First Case of Staphylococci Carrying Linezolid Resistance Genes from Laryngological Infections in Poland
Abstract
1. Introduction
2. Results
2.1. Patient Characteristics
2.2. Characteristics of Isolates and Identification at the Species Level
2.3. Genetic Profiling and Clonality Analysis
2.4. Virulence and Biofilm Formation Genes
2.5. Antimicrobial Susceptibility and Resistance Determinants
3. Discussion
4. Materials and Methods
4.1. Strain Collection
4.2. Susceptibility Testing
4.3. Total DNA Extraction
4.4. Species Identification
4.5. Molecular Analysis
4.5.1. Spa Typing
4.5.2. MLST Typing
4.5.3. SCCmec Cassette Typing
4.5.4. ACME Cassette Typing
4.5.5. Detection of Virulence and ica Operon Genes
4.5.6. Detection and Analysis of Antimicrobial Resistance Determinants
4.6. Nucleotide Sequence Accession Numbers
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Ethics Approval
References
- Sorlozano, A.; Gutierrez, J.; Martinez, T.; Yuste, M.E.; Perez-Lopez, J.A.; Vindel, A.; Guillén, J.; Boquete, T.; Martınez, T. Detection of new mutations conferring resistance to linezolid in glycopeptide-intermediate susceptibility Staphylococcus hominis subspecies hominis circulating in an intensive care unit. Eur. J. Clin. Microbiol. Infect. Dis. 2009, 29, 73–80. [Google Scholar] [CrossRef]
- Tsiodras, S.; Gold, H.S.; Sakoulas, G.; Eliopoulos, G.M.; Wennersten, C.; Venkataraman, L.; Moellering, R.C.; Ferraro, M.J. Linezolid resistance in a clinical isolate of Staphylococcus aureus. Lancet 2001, 358, 207–208. [Google Scholar] [CrossRef]
- Endimiani, A.; Blackford, M.; Dasenbrook, E.C.; Reed, M.D.; Bajaksouszian, S.; Hujer, A.M.; Rudin, S.D.; Hujer, K.M.; Perreten, V.; Rice, L.B.; et al. Emergence of Linezolid-Resistant Staphylococcus aureus after Prolonged Treatment of Cystic Fibrosis Patients in Cleveland, Ohio. Antimicrob. Agents Chemother. 2011, 55, 1684–1692. [Google Scholar] [CrossRef] [PubMed]
- de Dios Caballero, J.; Pastor, M.D.; Vindel, A.; Máiz, L.; Yagüe, G.; Salvador, C.; Cobo, M.; Morosini, M.-I.; Del Campo, R.; Cantón, R.; et al. Emergence of cfr-Mediated Linezolid Resistance in a Methicillin-Resistant Staphylococcus aureus Epidemic Clone Isolated from Patients with Cystic Fibrosis. Antimicrob. Agents Chemother. 2015, 60, 1878–1882. [Google Scholar] [CrossRef]
- Morales, G.; Picazo, J.J.; Baos, E.; Candel, F.J.; Arribi, A.; Peláez, B.; Andrade, R.; De La Torre, M.; Fereres, J.; Sánchez-García, M. Resistance to Linezolid Is Mediated by the cfr Gene in the First Report of an Outbreak of Linezolid-Resistant Staphylococcus aureus. Clin. Infect. Dis. 2010, 50, 821–825. [Google Scholar] [CrossRef] [PubMed]
- Kosecka-Strojek, M.; Sadowy, E.; Gawryszewska, I.; Klepacka, J.; Tomasik, T.; Michalik, M.; Hryniewicz, W.; Miedzobrodzki, J. Emergence of linezolid-resistant Staphylococcus epidermidis in the tertiary children’s hospital in Cracow, Poland. Eur. J. Clin. Microbiol. Infect. Dis. 2020, 39, 1727–1737. [Google Scholar] [CrossRef] [PubMed]
- Yoshida, K.; Shoji, H.; Niki, Y.; Hanaki, H.; Yanagisawa, C.; Ikeda-Dantsuji, Y.; Fukuchi, K.; Adachi, M. Linezolid-resistant methicillin-resistant Staphylococcus aureus isolated after long-term, repeated use of linezolid. J. Infect. Chemother. 2009, 15, 417–419. [Google Scholar] [CrossRef]
- Rodríguez-Aranda, A.; Daskalaki, M.; Villar, J.; Sanz, F.; Otero, J.R.; Chaves, F. Nosocomial spread of linezolid-resistant Staphylococcus haemolyticus infections in an intensive care unit. Diagn. Microbiol. Infect. Dis. 2009, 63, 398–402. [Google Scholar] [CrossRef]
- Mazzariol, A.; Cascio, G.L.; Kocsis, E.; Maccacaro, L.; Fontana, R.; Cornaglia, G. Outbreak of linezolid-resistant Staphylococcus haemolyticus in an Italian intensive care unit. Eur. J. Clin. Microbiol. Infect. Dis. 2011, 31, 523–527. [Google Scholar] [CrossRef] [PubMed]
- Tewhey, R.; Gu, B.; Kelesidis, T.; Charlton, C.; Bobenchik, A.; Hindler, J.; Schork, N.J.; Humphries, R.M. Mechanisms of Linezolid Resistance among Coagulase-Negative Staphylococci Determined by Whole-Genome Sequencing. mBio 2014, 5, e00894-14. [Google Scholar] [CrossRef]
- Cui, L.; Wang, Y.; Li, Y.; He, T.; Schwarz, S.; Ding, Y.; Shen, J.; Lv, Y. cfr-Mediated Linezolid-Resistance among Methicillin-Resistant Coagulase-Negative Staphylococci from Infections of Humans. PLoS ONE 2013, 8, e57096. [Google Scholar] [CrossRef]
