistent with others who detected them in S. enteritidis and other Salmonella serovars [18,37,38]. The presence of these genes and their expression might be useful in Salmonella biofilm production via involvement in the synthesis of biofilm extracellular polymeric components [33]. Another study showed the presence of the csgD gene in all Salmonella isolates [39].
Antimicrobial agents are an effective tool for treating clinical diseases and maintaining healthy animals and human health. However, there is an increasing resistance of Salmonella to conventional therapeutic antimicrobial agents such as penicillins, sulfonamides, cephalosporins, amoxicillin-clavulanic and fluoroquinolones, which have been increasingly misused [31]. Antimicrobial-resistant Salmonellae create a public hazard, diminishing the therapeutic options available in the treatment of human salmonellosis [28]. In this study, 60% of broiler chicken Salmonella serovars were MDR, exhibiting resistance to β-lactams, cephalosporins, sulfonamides and fluoroquinolones. Meanwhile, only 28.6% of human Salmonella serovars were MDR, exhibiting lower resistance against β-lactams, cephalosporins, sulfonamides, fluoroquinolones and other antimicrobials used. These results resembled those recorded by other studies [31,36].
Antimicrobial resistance of Salmonella is one of the major virulence factors that enables the bacteria to survive and to be more pathogenic and toxigenic. ESBLs and plasmid-mediated ampC β-lactamase are essential causes of AMR [11]. ESBLs are one of the main causes of β-lactam resistance, including penicillin, 1st, 2nd and 3rd generations’ cephalosporins and monobactams by hydrolysis of antibiotics, among Gram-negative bacteria [40], and they can be inhibited by β-lactamase inhibitors such as clavulanic acid [14]. ESBLs coding plasmids may also carry additional β-lactamase genes and other resistance genes for other classes of antimicrobial [15]. This can restrict the treatment options for ESBL-producing pathogens and enhance the intra- and inter-species spreading of ESBLs [12]. There are many groups of ESBLs but those most frequently found in clinical Gram-negative isolates are TEM-, SHV-, OXA-, CMY- and CTX-M- types [1,41].
In the current study, all broiler chicken and human MDR Salmonella isolates were investigated using cPCR for seven resistance genes including ESBL and other AMR-associated genes (blaTEM, blaOXA-1, blaCTX, blaMOX, int1, int2, int3, qnrA and qnrS). Regarding broiler chicken isolates, only blaTEM, int1, blaCTX and qnrS genes were represented as 100, 27.8, 11.1 and 11.1%, respectively. Meanwhile, all human isolates included blaTEM, int1 and int3 genes (100%). These results agreed with those obtained by Abdel Aziz et al. [42], who detected blaTEM and int1 in all the tested Salmonella serovars recovered from broilers and humans. Additonally, the obtained results supported the fact that TEM-1 is the most popular plasmid mediated β-Lactamase in resistant Gram-negative bacteria [43]. The high blaTEM gene frequency in our study also corresponded with Zhu et al. [44]. In other studies, the blaTEM gene existed in 51.6% of Salmonella isolates [45] while Ćwiek et al. [36] detected it in 63.6% of isolates. The existence of ESBLs in all samples in our study indicated a shortage of infection barriers between humans and broilers.
Integrons are genetic elements that can recognize and capture movable gene cassettes carrying the AMR genes leading to MDR dissemination and limiting the chemotherapeutic options available for infectious diseases [42]. Regarding integrons genes, our results supported that int1 (class 1 integrons) was the most frequent in Salmonellae [46]. Additionally, the int1 gene was found in all Salmonella serovars recovered from poultry and humans [47], while it was found in another study in 82% of isolates [48]. The presence of int1 in Salmonellae was significantly associated with their AMR and this clearly indicates their important role in the dissemination of AMR genes [42].
The results recorded in this study strongly indicate a correlation between virulence genes and resistance to the most commonly used antimicrobial agents. The relation between virulence and AMR among Salmonella serovars occurred because of genetic determinants of AMR- and virulence-associated genes [49]. AMR- and virulence-associated genes may be linked in the same replicon [50]. Finally, the detection of chickens-to-human Salmonella strains’ transmission during farming was widely demonstrated and this may occur through the food chain or by direct contact with live broiler chickens during industrial production [25,51].

