Obtaining Specific Sequence Tags for Yersinia pestis and Visually Detecting Them Using the CRISPR-Cas12a System
Abstract
:1. Introduction
2. Materials and Methods
2.1. Strains Used in This Study
2.2. Acquisition of Genome Data for Y. pestis and Other Yersinia Species
2.3. BLAST Analysis on DNA Tags and Screening for Y. pestis-Specific DNA Fragments
2.4. Constructing Specific Tags and Searching for SNPs for Detecting Y. pestis
2.5. Establishing a CRISPR-Cas2a-Assisted Y. pestis Identification Method Based on SNPs
2.5.1. Detecting SNP Sites in Y. pestis Using a PCR–Fluorescence Combined Method
2.5.2. Detecting SNP Sites in Y. pestis Using a Combination of RPA and LFD
3. Results
3.1. Acquisition of Specific Fragments
3.2. Screening Results for the Y. pestis-Specific Fragments
3.3. Obtaining Y. pestis-Specific Tags
3.4. Detecting SNP sites in Y. pestis by PCR-Combined Fluorescence Methodology
3.4.1. CRISPR-Cas12a-Assisted Y. pestis Identification Using PCR-Combined Fluorescence Detection
3.4.2. Specificity of the Method Used to Differentiate Y. pestis from Other Bacteria
3.4.3. Sensitivity of the Method Used to Differentiate Y. pestis from Other Bacteria
3.5. Detecting SNP Sites in Y. pestis by RPA Combined with LFD
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Rotz, L.D.; Khan, A.S.; Lillibridge, S.R.; Ostroff, S.M.; Hughes, J.M. Public health assessment of potential biological terrorism agents. Emerg. Infect. Dis. 2002, 8, 225–230. [Google Scholar] [CrossRef] [PubMed]
- Parkhill, J.; Wren, B.W.; Thomson, N.R.; Titball, R.W.; Holden, M.T.; Prentice, M.B.; Sebaihia, M.; James, K.D.; Churcher, C.; Mungall, K.L.; et al. Genome sequence of Yersinia pestis, the causative agent of plague. Nature 2001, 413, 523–527. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chain, P.S.; Carniel, E.; Larimer, F.W.; Lamerdin, J.; Stoutland, P.O.; Regala, W.M.; Georgescu, A.M.; Vergez, L.M.; Land, M.L.; Motin, V.L.; et al. Insights into the evolution of Yersinia pestis through whole-genome comparison with Yersinia pseudotuberculosis. Proc. Natl. Acad. Sci. USA 2004, 101, 13826–13831. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Achtman, M.; Zurth, K.; Morelli, G.; Torrea, G.; Guiyoule, A.; Carniel, E. Yersinia pestis, the cause of plague, is a recently emerged clone of Yersinia pseudotuberculosis. Proc. Natl. Acad. Sci. USA 1999, 96, 14043–14048. [Google Scholar] [CrossRef] [Green Version]
- Trebesius, K.; Harmsen, D.; Rakin, A.; Schmelz, J.; Heesemann, J. Development of rRNA-targeted PCR and in situ hybridization with fluorescently labelled oligonucleotides for detection of Yersinia species. J. Clin. Microbiol. 1998, 36, 2557–2564. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sarovich, D.S.; Colman, R.E.; Price, E.P.; Chung, W.K.; Lee, J.; Schupp, J.M.; Cobble, K.R.; Busch, J.D.; Alexander, J.; Keim, P.; et al. Selective isolation of Yersinia pestis from plague-infected fleas. J. Microbiol. Methods 2010, 82, 95–97. [Google Scholar] [CrossRef] [Green Version]
- Chanteau, S.; Rahalison, L.; Ralafiarisoa, L.; Foulon, J.; Ratsitorahina, M.; Ratsifasoamanana, L.; Carniel, E.; Nato, F. Development and testing of a rapid diagnostic test for bubonic and pneumonic plague. Lancet 2003, 361, 211–216. [Google Scholar] [CrossRef]
- Hinnebusch, J.; Schwan, T.G. New method for plague surveillance using polymerase chain reaction to detect Yersinia pestis in fleas. J. Clin. Microbiol. 1993, 31, 1511–1514. [Google Scholar] [CrossRef] [Green Version]
- Tsukano, H.; Itoh, K.; Suzuki, S.; Watanabe, H. Detection and identification of Yersinia pestis by polymerase chain reaction (PCR) using multiplex primers. Microbiol. Immunol. 1996, 40, 773–775. [Google Scholar] [CrossRef]
- Loïez, C.; Herwegh, S.; Wallet, F.; Armand, S.; Guinet, F.; Courcol, R.J. Detection of Yersinia pestis in sputum by real-time PCR. J. Clin. Microbiol. 2003, 41, 4873–4875. [Google Scholar] [CrossRef] [Green Version]
- Bai, Y.; Motin, V.; Enscore, R.E.; Osikowicz, L.; Rosales Rizzo, M.; Hojgaard, A.; Kosoy, M.; Eisen, R.J. Pentaplex real-time PCR for differential detection of Yersinia pestis and Y. pseudotuberculosis and application for testing fleas collected during plague epizootics. Microbiologyopen 2020, 9, e1105. [Google Scholar] [CrossRef] [PubMed]
- Ben-Gurion, R.; Shafferman, A. Essential virulence determinants of different Yersinia species are carried on a common plasmid. Plasmid 1981, 5, 183–187. [Google Scholar] [CrossRef]
- Filippov, A.A.; Oleinikov, P.V.; Motin, V.L.; Protsenko, O.A.; Smirnov, G.B. Sequencing of two Yersinia pestis IS elements, IS285 and IS100. Contrib. Microbiol. Immunol. 1995, 13, 306–309. [Google Scholar]
- Matero, P.; Pasanen, T.; Laukkanen, R.; Tissari, P.; Tarkka, E.; Vaara, M.; Skurnik, M. Real-time multiplex PCR assay for detection of Yersinia pestis and Yersinia pseudotuberculosis. APMIS Acta Pathol. Microbiol. Immunol. Scand. 2009, 117, 34–44. [Google Scholar] [CrossRef] [PubMed]
- Stewart, A.; Satterfield, B.; Cohen, M.; O’Neill, K.; Robison, R. A quadruplex real-time PCR assay for the detection of Yersinia pestis and its plasmids. J. Med. Microbiol. 2008, 57, 324–331. [Google Scholar] [CrossRef] [Green Version]
- Ayyadurai, S.; Flaudrops, C.; Raoult, D.; Drancourt, M. Rapid identification and typing of Yersinia pestis and other Yersinia species by matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry. BMC Microbiol. 2010, 10, 285. [Google Scholar] [CrossRef] [Green Version]
- Gérôme, P.; Le Flèche, P.; Blouin, Y.; Scholz, H.C.; Thibault, F.M.; Raynaud, F.; Vergnaud, G.; Pourcel, C. Yersinia pseudotuberculosis ST42 (O:1) Strain Misidentified as Yersinia pestis by Mass Spectrometry Analysis. Genome Announc. 2014, 2. [Google Scholar] [CrossRef] [Green Version]
- Harch, S.A.J.; Jennison, A.V.; Bastian, I. Yersinia pseudotuberculosis bacteraemia: A diagnostic dilemma in the era of MALDI-TOF mass spectrometry. Pathology 2019, 51, 434–436. [Google Scholar] [CrossRef]
- Savin, C.; Criscuolo, A.; Guglielmini, J.; Le Guern, A.S.; Carniel, E.; Pizarro-Cerdá, J.; Brisse, S. Genus-wide Yersinia core-genome multilocus sequence typing for species identification and strain characterization. Microb. Genom. 2019, 5. [Google Scholar] [CrossRef]
- Broeders, M.; Herrero-Hernandez, P.; Ernst, M.P.T.; van der Ploeg, A.T.; Pijnappel, W. Sharpening the Molecular Scissors: Advances in Gene-Editing Technology. iScience 2020, 23, 100789. [Google Scholar] [CrossRef] [Green Version]
- Abudayyeh, O.O.; Gootenberg, J.S.; Konermann, S.; Joung, J.; Slaymaker, I.M.; Cox, D.B.; Shmakov, S.; Makarova, K.S.; Semenova, E.; Minakhin, L.; et al. C2c2 is a single-component programmable RNA-guided RNA-targeting CRISPR effector. Science 2016, 353, aaf5573. [Google Scholar] [CrossRef] [Green Version]
- Zhu, C.S.; Liu, C.Y.; Qiu, X.Y.; Xie, S.S.; Li, W.Y.; Zhu, L.; Zhu, L.Y. Novel nucleic acid detection strategies based on CRISPR-Cas systems: From construction to application. Biotechnol. Bioeng. 2020, 117, 2279–2294. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Shang, X.; Huang, X. Next-generation pathogen diagnosis with CRISPR/Cas-based detection methods. Emerg. Microbes Infect. 2020, 9, 1682–1691. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.S.; Ma, E.; Harrington, L.B.; Da Costa, M.; Tian, X.; Palefsky, J.M.; Doudna, J.A. CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science 2018, 360, 436–439. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, X.; Wang, Y.; Liu, Y.; Yang, B.; Wang, X.; Wei, J.; Lu, Z.; Zhang, Y.; Wu, J.; Huang, X.; et al. Base editing with a Cpf1-cytidine deaminase fusion. Nat. Biotechnol. 2018, 36, 324–327. [Google Scholar] [CrossRef] [PubMed]
- Li, S.Y.; Cheng, Q.X.; Liu, J.K.; Nie, X.Q.; Zhao, G.P.; Wang, J. CRISPR-Cas12a has both cis- and trans-cleavage activities on single-stranded DNA. Cell Res. 2018, 28, 491–493. [Google Scholar] [CrossRef]
- Piepenburg, O.; Williams, C.H.; Stemple, D.L.; Armes, N.A. DNA detection using recombination proteins. PLoS Biol. 2006, 4, e204. [Google Scholar] [CrossRef]
- Lobato, I.M.; O’Sullivan, C.K. Recombinase polymerase amplification: Basics, applications and recent advances. Trends Anal. Chem. 2018, 98, 19–35. [Google Scholar] [CrossRef]
- Zhang, J.; Cao, J.; Zhu, M.; Xu, M.; Shi, F. Loop-mediated isothermal amplification-lateral-flow dipstick (LAMP-LFD) to detect Mycoplasma ovipneumoniae. World J. Microbiol. Biotechnol. 2019, 35, 31. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mao, X.; Gurung, A.; Xu, H.; Baloda, M.; He, Y.; Liu, G. Simultaneous detection of nucleic acid and protein using gold nanoparticles and lateral flow device. Anal. Sci. Int. J. Jpn. Soc. Anal. Chem. 2014, 30, 637–642. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Q.; Xin, Y.; Zhao, H.; Liu, R.; Xu, X.; Yan, Y.; Kong, Z.; Wang, T.; Qi, Z.; Zhang, Q.; et al. Human Macrophages Clear the Biovar Microtus Strain of Yersinia pestis More Efficiently Than Murine Macrophages. Front. Cell. Infect. Microbiol. 2019, 9, 111. [Google Scholar] [CrossRef] [Green Version]
- Liu, X.; Wang, D.; Wang, H.; Feng, E.; Zhu, L.; Wang, H. Curing of plasmid pXO1 from Bacillus anthracis using plasmid incompatibility. PLoS ONE 2012, 7, e29875. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gao, Z.; Herrera-Carrillo, E.; Berkhout, B. Improvement of the CRISPR-Cpf1 system with ribozyme-processed crRNA. RNA Biol. 2018, 15, 1458–1467. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Van Aelst, K.; Martínez-Santiago, C.J.; Cross, S.J.; Szczelkun, M.D. The Effect of DNA Topology on Observed Rates of R-Loop Formation and DNA Strand Cleavage by CRISPR Cas12a. Genes 2019, 10, 169. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Le Guern, A.-S.; Savin, C.; Angermeier, H.; Brémont, S.; Clermont, D.; Mühle, E.; Orozova, P.; Najdenski, H.; Pizarro-Cerdá, J. Yersinia artesiana sp. nov., Yersinia proxima sp. nov., Yersinia alsatica sp. nov., Yersina vastinensis sp. nov., Yersinia thracica sp. nov. and Yersinia occitanica sp. nov., isolated from humans and animals. Int. J. Syst. Evol. Microbiol. 2020, 70, 5363–5372. [Google Scholar] [CrossRef]
- Xu, H.; Zhang, X.; Cai, Z.; Dong, X.; Chen, G.; Li, Z.; Qiu, L.; He, L.; Liang, B.; Liu, X.; et al. An Isothermal Method for Sensitive Detection of Mycobacterium tuberculosis Complex Using Clustered Regularly Interspaced Short Palindromic Repeats/Cas12a Cis and Trans Cleavage. J. Mol. Diagn. JMD 2020, 22, 1020–1029. [Google Scholar] [CrossRef]
- Xiong, D.; Dai, W.; Gong, J.; Li, G.; Liu, N.; Wu, W.; Pan, J.; Chen, C.; Jiao, Y.; Deng, H.; et al. Rapid detection of SARS-CoV-2 with CRISPR-Cas12a. PLoS Biol. 2020, 18, e3000978. [Google Scholar] [CrossRef] [PubMed]
- Ding, X.; Yin, K.; Li, Z.; Liu, C. All-in-One Dual CRISPR-Cas12a (AIOD-CRISPR) Assay: A Case for Rapid, Ultrasensitive and Visual Detection of Novel Coronavirus SARS-CoV-2 and HIV virus. Biorxiv Prepr. Serv. Biol. 2020. [Google Scholar] [CrossRef]
- Li, S.Y.; Cheng, Q.X.; Wang, J.M.; Li, X.Y.; Zhang, Z.L.; Gao, S.; Cao, R.B.; Zhao, G.P.; Wang, J. CRISPR-Cas12a-assisted nucleic acid detection. Cell Discov. 2018, 4, 20. [Google Scholar] [CrossRef] [Green Version]
- Fan, X.; Li, L.; Zhao, Y.; Liu, Y.; Liu, C.; Wang, Q.; Dong, Y.; Wang, S.; Chi, T.; Song, F.; et al. Clinical Validation of Two Recombinase-Based Isothermal Amplification Assays (RPA/RAA) for the Rapid Detection of African Swine Fever Virus. Front. Microbiol. 2020, 11, 1696. [Google Scholar] [CrossRef]
Tag Names | Target Sequences | Primers | crRNA (5′-3′) | |
---|---|---|---|---|
Names | Sequences (5′-3′) | |||
YP-1 | A*C*CAGACTCGCTCCACA | PCR-YP-1-F | AGGTGACAATTGTATACCTGCATAATTAATTAGCATTTA | AAUUUCUACUGUUGUAGAUACCAGACUCGCUCCACA |
PCR-YP-1-R | ACAGATGTTGACTGGTGAGATGGTC | |||
RPA-YP-1-F | GACAATTGTATACCTGCATAATTAATTAGCATTTA | |||
RPA-YP-1-R | ACAAATTTTACAGATGTTGACTGGTGAGATGGTC | |||
YP-2 | C*CTCG*GTACTGTTGCCA | PCR-YP-2-F | CCGCCAGATCCACGCCCTTTC | AAUUUCUACUGUUGUAGAUCCUCGGUACUGUUGCCA |
PCR-YP-2-R | GCATCAACGGCATTTCGGCCA | |||
RPA-YP-2-F | CCGGACAGATTGGCCGCCAGATCCACGCCCTTTC | |||
RPA-YP-2-R | CAGCCGCATCAACGGCATTTCGGCCAATGGCAG | |||
YP-3 | C*CT*ATGGCGTTCTCTAT | PCR-YP-3-F | TGCGAAATTGTACAAAAATCTCTGTTAGACTTTTA | AAUUUCUACUGUUGUAGAUCCUAUGGCGUUCUCUAU |
PCR-YP-3-R | CGCTGTTCTGCAACTTGAGTGACTAC | |||
RPA-YP-3-F | GTGCGAAATTGTACAAAAATCTCTGTTAGACTTTTA | |||
RPA-YP-3-R | GTAGTCACTCAAGTTGCAGAACAGCGTAAAACG | |||
YP-4 | A*GA*GACAAATATCACCA | PCR-YP-4-F | TTGGCTTCAAGCGATTCCAGTCAATTTA | AAUUUCUACUGUUGUAGAUAGAGACAAAUAUCACCA |
PCR-YP-4-R | GCATGGAGCTATTATGACAAGAACCGG | |||
RPA-YP-4-F | AATCGTTGGCTTCAAGCGATTCCAGTCAATTTA | |||
RPA-YP-4-R | TAGAAGCATGGAGCTATTATGACAAGAACCGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, G.; Lyu, Y.; Wang, D.; Zhu, L.; Cao, S.; Pan, C.; Feng, E.; Zhang, W.; Liu, X.; Cui, Y.; et al. Obtaining Specific Sequence Tags for Yersinia pestis and Visually Detecting Them Using the CRISPR-Cas12a System. Pathogens 2021, 10, 562. https://doi.org/10.3390/pathogens10050562
Chen G, Lyu Y, Wang D, Zhu L, Cao S, Pan C, Feng E, Zhang W, Liu X, Cui Y, et al. Obtaining Specific Sequence Tags for Yersinia pestis and Visually Detecting Them Using the CRISPR-Cas12a System. Pathogens. 2021; 10(5):562. https://doi.org/10.3390/pathogens10050562
Chicago/Turabian StyleChen, Gang, Yufei Lyu, Dongshu Wang, Li Zhu, Shiyang Cao, Chao Pan, Erling Feng, Weicai Zhang, Xiankai Liu, Yujun Cui, and et al. 2021. "Obtaining Specific Sequence Tags for Yersinia pestis and Visually Detecting Them Using the CRISPR-Cas12a System" Pathogens 10, no. 5: 562. https://doi.org/10.3390/pathogens10050562