Occurrence of Ten Protozoan Enteric Pathogens in Three Non-Human Primate Populations
Abstract
:1. Introduction
2. Results
2.1. Parasitological Analysis
2.2. Prevalence of Parasites by Primate Species and Site
2.2.1. Chimpanzees from Senegal
2.2.2. Gorillas from the Republic of the Congo
2.2.3. Gorillas from the Beauval Zoo
2.3. Genotyping of Blastocystis spp.
3. Discussion
4. Materials and Methods
4.1. Sample Collection and Information
4.2. Ethical Statement
4.3. DNA Extraction from Stool Samples
4.4. Singleplex Real-Time PCR Amplification and Detection
4.5. Amplification of the Small Subunit Ribosomal DNA (SSU rDNA) Gene and Blastocystis Typing
4.6. Accession Numbers
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Chalmers, R.M.; Smith, R.P.; Hadfield, S.J.; Elwin, K.; Giles, M. Zoonotic Linkage and Variation in Cryptosporidium Parvum from Patients in the United Kingdom. Parasitol. Res. 2011, 108, 1321–1325. [Google Scholar] [CrossRef]
- Giangaspero, A.; Berrilli, F.; Brandonisio, O. Giardia and Cryptosporidium and Public Health: The Epidemiological Scenario from the Italian Perspective. Parasitol. Res. 2007, 101, 1169–1182. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ng, J.; Yang, R.; Whiffin, V.; Cox, P.; Ryan, U. Identification of Zoonotic Cryptosporidium and Giardia Genotypes Infecting Animals in Sydney’s Water Catchments. Exp. Parasitol. 2011, 128, 138–144. [Google Scholar] [CrossRef] [Green Version]
- Rimšelienė, G.; Vold, L.; Robertson, L.; Nelke, C.; Søli, K.; Johansen, Ø.H.; Thrana, F.S.; Nygård, K. An Outbreak of Gastroenteritis among Schoolchildren Staying in a Wildlife Reserve: Thorough Investigation Reveals Norway’s Largest Cryptosporidiosis Outbreak. Scand. J. Public Health 2011, 39, 287–295. [Google Scholar] [CrossRef]
- Herrera, J.P.; Chakraborty, D.; Rushmore, J.; Altizer, S.; Nunn, C. The Changing Ecology of Primate Parasites: Insights from Wild-captive Comparisons. Am. J. Primatol. 2019, 81, e22991. [Google Scholar] [CrossRef]
- Zanzani, S.A.; Gazzonis, A.L.; Epis, S.; Manfredi, M.T. Study of the Gastrointestinal Parasitic Fauna of Captive Non-Human Primates (Macaca Fascicularis). Parasitol. Res. 2016, 115, 307–312. [Google Scholar] [CrossRef]
- Vlčková, K.; Kreisinger, J.; Pafčo, B.; Čížková, D.; Tagg, N.; Hehl, A.B.; Modrý, D. Diversity of Entamoeba Spp. in African Great Apes and Humans: An Insight from Illumina MiSeq High-Throughput Sequencing. Int. J. Parasitol. 2018, 48, 519–530. [Google Scholar] [CrossRef]
- Kalishman, J.; Paul-Murphy, J.; Scheffler, J.; Thomson, J.A. Survey of Cryptosporidium and Giardia Spp. in a Captive Population of Common Marmosets. Lab. Anim. Sci. 1996, 46, 116–119. [Google Scholar]
- Gillespie, T.R.; Chapman, C.A. Forest Fragmentation, the Decline of an Endangered Primate, and Changes in Host-Parasite Interactions Relative to an Unfragmented Forest. Am. J. Primatol. 2008, 70, 222–230. [Google Scholar] [CrossRef] [PubMed]
- Yoshikawa, H.; Wu, Z.; Pandey, K.; Pandey, B.D.; Sherchand, J.B.; Yanagi, T.; Kanbara, H. Molecular Characterization of Blastocystis Isolates from Children and Rhesus Monkeys in Kathmandu, Nepal. Vet. Parasitol. 2009, 160, 295–300. [Google Scholar] [CrossRef]