5. Conclusions

ESBLs producing virulent Salmonella serovars are a hazard to food safety and public health, creating severe therapeutic problems in the future. The relationship between human and broiler chicken strains strongly indicates that the poultry sector may be considered a very important reservoir for ESBL-producing Salmonella, which transmits to humans through the food chain and/or direct contact. However, further studies are badly needed to evaluate the expression of virulence genes using qPCR and compare them with non-virulent serotypes devoid of ESBL genes, which may indicate a variable measurable quantitative analysis of the virulence of the serovars isolated from the chicken farms in order to assess a correlation with the presence and activity of ESBL.

Author Contributions

Conceptualization, I.A.R., W.A., A.O. and A.R.E.; Data curation, A.O., W.A. and A.R.E.; Resources, A.O., Z.M.S.A.G., E.H., M.S.D. and I.A.R.; Methodology, A.O., Z.M.S.A.G., E.H., M.S.D. and I.A.R.; Supervision, I.A.R., W.A., A.O. and A.R.E.; writing—original draft, A.O, A.R.E. and I.A.R.; writing—review and editing, I.A.R., W.A., A.O., A.R.E. and M.S.D. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The study was approved from Beni-Suef University, Institutional Animal Care and Use Committee (BSU-IACU/ http://www.bsu.edu.eg [accessed on 1 January 2019]).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Acknowledgments

The authors would like to thank the Bacteriology, Mycology, and Immunology Department staff at the Faculty of Veterinary Medicine, Beni-Suef University, and staff of Microbiology Department, Faculty of Veterinary Medicine, Cairo University, Egypt, for providing technical help.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Hassan, W.H.; Abed, A.H.; Thabet, A.; El Nady, E.A.M. Genetic analysis of multidrug resistant Salmonella isolated from broiler chickens. J. Vet Med. Res. 2018, 25, 121–131. [Google Scholar] [CrossRef] [Scilit]
  2. Threlfall, E.J. Antimicrobial drug resistance in Salmonella: Problems and perspectives in food- and water-borne infections. FEMS Microbiol. Rev. 2002, 26, 141–148. [Google Scholar] [CrossRef] [PubMed]
  3. Centers for Disease Control (CDC). Incidence and trends of infection with pathogens transmitted commonly through food—Foodborne Diseases Active Surveillance Network, 10 U.S. Sites, 1996–2012. Wkly. Rep. 2013, 62, 283–287. [Google Scholar]
  4. Gal-Mor, O.; Boyle, E.C.; Grassl, G.A. Same species, different diseases: How and why typhoidal and non-typhoidal Salmonella enterica serovars differ. Front. Microbiol. 2014, 5, 391. [Google Scholar] [CrossRef] [Scilit]
  5. Ed-Dra, A.; Filali, F.R.; Karraouan, B.; El-Allaoui, A.; Aboulkacem, A.; Bouchrif, B. Prevalence, molecular and antimicrobial resistance of Salmonella isolated from sausages in Meknes, Morocco. Microb. Pathog. 2017, 105, 340–345. [Google Scholar] [CrossRef] [Scilit]
