Genetic Correlation of Virulent Salmonella Serovars (Extended Spectrum β-Lactamases) Isolated from Broiler Chickens and Human: A Public Health Concern
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethical Approval
2.2. Samples
2.3. Isolation, Identification and Serotyping of Salmonella Isolates
2.4. Antimicrobial Susceptibility Testing
2.5. Conventional Polymerase Chain Reaction (cPCR) on Salmonella Isolates
3. Results
3.1. Occurrence of Salmonella Serovars in Chicken and Human Fecal Samples
3.2. Antimicrobial Susceptibility Profiles
3.3. PCR for Screening Virulence and Resistance Genes in Salmonella Isolates
3.4. Correlation between Virulence Genes and Antimicrobial Resistance among Salmonella Isolates from Broilers and Human
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hassan, W.H.; Abed, A.H.; Thabet, A.; El Nady, E.A.M. Genetic analysis of multidrug resistant Salmonella isolated from broiler chickens. J. Vet Med. Res. 2018, 25, 121–131. [Google Scholar] [CrossRef] [Scilit]
- Threlfall, E.J. Antimicrobial drug resistance in Salmonella: Problems and perspectives in food- and water-borne infections. FEMS Microbiol. Rev. 2002, 26, 141–148. [Google Scholar] [CrossRef] [PubMed]
- Centers for Disease Control (CDC). Incidence and trends of infection with pathogens transmitted commonly through food—Foodborne Diseases Active Surveillance Network, 10 U.S. Sites, 1996–2012. Wkly. Rep. 2013, 62, 283–287. [Google Scholar]
- Gal-Mor, O.; Boyle, E.C.; Grassl, G.A. Same species, different diseases: How and why typhoidal and non-typhoidal Salmonella enterica serovars differ. Front. Microbiol. 2014, 5, 391. [Google Scholar] [CrossRef] [Scilit]
- Ed-Dra, A.; Filali, F.R.; Karraouan, B.; El-Allaoui, A.; Aboulkacem, A.; Bouchrif, B. Prevalence, molecular and antimicrobial resistance of Salmonella isolated from sausages in Meknes, Morocco. Microb. Pathog. 2017, 105, 340–345. [Google Scholar] [CrossRef] [Scilit]
- Amavisit, P.; Lightfoot, D.; Browning, G.F.; Markham, P.F. Variation between pathogenic serovars within Salmonella pathogenicity islands. J. Bacteriol. 2003, 185, 3624–3635. [Google Scholar] [CrossRef] [Scilit]
- Malorny, B.; Hoorfar, J.; Hugas, M.; Heuvelink, A.; Fach, P.; Ellerbyoek, L.; Bunge, C.; Dorn, C.; Helmuth, R. Inter laboratory diagnostic accuracy of a Salmonella specific PCR-based method. Int. J. Food Microbiol. 2003, 89, 241–249. [Google Scholar] [CrossRef] [Scilit]
- Kataria, J.L.; Kumar, A.; Rajagunalan, S.; Jonathan, L.; Agarwal, R.K. Detection of OmpA gene by PCR for specific detection of Salmonella serovars. Vet. World 2013, 6, 911–914. [Google Scholar] [CrossRef] [Scilit]
- Foley, S.L.; Nayak, R.; Hanning, I.B.; Johnson, T.J.; Han, J.; Ricke, S.C. Population dynamics of Salmonella enterica serotypes in commercial egg and poultry production. Appl Environ. Microbiol. 2011, 77, 4273–4279. [Google Scholar] [CrossRef] [Scilit]
- Chiaretto, G.; Zavagnin, P.; Bettini, F.; Mancin, M.; Minorello, C.; Saccardin, C.; Ricci, A. Extended spectrum β-lactamase SHV-12-producing Salmonella from poultry. Vet. Microbiol. 2008, 128, 406–413. [Google Scholar] [CrossRef] [Scilit]
- Carmo, L.P.; Neilsen, L.R.; da Costa, P.M.; Alban, L. Exposure assessment of extended-spectrum beta-lactamases ampC beta-lactamases producing E. coli in meat in Denmark. Infect. Ecol. Epidmiol. 2014, 4, 22924. [Google Scholar] [CrossRef] [Scilit]
- Zahar, J.R.; Lortholary, O.; Martin, C.; Potel, G.; Plesiat, P.; Nordmann, P. Addressing the challenge of extended-spectrum β-lactamases. Curr. Opin. Investig. Drugs 2009, 10, 172–180. [Google Scholar]
- Kaonga, N.; Hang’ombe, B.M.; Lupindu, A.M.; Hoza, A.S. Detection of CTX-M-Type extended spectrum beta-lactamase producing Salmonella Typhimurium in commercial poultry farms in Copperbelt Province, Zambia. Ger. J. Vet. Res. 2021, 2, 27–34. [Google Scholar] [CrossRef] [Scilit]
- Poulou, A.; Grivakou, E.; Vrioni, G.; Koumaki, V.; Pittaras, T.; Pournaras, S.; Tsakris, A. Modified CLSI Extended spectrum β-Lactamase (ESBL) confirmatory test for phenotypic detection of ESBLs among Enterobacteriaceae producing various β-Lactamases. J. Clin. Microbiol. 2014, 52, 1483–1489. [Google Scholar] [CrossRef] [Scilit]
- Carattoli, A. Resistance plasmid families in Enterobacteriaceae. Antimicrob. Agents Chemother. 2009, 53, 2227–2238. [Google Scholar] [CrossRef] [Scilit]
- Quinn, P.J.; Carter, M.E.; Markey, B.K.; Leonard, F.C.; Hartigan, P.; Fanning, S.; Fitzpatrick, E.S. Veterinary Microbiology and Microbial Disease Textbook, 2nd ed.; Blackwell Science Ltd.: Wiley-Blackwell, UK, 2011; pp. 115–165. [Google Scholar]
- M100–S27; Performance Standards for Antimicrobial Susceptibility Testing. 27th ed. Informational Supplement. Clinical and Laboratory Standards Institute (CLSI): Wayne, PA, USA, 2018; Volume 37, No. 1.
- Shanmugasamy, M.; Velayutham, T.; Rajeswar, J. InvA gene specific PCR for detection of Salmonella from broilers. Vet. World 2011, 4, 562–564. [Google Scholar] [CrossRef] [Scilit]
- Bhowmick, P.P.; Devegowda, D.; Ruwandeepika, H.D.; Fuchs, T.M.; Srikumar, S.; Karunasagar, I.; Karunasagar, I. gcpA (stm1987) is critical for cellulose production and biofilm formation on polystyrene surface by Salmonella enterica serovar Weltevreden in both high and low nutrient medium. Microb. Pathog. 2011, 50, 114–122. [Google Scholar] [CrossRef] [Scilit]
- Colom, K.; Pérez, J.; Alonso, R.; Fernández-Aranguiz, A.; Lariño, E.; Cisterna, R. Simple and reliable multiplex PCR assay for detection of blaTEM, blaSHV and blaOXA-1 genes in Enterobacteriaceae. FEMS Microbiol. Lett. 2003, 223, 147–151. [Google Scholar] [CrossRef] [Scilit]
- Archambault, M.; Petrov, P.; Hendriksen, R.S.; Asseva, G.; Bangtrakulnonth, A.; Hasman, H.; Aarestrup, F.M. Molecular characterization and occurrence of extended-spectrum β-lactamase resistance genes among Salmonella enterica serovar Corvallis from Thailand, Bulgaria, and Denmark. Microb. Drug Resist. 2006, 12, 192–198. [Google Scholar] [CrossRef] [Scilit]
- Pérez-Pérez, F.J.; Hanson, N.D. Detection of plasmid-mediated ampC β-lactamase genes in clinical isolates by using multiplex PCR. J. Clin. Microbiol. 2002, 40, 2153–2162. [Google Scholar] [CrossRef] [Scilit]
- Kashif, J.; Buriro, R.; Memon, J.; Yaqoob, M.; Soomro, J.; Dongxue, D.; Jinhu, H.; Liping, W. Detection of class 1 and 2 integrons, β-lactamase genes and molecular characterization of sulfonamide resistance in Escherichia coli isolates recovered from poultry in China. Pak. Vet. J. 2013, 33, 321–324. [Google Scholar]
- Robicsek, A.; Strahilevitz, J.; Sahm, D.F.; Jacoby, G.A.; Hooper, D.C. qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States. Antimicrob. Agents Chemother. 2006, 50, 2872–2874. [Google Scholar] [CrossRef] [Scilit]
- Kabir, S.M.L. Avian colibacillosis and Salmonellosis: A Closer look at epidemiology, pathogenesis, diagnosis, control and public health concerns. Int. J. Environ. Res. Public Health 2010, 7, 89–114. [Google Scholar] [CrossRef] [Scilit]
- Tegegne, F.M. Epidemiology of Salmonella and its serotypes in human, food animals, foods of animal origin, animal feed and environment. J. Food Nutr. Health 2019, 2, 7–14. [Google Scholar]
- Mahmoud, A.E.A.; Moussa, H.M. Studies on some aerobic bacterial causing of broilers. Egyptian J. Agri. Res. 2000, 78, 25–34. [Google Scholar]
- Radwan, I.A.; Abed, A.H.; Abd Al-Wanis, S.A.; Abd El-Aziz, G.G. Antibacterial effect of cinnamon and oreganium oils on multidrug resistant Escherichia coli and Salmonellae isolated from broiler chickens. J. Egypt. Vet. Med. Assoc. 2016, 76, 169–186. [Google Scholar]
- Sharada, R.; Krishneppa, G.; Raghavan, R.; Gowda, R.N.S.; Upendra, H.A. Isolation and serotyping of Escherichia coli from different pathological conditions in poultry. Ind. J. Poult. Sci. 1999, 34, 336–369. [Google Scholar]
- Shehata, A.A.; Basiouni, S.; Abd Elrazek, A.; Sultan, H.; Tarabees, R.; Elsayed, M.S.A.; Talat, S.; Moharam, E.; Said, A.; Mohsen, W.A.; et al. Characterization of Salmonella enterica Isolated from Poultry Hatcheries and Commercial Broiler Chickens. Pak. Vet. J. 2019, 39, 515–520. [Google Scholar] [CrossRef] [Scilit]
- Andoh, L.A.; Ahmed, S.; Olsen, J.E.; Obiri-Danso, K.; Newman, M.J.; Opintan, J.A.; Barco, L.; Dalsgaard, A. Prevalence and characterization of Salmonella among humans in Ghana. Trop. Med. Health 2017, 45, 3. [Google Scholar] [CrossRef] [Scilit]
- Akinyemi, K.O.; Fakorede, C.O.; Abegunrin, R.O.; Ajoseh, S.O.; Anjorin, A.A.; Amisu, K.O.; Opere, B.O.; Moro, D.D. Detection of invA and blaCTM-genes in Salmonella spp. isolated from febrile patients in Lagos hospitals, Nigeria. Ger. J. Microbiol. 2021, 1, 1–10. [Google Scholar] [CrossRef] [Scilit]
- Confer, A.W.; Ayale, W.S. The OmpA A family of proteins; Roles in bacterial pathogenesis and immunity. Vet. Microb. 2013, 163, 207–222. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Okamura, M.; Ueda, M.; Noda, Y.; Kashimoto, T.; Takehara, K.; Nakamura, M. Immunization with outer membrane protein from Salmonella enterica serovar Enteritidis induces humoral immune response but no protection against homologous challenge in chickens. Poult. Sci. 2012, 91, 2444–2449. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Elkenany, R.; Elsayed, M.M.; Zakaria, A.I.; El-Sayed, S.A.E.S.; Rizk, M.A. Antimicrobial resistance profiles and virulence genotyping of Salmonella enterica serovars recovered from broiler chickens and chicken carcasses in Egypt. BMC Vet. Res. 2019, 15, 124. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ćwiek, K.; Korzekwa, K.; Tabiś, A.; Bania, J.; Bugla-Płoskońska, G.; Wieliczko, A. Antimicrobial resistance and biofilm formation capacity of Salmonella enterica serovar Enteritidis strains isolated from poultry and humans in Poland. Pathogens 2020, 9, 643. [Google Scholar] [CrossRef] [Scilit]
- Halatsi, K.; Oikonomou, I.; Lambiri, M.; Mandilara, G.; Vatopoulos, A.C.; Kyriacou, A. PCR detection of Salmonella spp. using primers targeting the quorum sensing gene sdiA. FEMS Microbiol. Lett. 2006, 259, 201–207. [Google Scholar] [CrossRef] [Scilit]
- Ziech, R.E.; Perin, A.P.; Lampugnani, C.; Sereno, M.J.; Viana, C.; Soares, V.M.; Pereira, J.G.; Pinto, J.P.d.A.N.; Bersot, L.D.S. Biofilm-producing ability and tolerance to industrial sanitizers in Salmonella spp. isolated from Brazilian poultry processing plants. LWT Food Sci. Technol. 2016, 68, 85–90. [Google Scholar] [CrossRef] [Scilit]
- Hawash, H.M.; El-Enbaawy, M.I.H.; Nasef, S.A. Biofilm producing non- typhoidal Salmonella serovars field isolates screening from poultry farms. Biosci. Res. 2017, 14, 1050–1056. [Google Scholar]
- Rawat, D.; Nair, D. Extended-spectrum beta-lactamases in Gram Negative Bacteria. J. Glob. Infect. Dis. 2010, 2, 263–274. [Google Scholar] [CrossRef] [Scilit]
- Bush, K.; Fisher, J.F. Epidemiological expansion, structural studies, and clinical challenges of new β-lactamases from Gram-negative bacteria. Annu. Rev. Microbiol. 2011, 65, 455–478. [Google Scholar] [CrossRef] [Scilit]
- Abdel Aziz, S.A.; Abdel-Latef, G.K.; Shany, S.A.S.; Rouby, S.R. Molecular detection of integron and antimicrobial resistance genes in multidrug resistant Salmonella isolated from poultry, calves and human in Beni-Suef Governorate, Egypt. Beni-Suef Univ. J. Basic Appl. Sci. 2018, 7, 535–542. [Google Scholar] [CrossRef] [Scilit]
- Livermore, D.M. Beta-Lactamaes in Laboratory and Clinical Resistance. Clin. Microbial. Rev. 1995, 8, 557–584. [Google Scholar] [CrossRef]
- Zhu, Y.; Lai, H.; Zou, L.; Yin, S.; Wang, C.; Han, X.; Xia, X.; Hu, K.; He, L.; Zhou, K.; et al. Antimicrobial resistance and resistance genes in Salmonella strains isolated from broiler chickens along the slaughtering process in China. Int. J. Food Microbiol. 2017, 259, 43–51. [Google Scholar] [CrossRef] [Scilit]
- Weese, J.S. Infection control and biosecurity in equine disease control. Equine Vet. J. 2014, 46, 654–660. [Google Scholar] [CrossRef] [Scilit]
- Rodríguez-Baño, J. Community infections caused by extended-spectrum. Arch. Intern. Med. 2008, 168, 1897–1902. [Google Scholar] [CrossRef] [Scilit]
- Gharieb, R.M.; Tartor, Y.H.; Khedr, M.H.E. Nontyphoidal Salmonella in poultry meat and diarrhoeic patients: Prevalence, antibiogram, virulotyping, molecular detection and sequencing of class I integrons in multidrug resistant strains. Gut Pathog. 2015, 7, 34–44. [Google Scholar] [CrossRef] [Scilit]
- Mohamed, M.E.M.; Suelam, I.A. Isolation of non-typhoid Salmonella from humans and camels with reference to its survival in abattoir effluents. Glob. Vet. 2010, 5, 356–361. [Google Scholar]
- Dione, M.M.; Ikmapayi, U.; Saha, D.; Mohammed, I.N.; Adegbola, A.R.; Geerts, S. Antimicrobial resistance and virulence genes of non-typhoidal Salmonella isolates in the Gambia and Senegal. J. Infect. Dis. Dev. Ctries. 2011, 5, 765–775. [Google Scholar] [CrossRef] [Scilit]
- Martinez, Z.L.; Baquero, F. Interaction among strategies associated with bacterial infection: Pathogenicity, epidemicity, and antibiotic resistance. Clin. Microbiol. Rev. 2002, 15, 647–679. [Google Scholar] [CrossRef] [Scilit]
- Currie, A.; MacDougall, L.; Aramini, J.; Gaulin, C.; Ahmed, R.; Isaacs, S. Frozen chicken nuggets and strips and eggs are leading risk factors for Salmonella Heidelberg infections in Canada. Epidemiol. Infect. 2005, 133, 809–816. [Google Scholar] [CrossRef] [Scilit]
| Primers | Primer Sequence (5′-3′) | Amplified Product | Reference | |
|---|---|---|---|---|
| invA | F R | GTGAAATTATCGCCACGTTCGGGCAA TCATCGCACCGTCAAAGGAACC | 284 | [18] |
| OmpA | F R | AGTCGAGCTCATGAAAAAGACAGCTATCGC AGTCAAGCTTTTAAGCCTGCGGCTGAGTTA | 1052 | [8] |
| adrA | F R | ATGTTCCCAAAAATAATGAA TCATGCCGCCACTTCGGTGC | 1113 | [19] |
| csgD | F R | TTACCGCCTGAGATTATCGT ATGTTTAATGAAGTCCATAG | 651 | |
| blaOXA-1 | F R | ATATCTCTACTGTTGCATCTCC AAACCCTTCAAACCATCC | 619 | [20] |
| blaTEM | F R | ATCAGCAATAAACCAGC CCCCGAAGAACGTTTTC | 516 | |
| blaCTX | F R | ATGTGCAGYACCAGTAARGTKATGGC TGGGTRAARTARGTSACCAGAAYCAGCG | 593 | [21] |
| blaMOX | F R | GCTGCTCAAGGAGCACAGGAT CACATTGACATAGGTGTGGTGC | 520 | [22] |
| int1 | F R | CCTCCCGCACGATGATC TCCACGCATCGTCAGGC | 280 | [23] |
| int2 | F R | TTATTGCTGGGATTAGGC ACGGCTACCCTCTGTTATC | 250 | |
| int3 | F R | AGTGGGTGGCGAATGAGTG TGTTCTTGTATCGGCAGGTG | 484 | |
| qnrA | F R | ATTTCTCACGCCAGGATTTG GATCGGCAAAGGTTAGGTCA | 516 | [24] |
| qnrS | F R | ACGACATTCGTCAACTGCAA TAAATTGGCACCCTGTAGGC | 417 | |
| Salmonella Serotype | No. of Isolates | % |
|---|---|---|
| Broiler chicken isolated serotypes (n = 30) | ||
| S. enteritidis | 6 | 20 |
| S. infantis | 5 | 16.6 |
| S. typhimurium | 3 | 10 |
| S. kentucky | 3 | 10 |
| S. heidelberg | 3 | 10 |
| S. hader | 3 | 10 |
| S. newport | 3 | 10 |
| S. blegdam | 2 | 6.6 |
| S. gueuletapee | 1 | 3.3 |
| S. maloe | 1 | 3.3 |
| Human isolated serotypes (n = 14) | ||
| S. enteritidis | 5 | 35.7 |
| S. typhimurium | 5 | 35.7 |
| S. anatum | 3 | 21.4 |
| S. derby | 1 | 7.1 |
| Broiler Chicken Salmonella Isolates (n = 30) | Human Salmonella Isolates (n = 14) | |||||||
|---|---|---|---|---|---|---|---|---|
| Sensitive | Resistant | Resistant | Resistant | |||||
| No. | % | No. | % | No. | % | No. | % | |
| ATM | 9 | 30 | 21 | 70 | 12 | 85.7 | 2 | 14.3 |
| IPM | 5 | 16.6 | 25 | 83.3 | 12 | 85.7 | 2 | 14.3 |
| CTX | 6 | 20 | 24 | 80 | 13 | 92.8 | 1 | 7.2 |
| AM | 16 | 53.3 | 14 | 46.6 | 12 | 85.7 | 2 | 14.3 |
| CAZ | 14 | 46.6 | 16 | 53.3 | 14 | 100 | -- | -- |
| CN | 21 | 70 | 9 | 30 | 12 | 85.7 | 2 | 14.3 |
| CRO | 8 | 26.6 | 22 | 73.3 | 12 | 85.7 | 2 | 14.3 |
| CL | 22 | 73.3 | 8 | 26.6 | 13 | 92.8 | 1 | 7.2 |
| AK | 12 | 40 | 18 | 60 | 14 | 100 | -- | -- |
| SAM | 17 | 56.6 | 13 | 43.3 | 11 | 78.5 | 3 | 21.4 |
| AMC | 14 | 46.6 | 16 | 53.4 | 13 | 92.8 | 1 | 7.2 |
| SXT | 10 | 33.3 | 20 | 66.6 | 14 | 100 | -- | -- |
| CIP | 10 | 33.3 | 20 | 66.6 | 13 | 92.8 | 1 | 7.2 |
| invA | ompA | csgD | adrA | blaOXA-1 | blaTEM | blaCTX | blaMOX | int1 | int2 | int3 | qnrA | qnrS | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| MDR Salmonella Serovars from Broilers (n = 18) | |||||||||||||
| S. enteritidis | + | + | + | + | - | + | - | - | - | - | - | - | - |
| S. enteritidis | + | + | + | + | - | + | - | - | - | - | - | - | - |
| S. infantis | + | + | + | - | - | + | - | - | - | - | - | - | - |
| S. infantis | + | + | + | - | - | + | - | - | - | - | - | - | - |
| S. typhimurium | + | + | + | - | - | + | - | - | - | - | - | - | - |
| S. typhimurium | + | + | + | + | - | + | - | - | - | - | - | - | - |
| S. kentucky | + | + | + | + | - | + | - | - | - | - | - | - | - |
| S. kentucky | + | + | + | + | - | + | - | - | - | - | - | - | - |
| S. hedeilberg | + | + | + | + | - | + | - | - | - | - | - | - | - |
| S. hedeilberg | + | + | + | + | - | + | - | - | - | - | - | - | - |
| S. hader | + | + | + | + | - | + | - | - | + | - | - | - | + |
| S. hader | + | + | + | + | - | + | - | - | + | - | - | - | + |
| S. blegdam | + | + | + | + | - | + | - | - | - | - | - | - | - |
| S. blegdam | + | + | + | + | - | + | - | - | - | - | - | - | - |
| S. newport | + | + | + | + | - | + | - | - | + | - | - | - | - |
| S. newport | + | + | + | + | - | + | + | - | + | - | - | - | - |
| S. maloe | + | + | + | + | - | + | + | - | + | - | - | - | - |
| S. gueuletapee | + | + | + | + | - | + | - | - | - | - | - | - | - |
| Total no. % | 18 100 | 18 100 | 18 100 | 15 83.3 | 0 0 | 18 100 | 2 11.1 | 0 0 | 5 27.8 | 0 0 | 0 0 | 0 0 | 2 11.1 |
| MDR Salmonella Serovars from Human (n = 4) | |||||||||||||
| S. enteritidis | + | + | + | + | - | + | - | - | + | - | + | - | - |
| S. typhimurium | + | + | + | + | - | + | - | - | + | - | + | - | - |
| S. anatum | + | + | + | + | - | + | - | - | + | - | + | - | - |
| S. derby | + | + | + | + | - | + | - | - | + | - | + | - | - |
| Total no. % | 4 100 | 4 100 | 4 100 | 4 100 | 0 0 | 4 100 | 0 0 | 0 0 | 4 100 | 0 0 | 4 100 | 0 0 | 0 0 |
| MDR Salmonella Serotypes from Broilers | |||
|---|---|---|---|
| Tested Salmonella Serovars | Virulence Genes Detected | Antimicrobial Resistance Pattern | Resistance Genes Detected |
| S. enteritidis | invA, adrA, csgD, ompA | ATM, IPM, CTX, CAZ, CRO, AK, SXT, CIP | blaTEM |
| S. enteritidis | invA, adrA, csgD, ompA | ATM, IPM, CTX, AK, SAM, AMC, SXT, CIP | blaTEM |
| S. typhimurium | invA, adrA, csgD, ompA | ATM, IPM, CTX, AM, CAZ, CN, CRO, SAM, SXT, CIP | blaTEM |
| S. typhimurium | invA, csgD, ompA | CTX, CAZ, CRO, AK, SAM, AMC, SXT, CIP | blaTEM |
| S. infantis | invA, csgD, ompA | AMC, CAZ, SXT | blaTEM |
| S. infantis | invA, csgD, ompA | IMP, AM, SXT | blaTEM |
| S. kentucky | invA, adrA, csgD, ompA | IMP, CTX, CN, CRO, AK, CIP | blaTEM |
| S. kentucky | invA, adrA, csgD, ompA | IPM, CTX, CRO, SXT, CIP | blaTEM |
| S. hedeilberg | invA, adrA, csgD, ompA | ATM, IPM, CTX, CN, CRO, CL, CIP | blaTEM |
| S. hedeilberg | invA, adrA, csgD, ompA | ATM, IPM, CTX, AM, CAZ, CN, CRO, AK, AMC, SXT, CIP | blaTEM |
| S. hader | invA, adrA, csgD, ompA | IPM, AM, CIP | blaTEM, int1, qnrS |
| S. hader | invA, adrA, csgD, ompA | ATM, IPM, CTX, AM, CRO, CL, AMC, SXT, CIP | blaTEM, int1, qnrS |
| S. blegdam | invA, adrA, csgD, ompA | ATM, IMP, CTX, CAZ, CRO, CL, AK, SAM, AMC | blaTEM |
| S. blegdam | invA, adrA, csgD, ompA | ATM, IMP, CTX, CAZ, CN, CRO, AK, SAM, AMC, SXT, CIP | blaTEM |
| S. newport | invA, adrA, csgD, ompA | ATM, IPM, CTX, AM, CRO | blaTEM, int1 |
| S. newport | invA, adrA, csgD, ompA | ATM, AM, CRO | blaTEM, blaCTX, int1 |
| S. maloe | invA, adrA, csgD, ompA | CAZ, AM, AK | blaTEM, blaCTX, int1 |
| S. gueuletapee | invA, adrA, csgD, ompA | ATM, IPM, CTX, CN, CL, AK, AMC | blaTEM |
| MDR Salmonella Serotypes from Human | |||
| S. enteritidis | invA, adrA, csgD, ompA | ATM, IPM, CN, CRO, CIP | blaTEM, int1, int3 |
| S. typhimurium | invA, adrA, csgD, ompA | ATM, IPM, CTX, AM, CN, CRO, CL | blaTEM, int1, int3 |
| S. anatum | invA, adrA, csgD, ompA | CAZ, AM, SAM | blaTEM, int1, int3 |
| S. derby | invA, adrA, csgD, ompA | CRO, SAM, AMC | blaTEM, int1, int3 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Orabi, A.; Armanious, W.; Radwan, I.A.; Girh, Z.M.S.A.; Hammad, E.; Diab, M.S.; Elbestawy, A.R. Genetic Correlation of Virulent Salmonella Serovars (Extended Spectrum β-Lactamases) Isolated from Broiler Chickens and Human: A Public Health Concern. Pathogens 2022, 11, 1196. https://doi.org/10.3390/pathogens11101196
Orabi A, Armanious W, Radwan IA, Girh ZMSA, Hammad E, Diab MS, Elbestawy AR. Genetic Correlation of Virulent Salmonella Serovars (Extended Spectrum β-Lactamases) Isolated from Broiler Chickens and Human: A Public Health Concern. Pathogens. 2022; 11(10):1196. https://doi.org/10.3390/pathogens11101196
Chicago/Turabian StyleOrabi, Ahmed, Wagih Armanious, Ismail A. Radwan, Zeinab M. S. A. Girh, Enas Hammad, Mohamed S. Diab, and Ahmed R. Elbestawy. 2022. "Genetic Correlation of Virulent Salmonella Serovars (Extended Spectrum β-Lactamases) Isolated from Broiler Chickens and Human: A Public Health Concern" Pathogens 11, no. 10: 1196. https://doi.org/10.3390/pathogens11101196
APA StyleOrabi, A., Armanious, W., Radwan, I. A., Girh, Z. M. S. A., Hammad, E., Diab, M. S., & Elbestawy, A. R. (2022). Genetic Correlation of Virulent Salmonella Serovars (Extended Spectrum β-Lactamases) Isolated from Broiler Chickens and Human: A Public Health Concern. Pathogens, 11(10), 1196. https://doi.org/10.3390/pathogens11101196