- Meloni, D.; Poirier, P.; Mantini, C.; Noël, C.; Gantois, N.; Wawrzyniak, I.; Delbac, F.; Chabé, M.; Delhaes, L.; Dei-Cas, E.; et al. Mixed Human Intra- and Inter-Subtype Infections with the Parasite Blastocystis Sp. Parasitol. Int. 2012, 61, 719–722. [Google Scholar] [CrossRef]
- Skotarczak, B. Genetic Diversity and Pathogenicity of Blastocystis. Ann. Agric. Environ. Med. 2018, 25, 411–416. [Google Scholar] [CrossRef]
- Fletcher, S.M.; Stark, D.; Harkness, J.; Ellis, J. Enteric Protozoa in the Developed World: A Public Health Perspective. Clin. Microbiol. Rev. 2012, 25, 420–449. [Google Scholar] [CrossRef] [Green Version]
- Menu, E.; Mary, C.; Toga, I.; Raoult, D.; Ranque, S.; Bittar, F. A Hospital QPCR-Based Survey of 10 Gastrointestinal Parasites in Routine Diagnostic Screening, Marseille, France. Epidemiol. Infect. 2019, 147. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Teare, J.A.; Loomis, M.R. Epizootic of Balantidiasis in Lowland Gorillas. J. Am. Vet. Med. Assoc. 1982, 181, 1345–1347. [Google Scholar] [PubMed]
- Lankester, F.; Mätz-Rensing, K.; Kiyang, J.; Jensen, S.A.; Weiss, S.; Leendertz, F.H. Fatal Ulcerative Colitis in a Western Lowland Gorilla (Gorilla Gorilla Gorilla). J. Med. Primatol. 2008, 37, 297–302. [Google Scholar] [CrossRef] [Green Version]
- Stark, D.; Phillips, O.; Peckett, D.; Munro, U.; Marriott, D.; Harkness, J.; Ellis, J. Gorillas Are a Host for Dientamoeba Fragilis: An Update on the Life Cycle and Host Distribution. Vet. Parasitol. 2008, 151, 21–26. [Google Scholar] [CrossRef]
- Lankester, F.; Kiyang, J.A.; Bailey, W.; Unwin, S. Dientamoeba Fragilis: Initial Evidence of Pathogenicity in the Western Lowland Gorilla (Gorilla Gorilla Gorilla). J. Zoo Wildl. Med. 2010, 41, 350–352. [Google Scholar] [CrossRef] [PubMed]
- Munene, E.; Otsyula, M.; Mbaabu, D.A.; Mutahi, W.T.; Muriuki, S.M.; Muchemi, G.M. Helminth and Protozoan Gastrointestinal Tract Parasites in Captive and Wild-Trapped African Non-Human Primates. Vet. Parasitol. 1998, 78, 195–201. [Google Scholar] [CrossRef]
- Berrilli, F.; Prisco, C.; Friedrich, K.G.; Di Cerbo, P.; Di Cave, D.; De Liberato, C. Giardia Duodenalis Assemblages and Entamoeba Species Infecting Non-Human Primates in an Italian Zoological Garden: Zoonotic Potential and Management Traits. Parasit. Vectors 2011, 4, 199. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Levecke, B.; Dorny, P.; Geurden, T.; Vercammen, F.; Vercruysse, J. Gastrointestinal Protozoa in Non-Human Primates of Four Zoological Gardens in Belgium. Vet. Parasitol. 2007, 148, 236–246. [Google Scholar] [CrossRef] [Green Version]
- Pérez Cordón, G.; Hitos Prados, A.; Romero, D.; Sánchez Moreno, M.; Pontes, A.; Osuna, A.; Rosales, M.J. Intestinal Parasitism in the Animals of the Zoological Garden “Peña Escrita” (Almuñecar, Spain). Vet. Parasitol. 2008, 156, 302–309. [Google Scholar] [CrossRef]
- Medkour, H.; Amona, I.; Laidoudi, Y.; Davoust, B.; Bitam, I.; Levasseur, A.; Akiana, J.; Diatta, G.; Pacheco, L.; Gorsane, S.; et al. Parasitic Infections in African Humans and Non-Human Primates. Pathogens 2020, 9, 561. [Google Scholar] [CrossRef]
- Wasson, K.; Peper, R.L. Mammalian Microsporidiosis. Vet. Pathol. 2000, 37, 113–128. [Google Scholar] [CrossRef] [Green Version]
- Graczyk, T.K.; Bosco-Nizeyi, J.; da Silva, A.J.; Moura, I.N.S.; Pieniazek, N.J.; Cranfield, M.R.; Lindquist, H.D.A. A Single Genotype of Encephalitozoon Intestinalis Infects Free-Ranging Gorillas and People Sharing Their Habitats in Uganda. Parasitol. Res. 2002, 88, 926–931. [Google Scholar] [CrossRef]