  6. Amavisit, P.; Lightfoot, D.; Browning, G.F.; Markham, P.F. Variation between pathogenic serovars within Salmonella pathogenicity islands. J. Bacteriol. 2003, 185, 3624–3635. [Google Scholar] [CrossRef] [Scilit]
  7. Malorny, B.; Hoorfar, J.; Hugas, M.; Heuvelink, A.; Fach, P.; Ellerbyoek, L.; Bunge, C.; Dorn, C.; Helmuth, R. Inter laboratory diagnostic accuracy of a Salmonella specific PCR-based method. Int. J. Food Microbiol. 2003, 89, 241–249. [Google Scholar] [CrossRef] [Scilit]
  8. Kataria, J.L.; Kumar, A.; Rajagunalan, S.; Jonathan, L.; Agarwal, R.K. Detection of OmpA gene by PCR for specific detection of Salmonella serovars. Vet. World 2013, 6, 911–914. [Google Scholar] [CrossRef] [Scilit]
  9. Foley, S.L.; Nayak, R.; Hanning, I.B.; Johnson, T.J.; Han, J.; Ricke, S.C. Population dynamics of Salmonella enterica serotypes in commercial egg and poultry production. Appl Environ. Microbiol. 2011, 77, 4273–4279. [Google Scholar] [CrossRef] [Scilit]
  10. Chiaretto, G.; Zavagnin, P.; Bettini, F.; Mancin, M.; Minorello, C.; Saccardin, C.; Ricci, A. Extended spectrum β-lactamase SHV-12-producing Salmonella from poultry. Vet. Microbiol. 2008, 128, 406–413. [Google Scholar] [CrossRef] [Scilit]
  11. Carmo, L.P.; Neilsen, L.R.; da Costa, P.M.; Alban, L. Exposure assessment of extended-spectrum beta-lactamases ampC beta-lactamases producing E. coli in meat in Denmark. Infect. Ecol. Epidmiol. 2014, 4, 22924. [Google Scholar] [CrossRef] [Scilit]
  12. Zahar, J.R.; Lortholary, O.; Martin, C.; Potel, G.; Plesiat, P.; Nordmann, P. Addressing the challenge of extended-spectrum β-lactamases. Curr. Opin. Investig. Drugs 2009, 10, 172–180. [Google Scholar]
  13. Kaonga, N.; Hang’ombe, B.M.; Lupindu, A.M.; Hoza, A.S. Detection of CTX-M-Type extended spectrum beta-lactamase producing Salmonella Typhimurium in commercial poultry farms in Copperbelt Province, Zambia. Ger. J. Vet. Res. 2021, 2, 27–34. [Google Scholar] [CrossRef] [Scilit]
  14. Poulou, A.; Grivakou, E.; Vrioni, G.; Koumaki, V.; Pittaras, T.; Pournaras, S.; Tsakris, A. Modified CLSI Extended spectrum β-Lactamase (ESBL) confirmatory test for phenotypic detection of ESBLs among Enterobacteriaceae producing various β-Lactamases. J. Clin. Microbiol. 2014, 52, 1483–1489. [Google Scholar] [CrossRef] [Scilit]
  15. Carattoli, A. Resistance plasmid families in Enterobacteriaceae. Antimicrob. Agents Chemother. 2009, 53, 2227–2238. [Google Scholar] [CrossRef] [Scilit]
  16. Quinn, P.J.; Carter, M.E.; Markey, B.K.; Leonard, F.C.; Hartigan, P.; Fanning, S.; Fitzpatrick, E.S. Veterinary Microbiology and Microbial Disease Textbook, 2nd ed.; Blackwell Science Ltd.: Wiley-Blackwell, UK, 2011; pp. 115–165. [Google Scholar]
  17. M100–S27; Performance Standards for Antimicrobial Susceptibility Testing. 27th ed. Informational Supplement. Clinical and Laboratory Standards Institute (CLSI): Wayne, PA, USA, 2018; Volume 37, No. 1.