- Jian, J.; Chen, L.; Xie, Z.; Zhang, M. Dissemination of cfr-mediated linezolid resistance among Staphylococcus species isolated from a teaching hospital in Beijing, China. J. Int. Med Res. 2018, 46, 3884–3889. [Google Scholar] [CrossRef]
- Rajan, V.; Kumar, V.G.S.; Gopal, S. A cfr-positive clinical staphylococcal isolate from India with multiple mechanisms of linezolid-resistance. Indian J. Med. Res. 2014, 139, 463–467. [Google Scholar] [PubMed]
- Dhawan, B.; Kumari, S.; Rawre, J.; Trikha, A.; Sreenivas, V.; Sood, S.; Kapil, A. Linezolid-resistant Staphylococcus haemolyticus: Emergence of G2447U & C2534U mutations at the domain V of 23S ribosomal RNA gene in a tertiary care hospital in India. Indian J. Med. Res. 2019, 149, 795–798. [Google Scholar] [CrossRef]
- Mittal, G.; Bhandari, V.; Gaind, R.; Rani, V.; Chopra, S.; Dawar, R.; Sardana, R.; Verma, P.K. Linezolid resistant coagulase negative staphylococci (LRCoNS) with novel mutations causing blood stream infections (BSI) in India. BMC Infect. Dis. 2019, 19, 717. [Google Scholar] [CrossRef] [PubMed]
- Vijayan, P.; Srinivas, D.; Siddaiah, N.; Bahubali, V.K.H. Device-Associated Meningitis by Linezolid-Resistant Staphylococcus haemolyticus in a Vancomycin- Hypersensitive Patient. J. Neurosci. Rural. Pr. 2019, 10, 718–720. [Google Scholar] [CrossRef]
- Long, K.S.; Vester, B. Resistance to Linezolid Caused by Modifications at Its Binding Site on the Ribosome. Antimicrob. Agents Chemother. 2011, 56, 603–612. [Google Scholar] [CrossRef]
- Gu, B.; Kelesidis, T.; Tsiodras, S.; Hindler, J.; Humphries, R.M. The emerging problem of linezolid-resistant Staphylococcus. J. Antimicrob. Chemother. 2013, 68, 4–11. [Google Scholar] [CrossRef] [PubMed]
- Mendes, R.E.; Deshpande, L.M.; Jones, R.N. Linezolid update: Stable in vitro activity following more than a decade of clinical use and summary of associated resistance mechanisms. Drug Resist. Updat. 2014, 17, 1–12. [Google Scholar] [CrossRef]
- Takaya, A.; Kimura, A.; Sato, Y.; Ishiwada, N.; Watanabe, M.; Matsui, M.; Shibayama, K.; Yamamoto, T. Molecular characterization of linezolid-resistant CoNS isolates in Japan. J. Antimicrob. Chemother. 2015, 70, 658–663. [Google Scholar] [CrossRef] [PubMed]
- Fessler, A.T.; Calvo, N.; Gutiérrez, N.; Bellido, J.L.M.; Fajardo, M.; Garduño, E.; Monecke, S.; Ehricht, R.; Kadlec, K.; Schwarz, S.; et al. cfr-mediated linezolid resistance in methicillin-resistant Staphylococcus aureus and Staphylococcus haemolyticus associated with clinical infections in humans: Two case reports. J. Antimicrob. Chemother. 2014, 69, 268–285. [Google Scholar] [CrossRef][Green Version]
- Long, K.S.; Poehlsgaard, J.; Kehrenberg, C.; Schwarz, S.; Vester, B. The cfr rRNA methyltransferase confers resistance to phenicols, lincosamides, oxazolidinones, pleuromutilins, and streptogramin a antibiotics. Antimicrob Agents Chemother 2006, 50, 2500–2505. [Google Scholar] [CrossRef] [PubMed]
- Gawryszewska, I.; Żabicka, D.; Hryniewicz, W.; Sadowy, E. Linezolid-resistant enterococci in Polish hospitals: Species, clonality and determinants of linezolid resistance. Eur. J. Clin. Microbiol. Infect. Dis. 2017, 36, 1279–1286. [Google Scholar] [CrossRef] [PubMed]
- He, T.; Shen, Y.; Schwarz, S.; Cai, J.; Lv, Y.; Li, J.; Feßler, A.T.; Zhang, R.; Wu, C.; Shen, J.; et al. Genetic environment of the transferable oxazolidinone/phenicol resistance gene optrA in Enterococcus faecalis isolates of human and animal origin. J. Antimicrob. Chemother. 2016, 71, 1466–1473. [Google Scholar] [CrossRef] [PubMed]
- Fan, R.; Li, D.; Wang, Y.; He, T.; Feßler, A.T.; Schwarz, S.; Wu, C. Presence of the optrA gene in methicillin-resistant Staphylococcus sciuri of porcine origin. Antimicrob Agents Chemother 2016, 60, 7200–7205. [Google Scholar] [PubMed]
- Li, D.; Wang, Y.; Schwarz, S.; Cai, J.; Fan, R.; Li, J.; Feßler, A.T.; Zhang, R.; Wu, C.; Shen, J. Co-location of the oxazolidinone resistance genes optrA and cfr on a multi-resistance plasmid from Staphylococcus sciuri. J Antimicrob. Chemother. 2016, 71, 1474–1478. [Google Scholar] [CrossRef]
- Wu, Y.; Fan, R.; Wang, Y.; Lei, L.; Feßler, A.T.; Wang, Z.; Wu, C.; Schwarz, S.; Wang, Y. Analysis of combined resistance to oxazolidinones and phenicols among bacteria from dogs fed with raw meat/vegetables and the respective food items. Sci. Rep. 2019, 9, 15500. [Google Scholar] [CrossRef] [PubMed]
- Antonelli, A.; D’Andrea, M.M.; Brenciani, A.; Galeotti, C.L.; Morroni, G.; Pollini, S.; Varaldo, P.E.; Rossolini, G.M. Characterization of poxtA, a novel phenicol–oxazolidinone–tetracycline resistance gene from an MRSA of clinical origin. J. Antimicrob. Chemother. 2018, 73, 1763–1769. [Google Scholar] [CrossRef]
- Rouard, C.; Garnier, F.; Leraut, J.; Lepainteur, M.; Rahajamananav, L.; Languepin, J.; Ploy, M.-C.; Bourgeois-Nicolaos, N.; Doucet-Populaire, F. Emergence and Within-Host Genetic Evolution of Methicillin-Resistant Staphylococcus aureus Resistant to Linezolid in a Cystic Fibrosis Patient. Antimicrob. Agents Chemother. 2018, 62, e00720-18. [Google Scholar] [CrossRef] [PubMed]
- Michalik, M.; Samet, A.; Podbielska-Kubera, A.; Savini, V.; Międzobrodzki, J.; Kosecka-Strojek, M. Coagulase-negative staphylococci (CoNS) as a significant etiological factor of laryngological infections: A review. Ann. Clin. Microbiol. Antimicrob. 2020, 19, 26. [Google Scholar] [CrossRef] [PubMed]
- Perez, F.; Salata, R.A.; Bonomo, R.A. Current and novel antibiotics against resistant Gram-positive bacteria. Infect. Drug Resist. 2008, 1, 27–44. [Google Scholar] [CrossRef] [PubMed]
- Schoenfelder, S.M.; Lange, C.; Eckart, M.; Hennig, S.; Kozytska, S.; Ziebuhr, W. Success through diversity—How Staphylococcus epidermidis establishes as a nosocomial pathogen. Int. J. Med. Microbiol. 2010, 300, 380–386. [Google Scholar] [CrossRef] [PubMed]
- Battisti, A.S.; Modi, P.; Pangia, J. Sinusitis. In StatPearls [Internet]. Treasure Island (FL); StatPearls Publishing: Treasure Island, FL, USA, 2020. [Google Scholar]
- Deresinski, S. Vancomycin Heteroresistance and Methicillin-Resistant Staphylococcus aureus. J. Infect. Dis. 2009, 199, 605–609. [Google Scholar] [CrossRef] [PubMed]
- Weinstein, R.A.; Fridkin, S.K. Vancomycin-Intermediate and -Resistant Staphylococcus aureus: What the Infectious Disease Specialist Needs to Know. Clin. Infect. Dis. 2001, 32, 108–115. [Google Scholar] [CrossRef]
- European Committee on Antimicrobial Susceptibility Testing. Breakpoints Tables for Interpretation of MICs and Zones Diameters. Version 10.0. 2020. Available online: http://www.eucast.org (accessed on 26 February 2021).
- Li, S.; Zhao, L.; Zheng, B.; Shen, P.; Ji, J.; Lv, J.; Li, L.; Xiao, Y. Identification and characterization of cfr-positive Staphylococcus aureus isolates from community-onset infectious patients in a county hospital in China. J. Med. Microbiol. 2015, 64, 910–915. [Google Scholar] [CrossRef]
- de Neeling, A.; Broek, M.V.D.; Spalburg, E.; van Santen-Verheuvel, M.; Dam-Deisz, W.; Boshuizen, H.; van de Giessen, A.; van Duijkeren, E.; Huijsdens, X. High prevalence of methicillin resistant Staphylococcus aureus in pigs. Vet. Microbiol. 2007, 122, 366–372. [Google Scholar] [CrossRef]
- Fitzgerald, J.R. Livestock-associated Staphylococcus aureus: Origin, evolution and public health threat. Trends Microbiol. 2012, 20, 192–198. [Google Scholar] [CrossRef]
- Kosecka-Strojek, M.; Ilczyszyn, W.M.; Buda, A.; Polakowska, K.; Murzyn, K.; Panz, T.; Bialecka, A.; Kasprowicz, A.; Jakubczak, A.; Krol, J.; et al. Multiple-locus variable-number tandem repeat fingerprinting as a method for rapid and cost-effective typing of animal-associated Staphylococcus aureus strains from lineages other than sequence type 398. J. Med. Microbiol. 2016, 65, 1494–1504. [Google Scholar] [CrossRef]
- Morcillo, A.; Castro, B.; Rodríguez-Álvarez, C.; Abreu, R.; Aguirre-Jaime, A.; Arias, A. Descriptive Analysis of Antibiotic-Resistant Patterns of Methicillin-Resistant Staphylococcus aureus (MRSA) st398 Isolated from Healthy Swine. Int. J. Environ. Res. Public Heal. 2015, 12, 611–622. [Google Scholar] [CrossRef]
- Wulf, M.; Sørum, M.; Van Nes, A.; Skov, R.; Melchers, W.; Klaassen, C.; Voss, A. Prevalence of methicillin-resistant Staphylococcus aureus among veterinarians: An international study. Clin. Microbiol. Infect. 2008, 14, 29–34. [Google Scholar] [CrossRef]
- European Food Safety Authority: Analysis of the baseline survey on the prevalence of methicillin-resistant Staphylococcus aureus (MRSA) in holdings with breeding pigs, in the EU, 2008, Part A: MRSA prevalence estimates; on request from the European Commission. EFSA J. 2009, 1376, 1–82.
- Huber, H.; Giezendanner, N.; Stephan, R.; Zweifel, C. Genotypes, Antibiotic Resistance Profiles and Microarray-Based Characterization of Methicillin-Resistant Staphylococcus aureus Strains Isolated from Livestock and Veterinarians in Switzerland. Zoonoses Public Heal. 2010, 58, 343–349. [Google Scholar] [CrossRef]
- Hanssen, A.-M.; Sollid, J.U.E. SCCmec in staphylococci: Genes on the move. FEMS Immunol. Med Microbiol. 2006, 46, 8–20. [Google Scholar] [CrossRef] [PubMed]
- Ito, T.; Okuma, K.; Ma, X.X.; Yuzawa, H.; Hiramatsu, K. Insights on antibiotic resistance of Staphylococcus aureus from its whole genome: Genomic island SCC. Drug Resist. Updat. 2003, 6, 41–52. [Google Scholar] [CrossRef]
- Strandén, A.M.; Frei, R.; Adler, H.; Flückiger, U.; Widmer, A.F. Emergence of SCCmec Type IV as the Most Common Type of Methicillin-Resistant Staphylococcus aureus in a University Hospital. Infect. 2008, 37, 44–48. [Google Scholar] [CrossRef] [PubMed]
- Fossum, A.; Bukholm, G. Increased incidence of methicillin-resistant Staphylococcus aureus ST80, novel ST125 and SCCmecIV in the south-eastern part of Norway during a 12-year period. Clin. Microbiol. Infect. 2006, 12, 627–633. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Chen, C.-J.; Huang, Y.-C.; Chiu, C.-H.; Su, L.-H.; Lin, T.-Y. Clinical Features and Genotyping Analysis of Community-Acquired Methicillin-Resistant Staphylococcus aureus Infections in Taiwanese Children. Pediatr. Infect. Dis. J. 2005, 24, 40–45. [Google Scholar] [CrossRef] [PubMed]
- Nakaminami, H.; Takadama, S.; Ito, A.; Hasegawa, M.; Jono, C.; Noguchi, M.; Shoshi, M.; Wajima, T.; Fujii, T.; Maruyama, H.; et al. Characterization of SCCmec type IV methicillin-resistant Staphylococcus aureus clones increased in Japanese hospitals. J. Med. Microbiol. 2018, 67, 769–774. [Google Scholar] [CrossRef]
- Choo, E.J. Community-Associated Methicillin-Resistant Staphylococcus aureus in Nosocomial Infections. Infect. Chemother. 2017, 49, 158–159. [Google Scholar] [CrossRef] [PubMed]
- David, M.Z.; Cadilla, A.; Boyle-Vavra, S.; Daum, R.S. Replacement of HA-MRSA by CA-MRSA Infections at an Academic Medical Center in the Midwestern United States, 2004-5 to 2008. PLoS ONE 2014, 9, e92760. [Google Scholar] [CrossRef]
- Ho, J.; O’Donoghue, M.; Guardabassi, L.; Moodley, A.; Boost, M. Characterization of Methicillin-Resistant Staphylococcus aureus Isolates from Pig Carcasses in Hong Kong. Zoonoses Public Heal. 2012, 59, 416–423. [Google Scholar] [CrossRef]
- Rodríguez-López, P.; Filipello, V.; Di Ciccio, P.A.; Pitozzi, A.; Ghidini, S.; Scali, F.; Ianieri, A.; Zanardi, E.; Losio, M.N.; Simon, A.C.; et al. Assessment of the Antibiotic Resistance Profile, Genetic Heterogeneity and Biofilm Production of Methicillin-Resistant Staphylococcus aureus (MRSA) Isolated from The Italian Swine Production Chain. Foods 2020, 9, 1141. [Google Scholar] [CrossRef]
- O’Connor, A.M.; McManus, B.A.; Coleman, D.C. First description of novel arginine catabolic mobile elements (ACMEs) types IV and V harboring a kdp operon in Staphylococcus epidermidis characterized by whole genome sequencing. Infect. Genet. Evol. 2018, 61, 60–66. [Google Scholar] [CrossRef] [PubMed]
- Diep, B.A.; Gill, S.R.; Chang, R.F.; Phan, T.H.; Chen, J.H.; Davidson, M.G.; Lin, F.; Lin, J.; Carleton, H.A.; Mongodin, E.F.; et al. Complete genome sequence of USA300, an epidemic clone of community-acquired meticillin-resistant Staphylococcus aureus. Lancet 2006, 367, 731–739. [Google Scholar] [CrossRef]
- Shore, A.C.; Rossney, A.S.; Brennan, O.M.; Kinnevey, P.M.; Humphreys, H.; Sullivan, D.J.; Goering, R.V.; Ehricht, R.; Monecke, S.; Coleman, D.C. Characterization of a Novel Arginine Catabolic Mobile Element (ACME) and Staphylococcal Chromosomal Cassette mec Composite Island with Significant Homology to Staphylococcus epidermidis ACME Type II in Methicillin-Resistant Staphylococcus aureus Genotype ST22-MRSA-IV. Antimicrob. Agents Chemother. 2011, 55, 1896–1905. [Google Scholar] [CrossRef]
- Sabat, A.J.; Ilczyszyn, W.M.; Van Rijen, M.; Akkerboom, V.; Sinha, B.; Kluytmans, J.; Miedzobrodzki, J.; Grundmann, H.; Friedrich, A.W. Genome-wide analysis reveals two novel mosaic regions containing an ACME with an identical DNA sequence in the MRSA ST398-t011 and MSSA ST8-t008 isolates. J. Antimicrob. Chemother. 2015, 70, 1298–1302. [Google Scholar] [CrossRef][Green Version]
- Pi, B.; Yu, M.; Chen, Y.; Yu, Y.; Li, L. Distribution of the ACME-arcA gene among meticillin-resistant Staphylococcus haemolyticus and identification of a novel ccr allotype in ACME-arcA-positive isolates. J. Med. Microbiol. 2009, 58, 731–736. [Google Scholar] [CrossRef]
- McManus, B.A.; O’Connor, A.M.; Egan, S.A.; Flanagan, P.R.; Coleman, D.C. First description of arginine catabolic mobile element (ACME) type VI harboring the kdp operon only in Staphylococcus epidermidis using short and long read whole genome sequencing: Further evidence of ACME diversity. Infect. Genet. Evol. 2019, 71, 51–53. [Google Scholar] [CrossRef]
- McCarthy, H.; Rudkin, J.K.; Black, N.S.; Egallagher, L.; Eo’Neill, E.; O’Gara, J.P. Methicillin resistance and the biofilm phenotype in Staphylococcus aureus. Front. Cell. Infect. Microbiol. 2015, 5, 1. [Google Scholar] [CrossRef] [PubMed]
- Juda, M.; Helon, P.; Malm, A. Anti-adhesive and anti-biofilm activities in vitro of linezolid, vancomycin, tigecycline and daptomycin against Staphylococcus haemolyticus. Acta Pol. Pharm. 2016, 73, 1539–1543. [Google Scholar] [PubMed]
- Fernández-Barat, L.; Motos, A.; Panigada, M.; Álvarez-Lerma, F.; Viña, L.; Lopez-Aladid, R.; Ceccato, A.; Bassi, G.L.; Nicolau, D.P.; Lopez, Y.; et al. Comparative efficacy of linezolid and vancomycin for endotracheal tube MRSA biofilms from ICU patients. Crit. Care 2019, 23, 251. [Google Scholar] [CrossRef]
- Kosecka-Strojek, M.; Buda, A.; Międzobrodzki, J. Staphylococcal Ecology and Epidemiology. In Pet-To-Man Travelling Staphylococci, 1st ed.; Savini, V., Ed.; Elsevier Academic Press: Cambridge, MA, USA, 2018; pp. 11–24. [Google Scholar]
- Takeuchi, F.; Watanabe, S.; Baba, T.; Yuzawa, H.; Ito, T.; Morimoto, Y.; Kuroda, M.; Cui, L.; Takahashi, M.; Ankai, A.; et al. Whole-Genome Sequencing of Staphylococcus haemolyticus Uncovers the Extreme Plasticity of Its Genome and the Evolution of Human-Colonizing Staphylococcal Species. J. Bacteriol. 2005, 187, 7292–7308. [Google Scholar] [CrossRef]
- Biavasco, F.; Vignaroli, C.; Varaldo, P.E. Glycopeptide Resistance in Coagulase-Negative Staphylococci. Eur. J. Clin. Microbiol. Infect. Dis. 2000, 19, 403–417. [Google Scholar] [CrossRef] [PubMed]
- Miragaia, M. Factors Contributing to the Evolution of mecA-Mediated β-lactam Resistance in Staphylococci: Update and New Insights From Whole Genome Sequencing (WGS). Front. Microbiol. 2018, 9, 2723. [Google Scholar] [CrossRef]
- de Gopegui, E.R.; Juan, C.; Zamorano, L.; Pérez, J.L.; Oliver, A. Transferable Multidrug Resistance Plasmid Carrying cfr Associated with tet(L), ant(4′)-Ia, and dfrK Genes from a Clinical Methicillin-Resistant Staphylococcus aureus ST125 Strain. Antimicrob. Agents Chemother. 2012, 56, 2139–2142. [Google Scholar] [CrossRef]
- Kehrenberg, C.; Cuny, C.; Strommenger, B.; Schwarz, S.; Witte, W. Methicillin-Resistant and -Susceptible Staphylococcus aureus Strains of Clonal Lineages ST398 and ST9 from Swine Carry the Multidrug Resistance Gene cfr. Antimicrob. Agents Chemother. 2008, 53, 779–781. [Google Scholar] [CrossRef]
- Kehrenberg, C.; Schwarz, S. Distribution of Florfenicol Resistance Genes fexA and cfr among Chloramphenicol-Resistant Staphylococcus Isolates. Antimicrob. Agents Chemother. 2006, 50, 1156–1163. [Google Scholar] [CrossRef] [PubMed]
- Woo, P.C.Y.; Leung, A.S.P.; Leung, K.W.; Yuen, K.Y. Identification of slide coagulase positive, tube coagulase negative Staphylococcus aureus by 16S ribosomal RNA gene sequencing. Mol. Pathol. 2001, 54, 244–247. [Google Scholar] [CrossRef]
- Poyart, C.; Quesne, G.; Boumaila, C.; Trieu-Cuot, P. Rapid and Accurate Species-Level Identification of Coagulase-Negative Staphylococci by Using the sodA Gene as a Target. J. Clin. Microbiol. 2001, 39, 4296–4301. [Google Scholar] [CrossRef] [PubMed]
- Martineau, F.; Picard, F.J.; Ke, D.; Paradis, S.; Roy, P.H.; Ouellette, M.; Bergeron, M.G. Development of a PCR Assay for Identification of Staphylococci at Genus and Species Levels. J. Clin. Microbiol. 2001, 39, 2541–2547. [Google Scholar] [CrossRef] [PubMed]
- Mellmann, A.; Becker, K.; Von Eiff, C.; Keckevoet, U.; Schumann, P.; Harmsen, D. Sequencing and Staphylococci Identification. Emerg. Infect. Dis. 2006, 12, 333–336. [Google Scholar] [CrossRef] [PubMed]
- Kahl, B.C.; Mellmann, A.; Deiwick, S.; Peters, G.; Harmsen, D. Variation of the Polymorphic Region X of the Protein A Gene during Persistent Airway Infection of Cystic Fibrosis Patients Reflects Two Independent Mechanisms of Genetic Change in Staphylococcus aureus. J. Clin. Microbiol. 2005, 43, 502–505. [Google Scholar] [CrossRef] [PubMed]
- Enright, M.C.; Day, N.P.J.; Davies, C.E.; Peacock, S.J.; Spratt, B.G. Multilocus Sequence Typing for Characterization of Methicillin-Resistant and Methicillin-Susceptible Clones of Staphylococcus aureus. J. Clin. Microbiol. 2000, 38, 1008–1015. [Google Scholar] [CrossRef]
- Cavanagh, J.P.; Klingenberg, C.; Hanssen, A.-M.; Fredheim, E.A.; Francois, P.; Schrenzel, J.; Flægstad, T.; Sollid, J.E. Core genome conservation of Staphylococcus haemolyticus limits sequence based population structure analysis. J. Microbiol. Methods 2012, 89, 159–166. [Google Scholar] [CrossRef] [PubMed]
- Jolley, K.A.; Bray, J.E.; Maiden, M.C.J. Open-access bacterial population genomics: BIGSdb software, the PubMLST.org website and their applications. Wellcome Open Res. 2018, 3, 124. [Google Scholar] [CrossRef] [PubMed]
- Milheiriço, C.; Oliveira, D.C.; De Lencastre, H. Update to the Multiplex PCR Strategy for Assignment of mec Element Types in Staphylococcus aureus. Antimicrob. Agents Chemother. 2007, 51, 3374–3377. [Google Scholar] [CrossRef]
- Kondo, Y.; Ito, T.; Ma, X.X.; Watanabe, S.; Kreiswirth, B.N.; Etienne, J.; Hiramatsu, K. Combination of Multiplex PCRs for Staphylococcal Cassette Chromosome mec Type Assignment: Rapid Identification System for mec, ccr, and Major Differences in Junkyard Regions. Antimicrob. Agents Chemother. 2006, 51, 264–274. [Google Scholar] [CrossRef]
- Diep, B.A.; Stone, G.G.; Basuino, L.; Graber, C.J.; Miller, A.; Etages, S.D.; Jones, A.; Palazzolo-Ballance, A.M.; Perdreau-Remington, F.; Sensabaugh, G.F.; et al. The Arginine Catabolic Mobile Element and Staphylococcal Chromosomal Cassette mec Linkage: Convergence of Virulence and Resistance in the USA300 Clone of Methicillin-Resistant Staphylococcus aureus. J. Infect. Dis. 2008, 197, 1523–1530. [Google Scholar] [CrossRef]
- O’Connor, A.M.; McManus, B.A.; Kinnevey, P.M.; Brennan, G.I.; Fleming, T.E.; Cashin, P.J.; O’Sullivan, M.; Polyzois, I.; Coleman, D.C. Significant Enrichment and Diversity of the Staphylococcal Arginine Catabolic Mobile Element ACME in Staphylococcus epidermidis Isolates From Subgingival Peri-implantitis Sites and Periodontal Pockets. Front. Microbiol. 2018, 9, 1558. [Google Scholar] [CrossRef]
- Costa, S.S.; Sobkowiak, B.; Parreira, R.; Edgeworth, J.D.; Viveiros, M.; Clark, T.G.; Couto, I. Genetic Diversity of norA, Coding for a Main Efflux Pump of Staphylococcus aureus. Front. Genet. 2019, 9, 710. [Google Scholar] [CrossRef]
- Marco, L.; Liliana, G.; Anna, B.; Annarita, M. Intrinsic role of coagulase negative staphylococci norA-like efflux system in fluoroquinolones resistance. AIMS Microbiol. 2017, 3, 908–914. [Google Scholar] [CrossRef]
- Vakulenko, S.B.; Donabedian, S.M.; Voskresenskiy, A.M.; Zervos, M.J.; Lerner, S.A.; Chow, J.W. Multiplex PCR for Detection of Aminoglycoside Resistance Genes in Enterococci. Antimicrob. Agents Chemother. 2003, 47, 1423–1426. [Google Scholar] [CrossRef]
- Pyzik, E.; Marek, A.; Stępień-Pyśniak, D.; Urban-Chmiel, R.; Jarosz, Ł.S.; Jagiełło-Podębska, I. Detection of antibiotic resistance and classical enterotoxin genes in coagulase -negative staphylococci isolated from poultry in Poland. J. Veter- Res. 2019, 63, 183–190. [Google Scholar] [CrossRef]
- Brenciani, A.; Fioriti, S.; Morroni, G.; Cucco, L.; Morelli, A.; Pezzotti, G.; Paniccià, M.; Antonelli, A.; Magistrali, C.F.; Rossolini, G.M.; et al. Detection in Italy of a porcine Enterococcus faecium isolate carrying the novel phenicol-oxazolidinone-tetracycline resistance gene poxtA. J. Antimicrob. Chemother. 2018, 74, 817–818. [Google Scholar] [CrossRef]
- Tristan, A.; Ying, L.; Bes, M.; Etienne, J.; Vandenesch, F.; Lina, G. Use of Multiplex PCR To Identify Staphylococcus aureus Adhesins Involved in Human Hematogenous Infections. J. Clin. Microbiol. 2003, 41, 4465–4467. [Google Scholar] [CrossRef]
- Jarraud, S.; Mougel, C.; Thioulouse, J.; Lina, G.; Meugnier, H.; Forey, F.; Nesme, X.; Etienne, J.; Vandenesch, F. Relationships between Staphylococcus aureus Genetic Background, Virulence Factors, agr Groups (Alleles), and Human Disease. Infect. Immun. 2002, 70, 631–641. [Google Scholar] [CrossRef] [PubMed]
- El-Baz, R.; Rizk, D.E.; Barwa, R.; Hassan, R. Virulence characteristics and molecular relatedness of methicillin resistant Staphylococcus aureus harboring different staphylococcal cassette chromosome mec. Microb. Pathog. 2017, 113, 385–395. [Google Scholar] [CrossRef] [PubMed]
- Pinheiro-Hubinger, L.; Brito, C.I.; De Oliveira, A.; Martins, P.Y.F.; Pereira, V.C.; Cunha, M.D.L.R.D.S.D. Staphylococcus epidermidis and Staphylococcus haemolyticus: Molecular Detection of Cytotoxin and Enterotoxin Genes. Toxins 2015, 7, 3688–3699. [Google Scholar] [CrossRef] [PubMed]
- Rohde, H.; Knobloch, J.K.M.; Horstkotte, M.A.; Mack, D.; Arciola, C.R.; Montanaro, L.; Baldassarri, L. Correlation of Staphylococcus aureus icaADBC Genotype and Biofilm Expression Phenotype. J. Clin. Microbiol. 2001, 39, 4595–4596. [Google Scholar] [CrossRef]
- Kiem, S.; Oh, W.S.; Peck, K.R.; Lee, N.Y.; Lee, J.-Y.; Song, J.-H.; Hwang, E.S.; Kim, E.-C.; Cha, C.Y.; Choe, K.-W. Phase Variation of Biofilm Formation in Staphylococcus aureus by IS256Insertion and Its Impact on the Capacity Adhering to Polyurethane Surface. J. Korean Med Sci. 2004, 19, 779–782. [Google Scholar] [CrossRef]
- Miller, K.; Dunsmore, C.J.; Fishwick, C.W.G.; Chopra, I. Linezolid and Tiamulin Cross-Resistance in Staphylococcus aureus Mediated by Point Mutations in the Peptidyl Transferase Center. Antimicrob. Agents Chemother. 2008, 52, 1737–1742. [Google Scholar] [CrossRef] [PubMed]
- Mendes, R.E.; Deshpande, L.M.; Farrell, D.J.; Spanu, T.; Fadda, G.; Jones, R.N. Assessment of linezolid resistance mechanisms among Staphylococcus epidermidis causing bacteraemia in Rome, Italy. J. Antimicrob. Chemother. 2010, 65, 2329–2335. [Google Scholar] [CrossRef] [PubMed]
| MLST | spa Type | SCCmec Cassette Type | ACME Type | Virulence and Biofilm Formation Genes | |
|---|---|---|---|---|---|
| S. aureus WAW1257 | ST 398 (arcC allel 3; aroE allel 35; glpF allel 19; gmk allel 2; pta allel 20; tpi allel 26; yqiL allel 39) | t4474 | IVE | II | clfB, clfA, fnbB, fib, hlg, hla, hld, hlb, icaABDC operon |
| S. haemolyticus WAW954 | ST42 (arcC allel 1; cfxE allel 1; hemH allel 1; leuB allel 1; RiboseABC allel 4; SH1200 allel 1; SH1431 allel 5) | not applicable | mecA only | III | fib, hla, hlb |
| Strain No. WAW1257 (S. aureus) | Strain No. WAW954 (S. haemolyticus) | |||||
|---|---|---|---|---|---|---|
| Antibiotic | MIC (µg/mL) | Interpretation (S/R) | Antibiotic Restistance Genes | MIC (µg/mL) | Interpretation (S/R) | Antibiotic Restistance Genes |
| Linezolid | 3 | S | optrA, poxtA, T314C and G362A mutations in rplC (L3), C575T mutation in rplD (L4) | 6 | R | cfr |
| Cefoxitin | 48 | R | mecA | 64 | R | mecA |
| Vancomycin | 3 | R | - | 4 | S | - |
| Teicoplanin | 3 | R | - | 6 | R | - |
| Daptomycin | 1 | S | - | 0.75 | S | - |
| Fosfomycin | 3 | S | - | 256 | R | - |
| Ciprofloxacin | 32 | R | norA | 32 | R | - |
| Tetracycline | 256 | R | - | 96 | R | - |
| Tigecycline | 0.50 | S | - | 1.5 | R | - |
| Chloramphenicol | 48 | R | - | 256 | R | fexA |
| Gentamicin | 0.75 | S | - | 24 | R | aac(6′)-Ie-aph(2″) |
| Clindamycin | 256 | R | - | 256 | R | - |
| Amikacin | 3 | S | - | 6 | S | - |
| Erythromycin | 256 | R | - | 256 | R | - |
| Trimethoprim-Sulfamethoxazole | 32 | R | - | 2 | S | - |
| Levofloxacin | 8 | R | norA | 32 | R | - |
| Nitrofurantoin | 96 | R | - | 128 | R | - |
| Benzylpenicillin | 24 | R | - | 256 | R | - |
| Gene | Sequence (5′-3′) | Product Size (bp) | References | |
|---|---|---|---|---|
| Adhesin genes | clfB (S. aureus) | ACATCAGTAATAGTAGGGGGCAAC | 205 | [88] |
| TTCGCACTGTTTGTGTTTGCAC | ||||
| clfA (S. aureus) | ATTGGCGTGGCTTCAGTGCT | 292 | ||
| CGTTTCTTCCGTAGTTGCATTTG | ||||
| fnbB (S. aureus) | GTAACAGCTAATGGTCGAATTGATACT | 524 | ||
| CAAGTTCGATAGGAGTACTATGTTC | ||||
| fnbA (S. aureus) | GTGAAGTTTTAGAAGGTGGAAAGATTAG | 643 | ||
| GCTCTTGTAAGACCATTTTTCTTCAC | ||||
| fib (S. aureus) | CTACAACTACAATTGCCGTCAACAG | 404 | ||
| GCTCTTGTAAGACCATTTTCTTCAC | ||||
| fib (S. haemolyticus) | TTATTTGACTTTCATACTTTGTA | 1698 | This study | |
| ATGGCATATGATGGCTTATTCA | ||||
| Hemolysin genes | hla (S. aureus) | CTGATTACTATCCAAGAAATTCGATTG | 209 | [89] |
| CTTTCCAGCCTACTTTTTTATCAGT | ||||
| hlg (S. aureus) | GTCAYAGAGTCCATAATGCATTTAA | 535 | ||
| CACCAAATGTATAGCCTAAAGTG | ||||
| hld (S. aureus) | AAGAATTTTTATCTTAATTAAGGAAGGAGTG | 111 | ||
| TTAGTGAATTTGTTCACTGTGTCGA | ||||
| hlb (S. aureus) | GCAATATAAACGCGCTGATTTAATCG | 518 | [90] | |
| GAGTGCCTTTATTGACATTAAGGTCG | ||||
| hla (S. haemolyticus) | TGGGCCATAAACTTCAATCGC | 72 | [91] | |
| ACGCCACCTACATGCAGATTT | ||||
| hlb (S. haemolyticus) | ATGTCTAACTCAACTAAGAATGC | 684 | This study | |
| CTAAATAAAATAAAGTATTGCTA | ||||
| ica operon (S. aureus and S. haemolyticus) | icaA | ACACTTGCTGGCGCAGTCAA | 188 | [92] |
| TCTGGAACCAACATCCAACA | ||||
| icaB | AGAATCGTGAAGTATAGAAAATT | 900 | [93] | |
| TCTAATCTTTTTCATGGAATCCGT | ||||
| icaC | ATGGGACGGATTCCATGAAAAAGA | 1100 | ||
| TAATAAGCATTAATGTTCAATT | ||||
| icaD | ATGGTCAAGCCCAGACAGAG | 198 | [92] | |
| AGTATTTTCAATGTTTAAAGCAA |
| Target Genes | Sequence (5′-3′) | PCR Conditions | Cycles (Steps 2–4) | Reference | |
|---|---|---|---|---|---|
| rplC (L3) 822-bp | rplC-F (S. aureus) | AACCTGATTTAGTTCCGTCTA | 94 °C for 2 min 94 °C for 1 min 50 °C for 1 min 72 °C for 1 min 72 °C for 5 min | 33 | [94] |
| rplC-R | GTTGACGCTTTAATGGGCTTA | ||||
| rplC-F (S. haemolyticus) | ACCCTGATTTAGTTCCGTCTA | [95] | |||
| rplD (L4) 1099-bp | rplD-F | TCGCTTACCTCCTTAATG | 95 °C for 5 min 95 °C for 30 s 45 °C for 30 s 72 °C for 1 min 72 °C for 10 min | 30 | [94] |
| rplD-R | GGTGGAAACACTGTAACTG | ||||
| rplV (L22) 520-bp | rplV-F | TTTCAGCATACCATTTTGCTTCC | 94 °C for 2 min 94 °C for 10 s 50 °C for 30 s 72 °C for 30 s 72 °C for 5 min | 30 | [6] |
| rplV-R | TAAAGGACATGCAGCAGACG | ||||
| 23S rRNA 846-bp | 23S-F | CGGCGGCCGTAACTATAACG | 95 °C for 5 min 95 °C for 30 s 50 °C for 30 s 72 °C for 30 s 72 °C for 10 min | 30 | |
| 23S-R | CAGCACTTATCCCGTCCATAC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Michalik, M.; Kosecka-Strojek, M.; Wolska, M.; Samet, A.; Podbielska-Kubera, A.; Międzobrodzki, J. First Case of Staphylococci Carrying Linezolid Resistance Genes from Laryngological Infections in Poland. Pathogens 2021, 10, 335. https://doi.org/10.3390/pathogens10030335
Michalik M, Kosecka-Strojek M, Wolska M, Samet A, Podbielska-Kubera A, Międzobrodzki J. First Case of Staphylococci Carrying Linezolid Resistance Genes from Laryngological Infections in Poland. Pathogens. 2021; 10(3):335. https://doi.org/10.3390/pathogens10030335
Chicago/Turabian StyleMichalik, Michał, Maja Kosecka-Strojek, Mariola Wolska, Alfred Samet, Adrianna Podbielska-Kubera, and Jacek Międzobrodzki. 2021. "First Case of Staphylococci Carrying Linezolid Resistance Genes from Laryngological Infections in Poland" Pathogens 10, no. 3: 335. https://doi.org/10.3390/pathogens10030335
APA StyleMichalik, M., Kosecka-Strojek, M., Wolska, M., Samet, A., Podbielska-Kubera, A., & Międzobrodzki, J. (2021). First Case of Staphylococci Carrying Linezolid Resistance Genes from Laryngological Infections in Poland. Pathogens, 10(3), 335. https://doi.org/10.3390/pathogens10030335