- Mynářová, A.; Foitová, I.; Kváč, M.; Květoňová, D.; Rost, M.; Morrogh-Bernard, H.; Nurcahyo, W.; Nguyen, C.; Supriyadi, S.; Sak, B. Prevalence of Cryptosporidium Spp., Enterocytozoon Bieneusi, Encephalitozoon Spp. and Giardia Intestinalis in Wild, Semi-Wild and Captive Orangutans (Pongo Abelii and Pongo Pygmaeus) on Sumatra and Borneo, Indonesia. PLoS ONE 2016, 11, e0152771. [Google Scholar] [CrossRef] [Green Version]
- Boorom, K.F.; Smith, H.; Nimri, L.; Viscogliosi, E.; Spanakos, G.; Parkar, U.; Li, L.-H.; Zhou, X.-N.; Ok, U.Z.; Leelayoova, S.; et al. Oh My Aching Gut: Irritable Bowel Syndrome, Blastocystis, and Asymptomatic Infection. Parasit. Vectors 2008, 1, 40. [Google Scholar] [CrossRef] [Green Version]
- Cian, A.; El Safadi, D.; Osman, M.; Moriniere, R.; Gantois, N.; Benamrouz-Vanneste, S.; Delgado-Viscogliosi, P.; Guyot, K.; Li, L.-L.; Monchy, S.; et al. Molecular Epidemiology of Blastocystis Sp. in Various Animal Groups from Two French Zoos and Evaluation of Potential Zoonotic Risk. PLoS ONE 2017, 12, e0169659. [Google Scholar] [CrossRef] [Green Version]
- Alfellani, M.A.; Jacob, A.S.; Perea, N.O.; Krecek, R.C.; Taner-Mulla, D.; Verweij, J.J.; Levecke, B.; Tannich, E.; Clark, C.G.; Stensvold, C.R. Diversity and Distribution of Blastocystis Sp. Subtypes in Non-Human Primates. Parasitology 2013, 140, 966–971. [Google Scholar] [CrossRef] [Green Version]
- Stensvold, C.R.; Clark, C.G. Current Status of Blastocystis: A Personal View. Parasitol. Int. 2016, 65, 763–771. [Google Scholar] [CrossRef]
- Li, J.; Karim, M.R.; Li, D.; Sumon, S.M.R.; Siddiki, S.F.; Rume, F.I.; Sun, R.; Jia, Y.; Zhang, L. Molecular Characterization of Blastocystis Sp. in Captive Wildlife in Bangladesh National Zoo: Non-Human Primates with High Prevalence and Zoonotic Significance. Int. J. Parasitol. Parasites Wildl. 2019, 10, 314–320. [Google Scholar] [CrossRef]
- Sow, D.; Parola, P.; Sylla, K.; Ndiaye, M.; Delaunay, P.; Halfon, P.; Camiade, S.; Dieng, T.; Tine, R.C.K.; Faye, B.; et al. Performance of Real-Time Polymerase Chain Reaction Assays for the Detection of 20 Gastrointestinal Parasites in Clinical Samples from Senegal. Am. J. Trop. Med. Hyg. 2017, 97, 173–182. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Menu, E.; Mary, C.; Toga, I.; Raoult, D.; Ranque, S.; Bittar, F. Evaluation of Two DNA Extraction Methods for the PCR-Based Detection of Eukaryotic Enteric Pathogens in Fecal Samples. BMC Res. Notes 2018, 11, 206. [Google Scholar] [CrossRef] [Green Version]
- Mejia, R.; Vicuña, Y.; Broncano, N.; Sandoval, C.; Vaca, M.; Chico, M.; Cooper, P.J.; Nutman, T.B. A Novel, Multi-Parallel, Real-Time Polymerase Chain Reaction Approach for Eight Gastrointestinal Parasites Provides Improved Diagnostic Capabilities to Resource-Limited at-Risk Populations. Am. J. Trop. Med. Hyg. 2013, 88, 1041–1047. [Google Scholar] [CrossRef] [PubMed]
- Stensvold, C.R.; Ahmed, U.N.; Andersen, L.O.; Nielsen, H.V. Development and Evaluation of a Genus-Specific, Probe-Based, Internal-Process-Controlled Real-Time PCR Assay for Sensitive and Specific Detection of Blastocystis Spp. J. Clin. Microbiol. 2012, 50, 1847–1851. [Google Scholar] [CrossRef] [Green Version]