  18. Shanmugasamy, M.; Velayutham, T.; Rajeswar, J. InvA gene specific PCR for detection of Salmonella from broilers. Vet. World 2011, 4, 562–564. [Google Scholar] [CrossRef] [Scilit]
  19. Bhowmick, P.P.; Devegowda, D.; Ruwandeepika, H.D.; Fuchs, T.M.; Srikumar, S.; Karunasagar, I.; Karunasagar, I. gcpA (stm1987) is critical for cellulose production and biofilm formation on polystyrene surface by Salmonella enterica serovar Weltevreden in both high and low nutrient medium. Microb. Pathog. 2011, 50, 114–122. [Google Scholar] [CrossRef] [Scilit]
  20. Colom, K.; Pérez, J.; Alonso, R.; Fernández-Aranguiz, A.; Lariño, E.; Cisterna, R. Simple and reliable multiplex PCR assay for detection of blaTEM, blaSHV and blaOXA-1 genes in Enterobacteriaceae. FEMS Microbiol. Lett. 2003, 223, 147–151. [Google Scholar] [CrossRef] [Scilit]
  21. Archambault, M.; Petrov, P.; Hendriksen, R.S.; Asseva, G.; Bangtrakulnonth, A.; Hasman, H.; Aarestrup, F.M. Molecular characterization and occurrence of extended-spectrum β-lactamase resistance genes among Salmonella enterica serovar Corvallis from Thailand, Bulgaria, and Denmark. Microb. Drug Resist. 2006, 12, 192–198. [Google Scholar] [CrossRef] [Scilit]
  22. Pérez-Pérez, F.J.; Hanson, N.D. Detection of plasmid-mediated ampC β-lactamase genes in clinical isolates by using multiplex PCR. J. Clin. Microbiol. 2002, 40, 2153–2162. [Google Scholar] [CrossRef] [Scilit]
  23. Kashif, J.; Buriro, R.; Memon, J.; Yaqoob, M.; Soomro, J.; Dongxue, D.; Jinhu, H.; Liping, W. Detection of class 1 and 2 integrons, β-lactamase genes and molecular characterization of sulfonamide resistance in Escherichia coli isolates recovered from poultry in China. Pak. Vet. J. 2013, 33, 321–324. [Google Scholar]
  24. Robicsek, A.; Strahilevitz, J.; Sahm, D.F.; Jacoby, G.A.; Hooper, D.C. qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States. Antimicrob. Agents Chemother. 2006, 50, 2872–2874. [Google Scholar] [CrossRef] [Scilit]
  25. Kabir, S.M.L. Avian colibacillosis and Salmonellosis: A Closer look at epidemiology, pathogenesis, diagnosis, control and public health concerns. Int. J. Environ. Res. Public Health 2010, 7, 89–114. [Google Scholar] [CrossRef] [Scilit]
  26. Tegegne, F.M. Epidemiology of Salmonella and its serotypes in human, food animals, foods of animal origin, animal feed and environment. J. Food Nutr. Health 2019, 2, 7–14. [Google Scholar]
  27. Mahmoud, A.E.A.; Moussa, H.M. Studies on some aerobic bacterial causing of broilers. Egyptian J. Agri. Res. 2000, 78, 25–34. [Google Scholar]
  28. Radwan, I.A.; Abed, A.H.; Abd Al-Wanis, S.A.; Abd El-Aziz, G.G. Antibacterial effect of cinnamon and oreganium oils on multidrug resistant Escherichia coli and Salmonellae isolated from broiler chickens. J. Egypt. Vet. Med. Assoc. 2016, 76, 169–186. [Google Scholar]
  29. Sharada, R.; Krishneppa, G.; Raghavan, R.; Gowda, R.N.S.; Upendra, H.A. Isolation and serotyping of Escherichia coli from different pathological conditions in poultry. Ind. J. Poult. Sci. 1999, 34, 336–369. [Google Scholar]
  30. Shehata, A.A.; Basiouni, S.; Abd Elrazek, A.; Sultan, H.; Tarabees, R.; Elsayed, M.S.A.; Talat, S.; Moharam, E.; Said, A.; Mohsen, W.A.; et al. Characterization of Salmonella enterica Isolated from Poultry Hatcheries and Commercial Broiler Chickens. Pak. Vet. J. 2019, 39, 515–520. [Google Scholar] [CrossRef] [Scilit]
  31. Andoh, L.A.; Ahmed, S.; Olsen, J.E.; Obiri-Danso, K.; Newman, M.J.; Opintan, J.A.; Barco, L.; Dalsgaard, A. Prevalence and characterization of Salmonella among humans in Ghana. Trop. Med. Health 2017, 45, 3. [Google Scholar] [CrossRef] [Scilit]
  32. Akinyemi, K.O.; Fakorede, C.O.; Abegunrin, R.O.; Ajoseh, S.O.; Anjorin, A.A.; Amisu, K.O.; Opere, B.O.; Moro, D.D. Detection of invA and blaCTM-genes in Salmonella spp. isolated from febrile patients in Lagos hospitals, Nigeria. Ger. J. Microbiol. 2021, 1, 1–10. [Google Scholar] [CrossRef] [Scilit]
  33. Confer, A.W.; Ayale, W.S. The OmpA A family of proteins; Roles in bacterial pathogenesis and immunity. Vet. Microb. 2013, 163, 207–222. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Okamura, M.; Ueda, M.; Noda, Y.; Kashimoto, T.; Takehara, K.; Nakamura, M. Immunization with outer membrane protein from Salmonella enterica serovar Enteritidis induces humoral immune response but no protection against homologous challenge in chickens. Poult. Sci. 2012, 91, 2444–2449. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Elkenany, R.; Elsayed, M.M.; Zakaria, A.I.; El-Sayed, S.A.E.S.; Rizk, M.A. Antimicrobial resistance profiles and virulence genotyping of Salmonella enterica serovars recovered from broiler chickens and chicken carcasses in Egypt. BMC Vet. Res. 2019, 15, 124. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Ćwiek, K.; Korzekwa, K.; Tabiś, A.; Bania, J.; Bugla-Płoskońska, G.; Wieliczko, A. Antimicrobial resistance and biofilm formation capacity of Salmonella enterica serovar Enteritidis strains isolated from poultry and humans in Poland. Pathogens 2020, 9, 643. [Google Scholar] [CrossRef] [Scilit]
  37. Halatsi, K.; Oikonomou, I.; Lambiri, M.; Mandilara, G.; Vatopoulos, A.C.; Kyriacou, A. PCR detection of Salmonella spp. using primers targeting the quorum sensing gene sdiA. FEMS Microbiol. Lett. 2006, 259, 201–207. [Google Scholar] [CrossRef] [Scilit]
  38. Ziech, R.E.; Perin, A.P.; Lampugnani, C.; Sereno, M.J.; Viana, C.; Soares, V.M.; Pereira, J.G.; Pinto, J.P.d.A.N.; Bersot, L.D.S. Biofilm-producing ability and tolerance to industrial sanitizers in Salmonella spp. isolated from Brazilian poultry processing plants. LWT Food Sci. Technol. 2016, 68, 85–90. [Google Scholar] [CrossRef] [Scilit]
  39. Hawash, H.M.; El-Enbaawy, M.I.H.; Nasef, S.A. Biofilm producing non- typhoidal Salmonella serovars field isolates screening from poultry farms. Biosci. Res. 2017, 14, 1050–1056. [Google Scholar]
  40. Rawat, D.; Nair, D. Extended-spectrum beta-lactamases in Gram Negative Bacteria. J. Glob. Infect. Dis. 2010, 2, 263–274. [Google Scholar] [CrossRef] [Scilit]
  41. Bush, K.; Fisher, J.F. Epidemiological expansion, structural studies, and clinical challenges of new β-lactamases from Gram-negative bacteria. Annu. Rev. Microbiol. 2011, 65, 455–478. [Google Scholar] [CrossRef] [Scilit]
  42. Abdel Aziz, S.A.; Abdel-Latef, G.K.; Shany, S.A.S.; Rouby, S.R. Molecular detection of integron and antimicrobial resistance genes in multidrug resistant Salmonella isolated from poultry, calves and human in Beni-Suef Governorate, Egypt. Beni-Suef Univ. J. Basic Appl. Sci. 2018, 7, 535–542. [Google Scholar] [CrossRef] [Scilit]