- Garcés-Sanchez, G.; Wilderer, P.A.; Munch, J.C.; Horn, H.; Lebuhn, M. Evaluation of Two Methods for Quantification of Hsp70 MRNA from the Waterborne Pathogen Cryptosporidium Parvum by Reverse Transcription Real-Time PCR in Environmental Samples. Water Res. 2009, 43, 2669–2678. [Google Scholar] [CrossRef]
- Verweij, J.J.; Laeijendecker, D.; Brienen, E.A.T.; van Lieshout, L.; Polderman, A.M. Detection of Cyclospora Cayetanensis in Travellers Returning from the Tropics and Subtropics Using Microscopy and Real-Time PCR. Int. J. Med. Microbiol. 2003, 293, 199–202. [Google Scholar] [CrossRef]
- Ten Hove, R.-J.; van Lieshout, L.; Brienen, E.A.T.; Perez, M.A.; Verweij, J.J. Real-Time Polymerase Chain Reaction for Detection of Isospora Belli in Stool Samples. Diagn. Microbiol. Infect. Dis. 2008, 61, 280–283. [Google Scholar] [CrossRef] [PubMed]
- Verweij, J.J.; Mulder, B.; Poell, B.; van Middelkoop, D.; Brienen, E.A.; van Lieshout, L. Real-Time PCR for the Detection of Dientamoeba Fragilis in Fecal Samples. Mol. Cell. Probes 2007, 21, 400–404. [Google Scholar] [CrossRef]
- Menotti, J.; Cassinat, B.; Sarfati, C.; Liguory, O.; Derouin, F.; Molina, J.-M. Development of a Real-Time PCR Assay for Quantitative Detection of Encephalitozoon Intestinalis DNA. J. Clin. Microbiol. 2003, 41, 1410–1413. [Google Scholar] [CrossRef] [Green Version]
- Roy, S.; Kabir, M.; Mondal, D.; Ali, I.K.M.; Petri, W.A.; Haque, R. Real-Time-PCR Assay for Diagnosis of Entamoeba Histolytica Infection. J. Clin. Microbiol. 2005, 43, 2168–2172. [Google Scholar] [CrossRef] [Green Version]
- Menotti, J.; Cassinat, B.; Porcher, R.; Sarfati, C.; Derouin, F.; Molina, J.-M. Development of a Real-Time Polymerase-Chain-Reaction Assay for Quantitative Detection of Enterocytozoon Bieneusi DNA in Stool Specimens from Immunocompromised Patients with Intestinal Microsporidiosis. J. Infect. Dis. 2003, 187, 1469–1474. [Google Scholar] [CrossRef] [Green Version]
- Verweij, J.J.; Blange, R.A.; Templeton, K.; Schinkel, J.; Brienen, E.A.; van Rooyen, M.A.; van Lieshout, L.; Polderman, A.M. Simultaneous Detection of Entamoeba Histolytica, Giardia Lamblia, and Cryptosporidium Parvum in Fecal Samples by Using Multiplex Real-Time PCR. J. Clin. Microbiol. 2004, 42, 1220–1223. [Google Scholar] [CrossRef] [Green Version]
- Poirier, P.; Wawrzyniak, I.; Albert, A.; El Alaoui, H.; Delbac, F.; Livrelli, V. Development and Evaluation of a Real-Time PCR Assay for Detection and Quantification of Blastocystis Parasites in Human Stool Samples: Prospective Study of Patients with Hematological Malignancies. J. Clin. Microbiol. 2011, 49, 975–983. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Tested Parasites | Chimpanzees (n = 48) from Senegal | Gorillas (n = 19) from the Republic of the Congo | Gorillas (n = 9) from the Beauval Zoo, France | Overall | |||
---|---|---|---|---|---|---|---|
Number | % | Number | % | Number | % | % | |
Giardia intestinalis | 1 | 2.1 | 5 | 26.3 | 0 | 0 | 7.9 |
Cryptosporidium spp. | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Balantidium coli | 0 | 0 | 11 | 57.9 | 7 | 77.8 | 23.7 |
Blastocystis spp. | 47 | 97.9 | 19 | 100 | 8 | 88.9 | 97.4 |
Cyclospora cayetanensis | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Dientamoeba fragilis | 12 | 25.0 | 0 | 0 | 0 | 0 | 0.2 |