  43. Livermore, D.M. Beta-Lactamaes in Laboratory and Clinical Resistance. Clin. Microbial. Rev. 1995, 8, 557–584. [Google Scholar] [CrossRef]
  44. Zhu, Y.; Lai, H.; Zou, L.; Yin, S.; Wang, C.; Han, X.; Xia, X.; Hu, K.; He, L.; Zhou, K.; et al. Antimicrobial resistance and resistance genes in Salmonella strains isolated from broiler chickens along the slaughtering process in China. Int. J. Food Microbiol. 2017, 259, 43–51. [Google Scholar] [CrossRef] [Scilit]
  45. Weese, J.S. Infection control and biosecurity in equine disease control. Equine Vet. J. 2014, 46, 654–660. [Google Scholar] [CrossRef] [Scilit]
  46. Rodríguez-Baño, J. Community infections caused by extended-spectrum. Arch. Intern. Med. 2008, 168, 1897–1902. [Google Scholar] [CrossRef] [Scilit]
  47. Gharieb, R.M.; Tartor, Y.H.; Khedr, M.H.E. Nontyphoidal Salmonella in poultry meat and diarrhoeic patients: Prevalence, antibiogram, virulotyping, molecular detection and sequencing of class I integrons in multidrug resistant strains. Gut Pathog. 2015, 7, 34–44. [Google Scholar] [CrossRef] [Scilit]
  48. Mohamed, M.E.M.; Suelam, I.A. Isolation of non-typhoid Salmonella from humans and camels with reference to its survival in abattoir effluents. Glob. Vet. 2010, 5, 356–361. [Google Scholar]
  49. Dione, M.M.; Ikmapayi, U.; Saha, D.; Mohammed, I.N.; Adegbola, A.R.; Geerts, S. Antimicrobial resistance and virulence genes of non-typhoidal Salmonella isolates in the Gambia and Senegal. J. Infect. Dis. Dev. Ctries. 2011, 5, 765–775. [Google Scholar] [CrossRef] [Scilit]
  50. Martinez, Z.L.; Baquero, F. Interaction among strategies associated with bacterial infection: Pathogenicity, epidemicity, and antibiotic resistance. Clin. Microbiol. Rev. 2002, 15, 647–679. [Google Scholar] [CrossRef] [Scilit]
  51. Currie, A.; MacDougall, L.; Aramini, J.; Gaulin, C.; Ahmed, R.; Isaacs, S. Frozen chicken nuggets and strips and eggs are leading risk factors for Salmonella Heidelberg infections in Canada. Epidemiol. Infect. 2005, 133, 809–816. [Google Scholar] [CrossRef] [Scilit]
Table 1. Oligonucleotide primers of virulence and resistance genes used in PCR.
Table 1. Oligonucleotide primers of virulence and resistance genes used in PCR.
PrimersPrimer Sequence (5′-3′)Amplified ProductReference
invAF
R
GTGAAATTATCGCCACGTTCGGGCAA
TCATCGCACCGTCAAAGGAACC
284[18]
OmpAF
R
AGTCGAGCTCATGAAAAAGACAGCTATCGC
AGTCAAGCTTTTAAGCCTGCGGCTGAGTTA
1052[8]
adrAF
R
ATGTTCCCAAAAATAATGAA
TCATGCCGCCACTTCGGTGC
1113[19]
csgDF
R
TTACCGCCTGAGATTATCGT
ATGTTTAATGAAGTCCATAG
651
blaOXA-1F
R
ATATCTCTACTGTTGCATCTCC
AAACCCTTCAAACCATCC
619[20]
blaTEMF
R
ATCAGCAATAAACCAGC
CCCCGAAGAACGTTTTC
516
blaCTXF
R
ATGTGCAGYACCAGTAARGTKATGGC
TGGGTRAARTARGTSACCAGAAYCAGCG
593[21]
blaMOXF
R
GCTGCTCAAGGAGCACAGGAT
CACATTGACATAGGTGTGGTGC
520[22]
int1F
R
CCTCCCGCACGATGATC
TCCACGCATCGTCAGGC
280[23]
int2F
R
TTATTGCTGGGATTAGGC
ACGGCTACCCTCTGTTATC
250
int3F
R
AGTGGGTGGCGAATGAGTG
TGTTCTTGTATCGGCAGGTG
484
qnrAF
R
ATTTCTCACGCCAGGATTTG
GATCGGCAAAGGTTAGGTCA
516[24]
qnrSF
R
ACGACATTCGTCAACTGCAA
TAAATTGGCACCCTGTAGGC
417
Table 2. Salmonella serotypes isolated from broiler chicken and human fecal samples.
Table 2. Salmonella serotypes isolated from broiler chicken and human fecal samples.
Salmonella SerotypeNo. of Isolates%
Broiler chicken isolated serotypes (n = 30)
S. enteritidis620
S. infantis516.6
S. typhimurium310
S. kentucky310
S. heidelberg310
S. hader310
S. newport310
S. blegdam26.6
S. gueuletapee13.3
S. maloe13.3
Human isolated serotypes (n = 14)
S. enteritidis535.7
S. typhimurium535.7
S. anatum321.4
S. derby17.1
%: was calculated according to the corresponding No. of isolated serotypes.
Table 3. Antimicrobial susceptibility of Salmonella serovars isolated from broiler chickens and humans.
Table 3. Antimicrobial susceptibility of Salmonella serovars isolated from broiler chickens and humans.
Broiler Chicken Salmonella Isolates (n = 30)Human Salmonella Isolates (n = 14)
SensitiveResistantResistantResistant
No.%No.%No.%No.%
ATM93021701285.7214.3
IPM516.62583.31285.7214.3
CTX62024801392.817.2
AM1653.31446.61285.7214.3
CAZ1446.61653.314100----
CN21709301285.7214.3
CRO826.62273.31285.7214.3
CL2273.3826.61392.817.2
AK1240186014100----
SAM1756.61343.31178.5321.4
AMC1446.61653.41392.817.2
SXT1033.32066.614100----
CIP 1033.32066.61392.817.2
%: was calculated according to the corresponding No. of tested Salmonella isolates. AK (Amikacin), AMC (Amoxicillin-clavulanic), AM (Ampicillin), SAM (Ampicillin-Sulbactam), ATM (Aztreonam), CTX (Cefotaxime), CAZ (Ceftazidime), CRO (Ceftriaxone), CL (Cephalexin), CIP (Ciprofloxacin), CN (Gentamicin), IPM (Impenem), SXT (Sulfamethoxazole-trimethoprim).
Table 4. Distribution of virulence and resistance genes in Salmonella serovars isolated from broilers and humans.
Table 4. Distribution of virulence and resistance genes in Salmonella serovars isolated from broilers and humans.
invAompAcsgDadrAblaOXA-1blaTEMblaCTXblaMOXint1int2int3qnrAqnrS
MDR Salmonella Serovars from Broilers (n = 18)
S. enteritidis++++-+-------
S. enteritidis++++-+-------
S. infantis+++--+-------
S. infantis+++--+-------
S. typhimurium+++--+-------
S. typhimurium++++-+-------
S. kentucky++++-+-------
S. kentucky++++-+-------
S. hedeilberg++++-+-------
S. hedeilberg++++-+-------
S. hader++++-+--+---+
S. hader++++-+--+---+
S. blegdam++++-+-------
S. blegdam++++-+-------
S. newport++++-+--+----
S. newport++++-++-+----
S. maloe++++-++-+----
S. gueuletapee++++-+-------
Total no.
%
18
100
18
100
18
100
15
83.3
0
0
18
100
2
11.1
0
0
5
27.8
0
0
0
0
0
0
2
11.1
MDR Salmonella Serovars from Human (n = 4)
S. enteritidis++++-+--+-+--
S. typhimurium++++-+--+-+--
S. anatum++++-+--+-+--
S. derby++++-+--+-+--
Total no.
%
4
100
4
100
4
100
4
100
0
0
4
100
0
0
0
0
4
100
0
0
4
100
0
0
0
0
Table 5. Correlation between virulence genes and antimicrobial resistance between Salmonella serovars isolated from broilers and Human.
Table 5. Correlation between virulence genes and antimicrobial resistance between Salmonella serovars isolated from broilers and Human.