Enterocytozoon bieneusi | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Encephalitozoon intestinalis | 0 | 0 | 1 | 5.3 | 0 | 0 | 1.3 |
Entamoeba histolytica | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Cystoisospora belli | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Positives | ST1 | ST2 | ST5 | ||||
---|---|---|---|---|---|---|---|
Number | Number | % | Number | % | Number | % | |
Chimpanzees from Senegal | 47 | 47 | 100 | 0 | 0 | 0 | 0 |
Gorilla from the Republic of the Congo | 19 | 11 | 57.9 | 8 | 42.1 | 0 | 0 |
Gorilla from the Beauval Zoo, France | 8 | 2 | 25 | 2 | 25 | 4 | 50 |
Total | 74 | 60 | 81.1 | 10 | 13.5 | 4 | 5.4 |
Parasite | Target Gene | Primer/Probe Names | Sequence 5′-3′ | Source |
---|---|---|---|---|
BcoliF | TGCAATGTGAATTGCAGAACC | |||
Balantidium coli | ITS1 | BcoliR | TGGTTACGCACACTGAAACAA | [32] |
BcoliP | FAM-CTGGTTTAGCCAGTGCCAGTTGC-TAMRA | |||
Blasto FWD F5 | GGTCCGGTGAACACTTTGGATTT | |||
Blastocystis sp. | 18S | Blasto R F2 | CCTACGGAAACCTTGTTACGACTTCA | [35] |
Blasto probe | FAM-CCTACGGAAACCTTGTTACGACTTCA-MGB | |||
1PS_F | AACTTTAGCTCCAGTTGAGAAAGTACTC | |||
Cryptosporidium hominis/parvum | Hsp70 | 1PS_R | CATGGCTCTTTACCGTTAAAGAATTCC | [36] |
Crypt_P | FAM-AATACGTGTAGAACCACCAACCAATACAACATC-TAMRA | |||
Cyclo250F | TAGTAACCGAACGGATCGCATT | |||
Cyclospora cayetanensis | 18S | Cyclo350R | AATGCCACGTAGGCCAATA | [37] |
Cyclo281T | FAM-CCGGCGATAGATCATTCAAGTTTCTGACC-TAMRA | |||
Ib-40F | ATATTCCCTGCAGCATGTCTGTTT | |||
Cystoisospora belli | ITS2 | Ib-129R | CCACACGCGTATTCCAGAGA | [38] |
Ib-81Taq | FAM-CAAGTTCTGCTCACGCGCTTCTGG-TAMRA | |||
Df-124F | CAACGGATGTCTTGGCTCTTTA | |||
Dientamoeba fragilis | 18S | Df-221R | TGCATTCAAAGATCGAACTTATCAC | [39] |
Df-172revT | FAM-CAATTCTAGCCGCTTAT-TAMRA | |||
FEI1 | GCAAGGGAGGAATGGAACAGAACAG | |||
Encephalitozoon intestinalis | 18S | REI1 | CACGTTCAGAAGCCCATTACACAGC | [40] |
PEI1 | FAM-CGGGCGGCACGCGCACTACGATA-TAMRA | |||
Ehf | AACAGTAATAGTTTCTTTGGTTAGTAAAA | |||
Entamoeba histolytica | 18S | Ehr | CTTAGAATGTCATTTCTCAATTCAT | [41] |
Ehp | FAM-ATTAGTACAAAATGGCCAATTCATTCA-TAMRA | |||
FEB1 | CGCTGTAGTTCCTGCAGTAAACTATGCC | |||
Enterocytozoon bieneusi | 18S | REB1 | CTTGCGAGCGTACTATCCCCAGAG | [42] |
PEB1 | FAM-ACGTGGGCGGGAGAAATCTTTAGTGTTCGGG-TAMRA | |||
Giardia-80F | GACGGCTCAGGACAACGGTT | |||
Giardia intestinalis | 18S | Giardia-127R | TTGCCAGCGGTGTCCG | [43] |
Giardia-105T | FAM-CCCGCGGCGGTCCCTGCTAG-TAMRA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Menu, E.; Davoust, B.; Mediannikov, O.; Akiana, J.; Mulot, B.; Diatta, G.; Levasseur, A.; Ranque, S.; Raoult, D.; Bittar, F. Occurrence of Ten Protozoan Enteric Pathogens in Three Non-Human Primate Populations. Pathogens 2021, 10, 280. https://doi.org/10.3390/pathogens10030280
Menu E, Davoust B, Mediannikov O, Akiana J, Mulot B, Diatta G, Levasseur A, Ranque S, Raoult D, Bittar F. Occurrence of Ten Protozoan Enteric Pathogens in Three Non-Human Primate Populations. Pathogens. 2021; 10(3):280. https://doi.org/10.3390/pathogens10030280
Chicago/Turabian StyleMenu, Estelle, Bernard Davoust, Oleg Mediannikov, Jean Akiana, Baptiste Mulot, Georges Diatta, Anthony Levasseur, Stéphane Ranque, Didier Raoult, and Fadi Bittar. 2021. "Occurrence of Ten Protozoan Enteric Pathogens in Three Non-Human Primate Populations" Pathogens 10, no. 3: 280. https://doi.org/10.3390/pathogens10030280