MDR Salmonella Serotypes from Broilers
Tested Salmonella
Serovars
Virulence Genes
Detected
Antimicrobial Resistance PatternResistance Genes
Detected
S. enteritidisinvA, adrA, csgD, ompAATM, IPM, CTX, CAZ, CRO, AK, SXT, CIPblaTEM
S. enteritidisinvA, adrA, csgD, ompAATM, IPM, CTX, AK, SAM, AMC, SXT, CIPblaTEM
S. typhimuriuminvA, adrA, csgD, ompAATM, IPM, CTX, AM, CAZ, CN, CRO, SAM, SXT, CIPblaTEM
S. typhimuriuminvA, csgD, ompACTX, CAZ, CRO, AK, SAM, AMC, SXT, CIPblaTEM
S. infantisinvA, csgD, ompAAMC, CAZ, SXTblaTEM
S. infantisinvA, csgD, ompAIMP, AM, SXTblaTEM
S. kentuckyinvA, adrA, csgD, ompAIMP, CTX, CN, CRO, AK, CIPblaTEM
S. kentuckyinvA, adrA, csgD, ompAIPM, CTX, CRO, SXT, CIPblaTEM
S. hedeilberginvA, adrA, csgD, ompAATM, IPM, CTX, CN, CRO, CL, CIPblaTEM
S. hedeilberginvA, adrA, csgD, ompAATM, IPM, CTX, AM, CAZ, CN, CRO, AK, AMC, SXT, CIPblaTEM
S. haderinvA, adrA, csgD, ompAIPM, AM, CIPblaTEM, int1, qnrS
S. haderinvA, adrA, csgD, ompAATM, IPM, CTX, AM, CRO, CL, AMC, SXT, CIPblaTEM, int1, qnrS
S. blegdaminvA, adrA, csgD, ompAATM, IMP, CTX, CAZ, CRO, CL, AK, SAM, AMCblaTEM
S. blegdaminvA, adrA, csgD, ompAATM, IMP, CTX, CAZ, CN, CRO, AK, SAM, AMC, SXT, CIPblaTEM
S. newportinvA, adrA, csgD, ompAATM, IPM, CTX, AM, CROblaTEM, int1
S. newportinvA, adrA, csgD, ompAATM, AM, CROblaTEM, blaCTX, int1
S. maloeinvA, adrA, csgD, ompACAZ, AM, AKblaTEM, blaCTX, int1
S. gueuletapeeinvA, adrA, csgD, ompAATM, IPM, CTX, CN, CL, AK, AMCblaTEM
MDR Salmonella Serotypes from Human
S. enteritidisinvA, adrA, csgD, ompAATM, IPM, CN, CRO, CIPblaTEM, int1, int3
S. typhimuriuminvA, adrA, csgD, ompAATM, IPM, CTX, AM, CN, CRO, CLblaTEM, int1, int3
S. anatuminvA, adrA, csgD, ompACAZ, AM, SAMblaTEM, int1, int3
S. derbyinvA, adrA, csgD, ompACRO, SAM, AMCblaTEM, int1, int3
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Orabi, A.; Armanious, W.; Radwan, I.A.; Girh, Z.M.S.A.; Hammad, E.; Diab, M.S.; Elbestawy, A.R. Genetic Correlation of Virulent Salmonella Serovars (Extended Spectrum β-Lactamases) Isolated from Broiler Chickens and Human: A Public Health Concern. Pathogens 2022, 11, 1196. https://doi.org/10.3390/pathogens11101196

AMA Style

Orabi A, Armanious W, Radwan IA, Girh ZMSA, Hammad E, Diab MS, Elbestawy AR. Genetic Correlation of Virulent Salmonella Serovars (Extended Spectrum β-Lactamases) Isolated from Broiler Chickens and Human: A Public Health Concern. Pathogens. 2022; 11(10):1196. https://doi.org/10.3390/pathogens11101196

Chicago/Turabian Style

Orabi, Ahmed, Wagih Armanious, Ismail A. Radwan, Zeinab M. S. A. Girh, Enas Hammad, Mohamed S. Diab, and Ahmed R. Elbestawy. 2022. "Genetic Correlation of Virulent Salmonella Serovars (Extended Spectrum β-Lactamases) Isolated from Broiler Chickens and Human: A Public Health Concern" Pathogens 11, no. 10: 1196. https://doi.org/10.3390/pathogens11101196

APA Style

Orabi, A., Armanious, W., Radwan, I. A., Girh, Z. M. S. A., Hammad, E., Diab, M. S., & Elbestawy, A. R. (2022). Genetic Correlation of Virulent Salmonella Serovars (Extended Spectrum β-Lactamases) Isolated from Broiler Chickens and Human: A Public Health Concern. Pathogens, 11(10), 1196. https://doi.org/10.3390/pathogens11101196

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop