Antimicrobial Resistance Profiles of Salmonella Isolates on Chickens Processed and Retailed at Outlets of the Informal Market in Gauteng Province, South Africa
Abstract
1. Introduction
2. Results
2.1. Selection of Informal Market Outlets Used in the Current Study
2.2. Isolation, Identification and Confirmation of Salmonella
2.3. Determination of Salmonella Serovars by PCR and Conventional Serotyping
2.4. Selection of Antimicrobial Agents Used in the Study
2.5. Frequency of Chickens Contaminated with Salmonella
2.6. Detection of Resistance to Antimicrobial Agents According to the Townships, Types of Samples, and the Serovars of Salmonella
2.6.1. Frequency of Detection of Resistant Salmonella in Chickens
2.6.2. Frequency of Detection of Resistant Salmonella by Type of Sample Processed
2.6.3. Frequency of Detection of Resistant Strains among Serotypes of Salmonella
2.6.4. Prevalence of Resistance Patterns and Multi-resistant Isolates of Salmonella
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Study Design
5.2. Selection of Informal Market Outlets for the Study
5.3. Isolation, Identification and Confirmation of Salmonella
5.4. Determination of Serovars of Salmonella by PCR and Conventional Slide Agglutination Test
5.5. Criteria for Selecting Isolates of Salmonella
5.6. Selection of Antimicrobial Agents Used in the Study
5.7. Determination of Resistance of Salmonella Isolates to Antimicrobial Agents
5.8. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Barbour, E.K.; Ayyash, D.B.; Alturkistni, W.; Alyahiby, A.; Yaghmoor, S.; Iyer, A.; Yousef, J.; Kumosani, T.; Harakeh, S. Impact of sporadic reporting of poultry Salmonella serovars from selected developing countries. J. Infect. Dev. Ctries. 2015, 9, 1–7. [Google Scholar] [CrossRef]
- Kumagai, Y.; Gilmour, S.; Ota, E.; Momose, Y.; Onishi, T.; Bilano, L.; Kasuga, F.; Sekizaki, T.; Shibuya, K. Estimating the burden of foodborne diseases in Japan. Bull. World Health Organ. 2015, 93, 540–549C. [Google Scholar] [CrossRef]
- Oh, J.Y.; Kang, M.S.; An, B.K.; Song, E.A.; Kwon, J.H.; Kwon, Y.K. Occurrence of purulent arthritis broilers vertically infected with Salmonella enterica serovar Enteritidis in Korea. Poult. Sci. 2010, 89, 2116–2122. [Google Scholar] [CrossRef] [PubMed]
- Rajagopal, R.; Mini, M. Outbreaks of salmonellosis in three different poultry farms of Kerala, India. Asian Pac. J. Trop. Biomed. 2013, 3, 496–500. [Google Scholar] [CrossRef]
- EFSA: European Food Safety Authority. European Union summary report on antimicrobial resistance in zoonotic and indicator bacteria from humans, animals and food in 2014. EFSA J. 2016, 14, 4380. [Google Scholar] [CrossRef]
- EFSA-ECDC: European Food Safety Authority and European Centre for Disease Prevention and Control. The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2017. EFSA J. 2018, 16, 5500. [Google Scholar] [CrossRef]
- Fonteneau, L.; Da Silva, N.J.; Fabre, L.; Ashton, P.; Torpdahl, M.; Muller, L.; Bouchrif, B.; El Boulani, A.; Valkanou, E.; Mattheus, W.; et al. Multinational outbreak of travel-related Salmonella Chester infections in Europe, summers 2014 and 2015. Eurosurveillance 2017, 22, 30463. [Google Scholar] [CrossRef]
- ProMed Mail. Salmonellosis—Malaysia: (Kedah), Wedding Banquet, Fatal International Society for Infectious Diseases. 2013. Available online: http://www.promedmail.org/direct.php?id=20131008.1989195 (accessed on 25 April 2015).
- Durso, L.M.; Cook, K.L. Impacts of antibiotic. Use in agriculture: What are the benefits and risks? Curr. Opin. Microbiol. 2014, 19, 37–44. [Google Scholar] [CrossRef] [PubMed]
- Lane, C.R.; LeBaigue, S.; Esanm, O.B.; Awofisyo, A.A.; Adams, N.L.; Fisher, I.S.; Grant, K.A.; Peters, T.M.; Larkin, L.; Davies, R.H.; et al. Salmonella serovar Enteritidis, England and Wales, 1945–2011. Emerg. Infect. Dis. 2014, 20, 1097–1104. [Google Scholar] [CrossRef]
- Manishimwe, R.; Nishimwe, K.; Ojok, L. Assessment of antibiotic use in farm animals in Rwanda. Trop. Anim. Hlth. Prod. 2017, 49, 1101–1106. [Google Scholar] [CrossRef]
- Sirdar, M.M.; Picard, J.; Bisschop, S.; Gummow, B. A questionnaire survey of poultry layer farmers in Khartoum state, Sudan, to study their antimicrobial awareness and usage patterns. Onderstepoort J. Vet. Res. 2012, 79, a361. [Google Scholar] [CrossRef]
- Van, T.T.H.; Yidana, Z.; Smooker, P.M.; Coloe, P.J. Antibiotic use in food animals worldwide, with a focus on Africa: Pluses and minuses. J. Glob. Antimicrob. Resist. 2020, 20, 170–177. [Google Scholar] [CrossRef]
- Roth, N.; Käsbohrer, A.; Mayrhofer, S.; Zitz, U.; Hofacre, C.; Domig, K.J. The application of antibiotics in broiler production and the resulting antibiotic resistance in Escherichia coli: A global overview. Poult. Sci. 2019, 98, 1791–1804. [Google Scholar] [CrossRef] [PubMed]
- Njoga, E.O.; Onunkwo, J.I.; Okoli, C.E.; Ugwuoke, W.I.; Nwanta, J.A.; Chah, K.F. Assessment of antimicrobial drug administration and antimicrobial residues in food animals in Enugu state, Nigeria. Trop. Anim. Health Prod. 2018, 50, 897–902. [Google Scholar] [CrossRef]
- Nonga, H.E.; Simon, C.; Karimuribo, E.D.; Mdegela, R.H. Assessment of antimicrobial usage and residues in commercial chicken eggs from smallholder poultry keepers in Morogoro municipality, Tanzania. Zoonoses Publ. Health 2010, 57, 339–344. [Google Scholar] [CrossRef]
- Mendelson, M.; Brink, A.; Gouws, J.; Mbelle, N.; Naidoo, V.; Pople, T.; Schellack, N.; van Vuuren, M.; Rees, H. South African One Health Stewardship Sub-Committee of the Ministerial Advisory Committee on Antimicrobial Resistance. The One Health stewardship of colistin as an antibiotic of last resort for human health in South Africa. Lancet Infect. Dis. 2018, 18, e288–e294. [Google Scholar] [CrossRef]
- Theobald, S.; Etter, E.M.C.; Gerber, D.; Abolnik, C. Antimicrobial Resistance Trends in Escherichia coli in South African poultry: 2009–2015. Foodborne Pathog. Dis. 2019, 16, 652–660. [Google Scholar] [CrossRef] [PubMed]
- Eagar, H.; Swan, G.; van Vuuren, M.A. A survey of antimicrobial usage in animals in South Africa with specific reference to food producing animals. J. S. Afr. Vet. Assoc. 2012, 83, 16. [Google Scholar] [CrossRef]
- Darwish, W.S.; Eldaly, E.A.; El-Abbasy, M.T.; Ikenaka, Y.; Nakayama, S.; Ishizuka, M. Antibiotic residues in food: The African scenario. Jap. J. Vet. Res. 2013, 61, S13–S22. [Google Scholar]
- Rana, M.S.; Lee, S.Y.; Kang, H.J.; Hur, S.J. Reducing veterinary drug residues in animal products: A review. Food Sci. Anim. Resour. 2019, 39, 687–703. [Google Scholar] [CrossRef]
- Adigun, F. Sanitary Practices and the Potential Staphylococcal and Coliform Health Risks Posed to Consumers of Dressed Chickens Sold in Informal Markets in Gauteng Province, South Africa. Master’s Thesis, Veterinary Epidemiology, University of Pretoria, Onderstepoort, South Africa, 2017. [Google Scholar]
- Oguttu, J.W. Participatory Risk Analysis of Street Vended Chicken Meat Sold in the Informal Market of PRETORIA, South Africa. Ph.D. Thesis, Department of Paraclinical Sciences, University of Pretoria, Onderstepoort, South Africa, 2015. [Google Scholar]
- Oguttu, J.; Roesel, K.; McCrindle, C.; Hendrickx, S.; Makita, K.; Grace, D. Arrive alive in South Africa: Chicken meat the least to worry about. In Food Safety and Informal Markets: Animal Products in Sub-Saharan Africa; Routledge Publisher: Oxfordshire, UK, 2015; pp. 202–206. [Google Scholar]
- Adigun, F.O.; Fasina, F.; Kidanemariam, A.; Gcebe, N.; Adesiyun, A.A. Prevalence and risk factors for staphylococcal and coliform carcass contamination of chicken slaughtered in the informal market in Gauteng Province, South Africa. Brit. Food J. 2020. [Google Scholar] [CrossRef]
- Von Holy, A.; Makhoane, F.M. Improving street food vending in South Africa: Achievement and lessons learned. Int. J. Food Microbiol. 2006, 111, 89–92. [Google Scholar] [CrossRef]
- Oguttu, J.W.; McCrindle, C.M.; Makita, K.; Grace, D. Investigation of the food value chain of ready-to-eat chicken and the associated risk for staphylococcal food poisoning in Tshwane Metropole, South Africa. Food Control 2014, 45, 87–94. [Google Scholar] [CrossRef]
- South African Poultry Association (SAPA). Industry Profile. 2019. Available online: www.sapoultry.co.za/pdfdocs/sapa-broiler-industry-summary.pdf (accessed on 15 December 2020).
- Department of Agriculture, Forestry and Fisheries for the Republic of South Africa (DAFF). Antimicrobial Resistance National Strategy Framework 2018–2024; Ministry of Health and DAFF: Johannesburg, South Africa, 2018; pp. 1–22. [Google Scholar]
- Office International des Epizooties (OIE)—World Organisation of Animal Health. The OIE Strategy on Antimicrobial Resistance and the Prudent Use of Antimicrobials; WHO: Geneva, Switzerland, 2016. [Google Scholar]
- Adigun, O.; Gcebe, N.; Jambwa, K.; Fasina, F.; Adesiyun, A.A. Molecular and phenotypic characterization of S. aureus strains isolated from carcass swabs and carcass drips of chickens slaughtered in the informal market in Gauteng Province, South Africa. J. Food Safety 2020, 40, e12806. [Google Scholar] [CrossRef]
- Mokgophi, T.M.; Gcebe, N.; Fasina, F.; Jambwa, K.; Adesiyun, A.A. Prevalence, serotypes and risk factors for Salmonella spp. contamination of chicken carcasses sold in outlets of the informal market in Gauteng Province, South Africa. J. Food Prot. 2020. [Google Scholar] [CrossRef]
- Gouws, P.A.; Brozel, V.S. Antimicrobial resistance of Salmonella isolates associated with retail chicken and a poultry abattoir. S. Afr. J. Sci. 2000, 96, 254–256. [Google Scholar]
- Castro-Vargas, R.E.; Herrera-Sánchez, M.P.; Rodríguez-Hernández, R.; Rondón-Barragán, L.S. Antibiotic resistance in Salmonella isolated from poultry: A global overview. Vet. World 2020, 13, 2070–2084. [Google Scholar] [CrossRef]
- Carnero, A.M.; Kitayama, K.; Diaz, D.A.; Garvich, M.; Angulo, N.; Cama, V.A.; Gilman, R.H.; Bayer, A.M. Risk for interspecies transmission of zoonotic pathogens during poultry processing and pork production in Peru: A qualitative study. Zoonoses Public Health 2018, 65, 528–539. [Google Scholar] [CrossRef]
- Klous, G.; Huss, A.; Heederik, D.J.J.; Coutinho, R.A. Human–livestock contacts and their relationship to transmission of zoonotic pathogens, a systematic review of literature. One Health 2016, 2, 65–276. [Google Scholar] [CrossRef]
- Nógrády, N.; Kardos, G.; Bistyák, A.; Turcsányi, I.; Mészáros, J.; Galántai, Z.; Juhász, A.; Samu, P.; Kaszanyitzky, J.E.; Pászti, J.; et al. Prevalence and characterization of Salmonella infantis isolates originating from different points of the broiler chicken-human food chain in Hungary. Int. J. Food Microbiol. 2008, 127, 162–167. [Google Scholar] [CrossRef] [PubMed]
- Padungtod, P.; Kaneene, J.B. Salmonella in food animals and humans in northern Thailand. Int. J. Food Microbiol. 2006, 108, 346–354. [Google Scholar] [CrossRef] [PubMed]
- Abatcha, M.G. Salmonella and Listeria monocytogenes: A review of prevalence and antimicrobial resistance in chickens and their processing environments. Adv. Anim. Vet. Sci. 2017, 5, 395–403. [Google Scholar] [CrossRef]
- Adesiyun, A.A.; Webb, L.; Musai, L.; Louison, B.; Joseph, G.; Stewart, A.; Samlal, S.; Rodrigo, S. Resistance to antimicrobial agents among Salmonella isolates recovered from layer farms and eggs in the Caribbean Region. J. Food Prot. 2014, 77, 2153–2160. [Google Scholar] [CrossRef]
- Khan, A.S.; Georges, K.; Rahaman, S.; Abdela, W.; Adesiyun, A.A. Antimicrobial resistance of Salmonella isolates recovered from chickens sold at retail outlets in Trinidad. J. Food Prot. 2018, 81, 1880–1889. [Google Scholar] [CrossRef] [PubMed]
- Zishiri, O.T.; Mkhize, N.; Mukaratirwa, S. Prevalence of virulence and antimicrobial resistance genes in Salmonella spp. isolated from commercial chickens and human clinical isolates from South Africa and Brazil. Onderstepoort J. Vet. Res. 2016, 83, a1067. [Google Scholar] [CrossRef]
- Ferri, M.; Ranucci, E.; Romagnoli, P.; Giaccone, V. Antimicrobial resistance: A global emerging threat to public health systems. Crit. Rev. Food Sci. Nutr. 2017, 57, 2857–2876. [Google Scholar] [CrossRef] [PubMed]
- Mukerji, S.; O’Dea, M.; Barton, M.; Kirkwood, R.; Lee, T.; Abraham, S. Development and transmission of antimicrobial resistance among gram-negative bacteria in animals and their public health impact. Essays Biochem. 2017, 61, 23–35. [Google Scholar] [CrossRef] [PubMed]
- Khan, A.S.; Georges, K.; Rahaman, S.; Abdela, W.; Adesiyun, A.A. Prevalence and serotypes of Salmonella spp. on chickens sold at retail outlets in Trinidad. PLoS ONE 2018, 13, e0202108. [Google Scholar] [CrossRef] [PubMed]
- Kumar, N.; Krishna, M.; Georges, K.; Dziva, F.; Adesiyun, A.A. Prevalence, serovars and antimicrobial resistance of Salmonella spp. in cecal samples of chickens slaughtered in pluck shops in Trinidad. J. Food Prot. 2019, 82, 1560–1567. [Google Scholar] [CrossRef]
- Rodrigo, S.; Adesiyun, A.; Asgarali, Z.; Swanston, W. Occurrence of selected foodborne pathogens on poultry and poultry giblets from small retail processing operations in Trinidad. J. Food Prot. 2006, 69, 1096–1105. [Google Scholar] [CrossRef] [PubMed]
- Yang, B.; Cui, Y.; Shi, C.; Wang, J.; Xia, X.; Xi, M.; Wang, X.; Meng, J.; Alali, W.Q.; Walls, I.; et al. Counts, serotypes, and antimicrobial resistance of Salmonella isolates on retail raw poultry in the People’s Republic of China. J. Food Prot. 2014, 77, 894–902. [Google Scholar] [CrossRef] [PubMed]
- Bhuvaneswari, M.; Shanmughapriya, S.; Natarajaseenivasan, K. Prevalence of Multidrug-Resistant (MDR) Salmonella enteritidis in Poultry and Backyard Chicken from Tiruchirappalli, India. Microbiol. J. 2015, 5, 28–35. [Google Scholar] [CrossRef]
- Akinola, S.A.; Mwanza, M.; Ateba, C.N. Occurrence, genetic diversities and antibiotic resistance profiles of Salmonella serovars isolated from chickens. Infect. Drug Resist. 2019, 12, 3327–3342. [Google Scholar] [CrossRef] [PubMed]
- Ekwanzala, M.D.; Dewar, J.B.; Kamika, H.; Momba, M.N.B. Systematic review in South Africa reveals antibiotic resistance genes shared between clinical and environmental settings. Infect. Drug Resist. 2018, 11, 1907–1920. [Google Scholar] [CrossRef]
- Igbinosa, I.H. Prevalence and detection of antibiotic-resistant determinant in Salmonella isolated from food-producing animals. Trop. Anim. Health Prod. 2015, 47, 37–43. [Google Scholar] [CrossRef] [PubMed]
- Iwu, C.J.; Iweriebor, B.C.; Obi, L.C.; Basson, A.K.; Okoh, A.I. Multidrug-resistant Salmonella isolates from swine in the Eastern Cape province, South Africa. J. Food Prot. 2016, 79, 1234–1239. [Google Scholar] [CrossRef]
- Madoroba, E.; Kapeta, D.; Gelaw, A.K. Salmonella contamination, serovars and antimicrobial resistance profiles of cattle slaughtered in South Africa. Onderstepoort Vet. Res. 2016, 83, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Mthembu, T.P.; Zishiri, O.T.; El Zowalaty, M.E. Molecular detection of multidrug resistant Salmonella isolated from livestock production systems in South Africa. Infect. Drug Resist. 2019, 12, 3537–3548. [Google Scholar] [CrossRef]
- Ott, R. Antibiotic Resistance in Escherichia coli Causing Airsacculitis in Poultry in South Africa. Ph.D. Thesis, University of Bern, Bern, Switzerland, 2012. [Google Scholar]
- Antunes, P.; Réu, C.; Sousa, J.C.; Peixe, L.; Pestana, N. Incidence of Salmonella from poultry products and their susceptibility to antimicrobial agents. Int. J. Food Microbiol. 2003, 82, 97–103. [Google Scholar] [CrossRef]
- Yang, B.; Xi, M.; Wang, X.; Cui, S.; Yue, T.; Hao, H.; Wang, Y.; Cui, Y.; Alali, W.Q.; Meng, J.; et al. Prevalence of Salmonella on raw poultry at retail markets in China. J. Food Prot. 2011, 74, 1724–1728. [Google Scholar] [CrossRef] [PubMed]
- Zhao, S.; Fedorka-Cray, P.J.; Freidman, S.; Mcdermott, P.F.; Walker, R.D.; Qaiyumi, S.; Foley, S.L.; Hubert, S.K.; Ayers, S.; English, L.; et al. Characterization of Salmonella Typhimurium of animal origin obtained from the national antimicrobial resistance monitoring system. Foodborne Pathog. Dis. 2005, 2, 168–181. [Google Scholar] [CrossRef] [PubMed]
- Shrestha, A.; Regmi, P.; Dutta, R.K.; Khanal, D.R.; Aryal, S.R.; Thakur, R.P.; Karki, D.; Singh, U.M. First report on antimicrobial resistance of Salmonella isolated from poultry in Nepal. Vet. Microbiol. 2010, 144, 522–524. [Google Scholar] [CrossRef] [PubMed]
- Phagoo, L.; Neetoo, H. Antibiotic resistance of Salmonella in poultry farms of Mauritius. J. World’s Poult. Res. 2015, 5, 42–47. [Google Scholar]
- Álvarez-Fernández, E.; Alonso-Calleja, C.; García-Fernández, C.; Capita, R. Prevalence and antimicrobial resistance of Salmonella serotypes isolated from poultry in Spain: Comparison between 1993 and 2006. Int. J. Food Microbiol. 2012, 153, 281–287. [Google Scholar] [CrossRef] [PubMed]
- Soltan Dallal, M.M.; Doyle, M.; Rezadehbashi, M.; Dabiri, H.; Sanaei, M.; Modarresi, S.; Bakhtiari, R.; Sharifiy, K.; Taremi, M.; Zali, M.R.; et al. Prevalence and antimicrobial resistance profiles of Salmonella serotypes, Campylobacter and Yersinia spp. isolated from retail chicken and beef, Tehran, Iran. Food Cont. 2010, 21, 388–392. [Google Scholar] [CrossRef]
- Parveen, S.; Taabodi, M.; Schwarz, J.G.; Oscar, T.P.; Harter-Dennis, J.; White, D.G. Prevalence and antimicrobial resistance of Salmonella recovered from processed poultry. Food Prot. 2007, 70, 2466–2472. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.-S.; Lim, T.-H.; Jang, J.-H.; Lee, D.; Kim, B.-Y.; Kwon, J.-H.; Kwon, J.-H.; Choi, S.-W.; Noh, J.-Y.; Hong, Y.-H.; et al. Prevalence and antimicrobial resistance of Salmonella species isolated from chicken meats produced by different integrated broiler operations in Korea. Poult. Sci. 2012, 91, 2370–2375. [Google Scholar] [CrossRef] [PubMed]
- Thung, T.Y.; Mahydin, N.A.; Basrin, D.F.; Wan Mohamed Radzi, C.W.J.; Nakaguchi, Y.; Nishibuchi, M.; Radu, S. Prevalence and antibiotic resistance of Salmonella Enteritidis and Salmonella Typhimurium in raw chicken meat at retail markets in Malaysia. Poult. Sci. 2016, 95, 1888–1893. [Google Scholar] [CrossRef]
- Rodriguez-Lazaro, D.; Gonzalez-García, P.; Delibato, E.; De Medici, D.; García-Gimeno, R.M.; Valero, A.; Hernandez, M. Next day Salmonella spp. detection method based on real-time PCR for meat, dairy and vegetable food products. Int. J. Food Microbiol. 2014, 184, 113–120. [Google Scholar] [CrossRef] [PubMed]
- Oliveira, S.D.; Santos, L.R.D.; Schuch, M.T.; Silva, A.B.C.; Salle, T.P.; Canal, C.W. Detection and identification of Salmonellas from poultry-related samples by PCR. Vet. Microbiol. 2002, 87, 25–35. [Google Scholar] [CrossRef]
- Kim, S.; Frye, J.G.; Hu, J.; Fedorka-Cray, P.J.; Gautom, R.; Boyle, D.S. Multiplex PCR-based method for identification of common clinical serotypes of Salmonella enterica subp. enterica. J. Clin. Microbiol. 2006, 44, 3608–3615. [Google Scholar] [CrossRef] [PubMed]
- Grimont, P.A.; Weill, F. Antigenic Formulae of the Salmonella Serovars, 9th ed.; WHO Collaborating Centre for Reference and Research on Salmonella, Institut Pasteur: Paris, France, 2007. [Google Scholar]
- Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing; CLSI: Wayne, PA, USA, 2017. [Google Scholar]
No. (%) of Resistant Salmonella Isolates from Chickens a Sampled from Townships: | ||||||||
---|---|---|---|---|---|---|---|---|
Atteridgeville | Garanguwa | Tembisa/Modise | Alexandra | Germiston | Soweto | Total | ||
Antimicrobial Agent | (n = 4) b | (n = 5) | (n = 1) | (n = 13) | (n = 20) | (n = 55) | p-Value | (n = 98) |
Erythromycin (E) | 4 (100.0) | 3 (60.0) | 1 (100.0) | 10 (76.9) | 20 (100.0) | 55 (100.0) | <0.001 | 93 (94.9) |
Oxytetracycline (OXT) | 2 (50.0) | 0 (0.0) | 0 (0.0) | 5 (38.5) | 11 (55.0) | 46 (83.6) | <0.001 | 64 (65.3) |
Chloramphenicol (C) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 2 (3.6) | 0.902 | 2 (2.0) |
Kanamycin (K) | 1 (25.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (1.8) | 0.044 | 2 (2.0) |
Nalidixic acid (NA) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (1.8) | 0.978 | 1 (1.0) |
Streptomycin (S) | 3 (75.0) | 0 (0.0) | 0 (0.0) | 6 (46.2) | 15 (75.0) | 49 (89.1) | <0.001 | 73 (74.5) |
Spectinomycin (SPE) | 4 (100.0) | 0 (0.0) | 0 (0.0) | 7 (53.8) | 19 (95.0) | 51 (87.9) | <0.001 | 81 (82.7) |
Ciprofloxacin (CIP) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (5.0) | 0 (0.0) | 0.558 | 1 (1.0) |
Ampicillin (AMP) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 2 (10.0) | 3 (5.5) | 0.815 | 5 (5.1) |
Cefotaxime (CET) | 1 (25.0) | 0 (0.0) | 0 (0.0) | 1 (7.7) | 6 (30.0) | 7 (12.7) | 0.351 | 15 (15.3) |
Doxycycline (DO) | 2 (50.0) | 0 (0.0) | 0 (0.0) | 4 (30.8) | 10 (50.0) | 42 (76.4) | 0.001 | 58 (59.2) |
Gentamycin (CN) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 2 (10.0) | 0 (0.0) | 0.158 | 2 (2.0) |
Amoxicillin-clavulanic acid (AMOX) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (7.7) | 1 (5.0) | 2 (3.6) | 0.968 | 4 (4.1) |
Sulfamethoxazole-trimethoprim (SXT) | 2 (50.0) | 0 (0.0) | 0 (0.0) | 4 (30.8) | 1 (5.0) | 2 (3.6) | 0.003 | 9 (9.2) |
Ceftazidime (CAZ) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 2 (10.0) | 1 (1.8) | 0.513 | 3 (3.1) |
Norfloxacin (NOR) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (7.7) | 0 (0.0) | 0 (0.0) | 0.252 | 1 (1.0) |
p-value | <0.001 | <0.001 | 0.382 | <0.001 | <0.001 | <0.001 |
No. (%) of Resistant Salmonella Isolates by Type of Sample Collected: | ||||
---|---|---|---|---|
Carcass Swab | Cloacal Swab | Carcass Drip | p-Value | |
Antimicrobial Agent | (n = 54) a | (n = 56) a | (n = 60) a | |
Erythromycin (E) | 54 (100.0) | 56 (100.0) | 60 (100.0) | NA |
Oxytetracycline (OXT) | 37 (68.5) | 44 (78.6) | 46 (76.7) | 0.436 |
Chloramphenicol (C) | 0 (0.0) | 0 (0.0) | 2 (3.3) | 0.156 |
Kanamycin (K) | 0 (0.0) | 4 (7.1) | 1 (1.7) | 0.066 |
Nalidixic acid (NA) | 0 (0.0) | 1 (1.8) | 1 (1.7) | 0.623 |
Streptomycin (S) | 34 (63.0) | 48 (85.7) | 54 (90.0) | <0.001 |
Spectinomycin (SPE) | 46 (85.2) | 51 (91.1) | 54 (90.0) | 0.580 |
Ciprofloxacin (CIP) | 0 (0.0) | 1 (1.8) | 0 (0.0) | 0.359 |
Ampicillin (AMP) | 0 (0.0) | 5 (8.9) | 3 (5.0) | 0.086 |
Cefotaxime (CET) | 2 (3.7) | 13 (23.2) | 9 (15.0) | 0.0130 |
Doxycycline (DO) | 35 (64.8) | 12 (21.4) | 42 (70.0) | <0.001 |
Gentamycin (CN) | 0 (0.0) | 3 (5.4) | 3 (5.0) | 0.234 |
Amoxicillin-clavulanic acid (AMOX) | 2 (3.7) | 4 (7.1) | 1 (1.7) | 0.327 |
Sulfamethoxazole-trimethoprim (SXT) | 0 (0.0) | 5 (8.9) | 6 (10.0) | 0.063 |
Ceftazidime (CAZ) | 1 (1.9) | 4 (7.1) | 1 (1.7) | 0.201 |
Norfloxacin (NOR) | 0 (0.0) | 1 (1.8) | 1 (1.7) | 0.623 |
p-value | <0.001 | <0.001 | <0.001 |
No. (%) of Salmonella Isolates Belonging to Nine Serotypes Resistant to Antimicrobial Agents: | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
Bovismorbificans | Hadar | Dublin | Enteritidis | Mbandaka | Saintpaul | Thompson | Infantis | Agona | Total | ||
Antimicrobial Agents | (n = 41) a | (n = 18) | (n = 13) | (n = 11) | (n = 9) | (n = 6) | (n = 2) | (n = 2) | (n = 1) | p-Value | (n = 103) |
Erythromycin | 41 (100.0) | 18 (100.0) | 13 (100.0) | 11 (100.0) | 9 (100.0) | 6 (100.0) | 2 (100.0) | 2 (100.0) | 1 (100.0) | NA | 103 (100.0) |
Oxytetracycline | 38 (92.7) | 11 (61.1) | 10 (76.9) | 9 (81.8) | 7 (77.8) | 4 (66.7) | 1 (50.0) | 1 (50.0) | 1 (100.0) | 0.188 | 84 (81.6) |
Chloramphenicol | 0 (0.0) | 1 (5.6) | 0 (0.0) | 1 (9.1) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0.686 | 2 (1.9) |
Kanamycin | 1 (2.4) | 1 (5.6) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0.976 | 2 (1.9) |
Nalidixic acid | 0 (0.0) | 1 (5.6) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0.782 | 1 (1.0) |
Streptomycin | 38 (92.7) | 15 (83.3) | 11 (84.6) | 9 (81.8) | 8 (88.9) | 2 (33.3) | 1 (50.0) | 1 (50.0) | 1 (100.0) | 0.029 | 83.5 |
Spectinomycin | 39 (95.1) | 16 (88.9) | 12 (92.3) | 9 (81.8) | 7 (77.8) | 6 (100.0) | 1 (50.0) | 1 (50.0) | 1 (100.0) | 0.213 | 92 (89.3) |
Ciprofloxacin | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | NA | 0 |
Ampicillin | 0 (0.0) | 0 (0.0) | 0 (0.0) | 1 (9.1) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0.391 | 1 (1.0) |
Cefotaxime | 1 (2.4) | 3 (16.7) | 3 (23.1) | 2 (18.2) | 2 (22.2) | 0 (0.0) | 1 (50.0) | 0 (0.0) | 0 (0.0) | 0.205 | 12(11.7) |
Doxycycline | 34 (82.9) | 13 (7 | 9 (69.2) | 9 (81.8) | 5 (55.6) | 4 (66.7) | 0 (0.0) | 1 (50.0) | 1 (100.0) | 0.227 | 76 (73.8) |
Gentamycin | 2 (4.9) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0.929 | 2 (1.9) |
AmoxycillinClavulanic acid | 3 (7.3) | 0 (0.0) | 0 (0.0) | 2 (18.2) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0.497 | 5 (4.9) |
Sulfamethoxazole-trimethoprim | 2 (4.9) | 1 (5.6) | 0 (0.0) | 1 (9.1) | 1 (11.1) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0.965 | 5 (4.9) |
Ceftazidime | 1 (2.4) | 0 (0.0) | 0 (0.0) | 1 (9.1) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0.856 | 2 (1.9) |
Norfloxacin | 1 (2.4) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0 (0.0) | 0.992 | 1 (1.0) |
p-value | <0.001 | <0.001 | <0.001 | <0.001 | <0.001 | <0.001 | 0.220 | 0.220 | 0.382 |
No. (%) of Isolates of Salmonella with Resistance Patterns from: | ||||
---|---|---|---|---|
No. of Antimicrobial | Carcass Swabs | Cloacal Swabs | Carcass Drips | |
Resistance Pattern a | Agents in Pattern | (n = 54) | (n = 56) | (n = 60) |
E-OXT-S-SPE-DO | 5 | 23 (42.6) | 23 (41.1) | 26 (43.3) |
E-SPE | 2 | 6 (11.1) | 0 (0.0) | 1 (1.7) |
E-OXT-SPE-DO | 4 | 6 (11.1) | 0 (0.0) | 0 (0.0) |
E | 1 | 6 (11.1) | 2 (3.6) | 6 (10.0) |
E-OXT-S-SPE-D0-AMOX | 6 | 2 (3.7) | 0 (0.0) | 0 (0.0) |
E-S-SPE-DO | 4 | 2 (3.7) | 1 (1.8) | 0 (0.0) |
E-OXT-S-SPE | 4 | 2 (3.7) | 0 (0.0) | 0 (0.0) |
E-OXT-S-SPE-CET-DO | 6 | 0 (0.0) | 5 (8.9) | 3 (5.0) |
E-OXT-S-DO | 4 | 0 (0.0) | 3 (5.4) | 1 (1.7) |
E-SPE-CET | 3 | 0 (0.0) | 2 (3.6) | 0 (0.0) |
E-S-SPE-CET | 4 | 1 (1.9) | 2 (3.6) | 0 (0.0) |
E-S-SPE | 3 | 2 (3.7) | 2 (3.6) | 3 (5.0) |
E-OXT-S-SPE-DO-CN | 6 | 0 (0.0) | 2 (3.6) | 0 (0.0) |
E-OXT-K-S-SPE-DO | 6 | 0 (0.0) | 2 (3.6) | 0 (0.0) |
E-OXT-S-SPE | 4 | 0 (0.0) | 0 (0.0) | 3 (5.0) |
E-OXT-S-SPE-DO-SXT-NOR | 7 | 0 (0.0) | 0 (0.0) | 2 (3.3) |
E-0XT-S-SPE-DO-SXT | 6 | 0 (0.0) | 1 (1.8) | 2 (3.3) |
E-SPE-DO | 3 | 1 (1.9) | 0 (0.0) | 1 (1.7) |
E-OXT-S | 3 | 1 (1.9) | 0 (0.0) | 0 (0.0) |
E-OXT-DO | 3 | 1 (1.9) | 0 (0.0) | 1 (1.7) |
E-OXT-S-SPE-CET-DO-CEFT | 7 | 1 (1.9) | 0 (0.0) | 0 (0.0) |
E-OXT-S-SPE-CET-D0-SXT | 7 | 0 (0.0) | 1 (1.8) | 0 (0.0) |
E-OXT-K-S-SPE-DO-SXT | 7 | 0 (0.0) | 1 (1.8) | 0 (0.0) |
E-OXT-K-S-SPE-AMP-DO-SXT | 8 | 0 (0.0) | 1 (1.8) | 0 (0.0) |
E-SPE-CET-AMOX-CEFT | 5 | 0 (0.0) | 2 (3.6) | 0 (0.0) |
E-SPE-AMP-CET-CN-CEFT | 6 | 0 (0.0) | 1 (1.8) | 0 (0.0) |
E-OXT-S-SPE-AMP-DO-AMOX-CEFT | 8 | 0 (0.0) | 1 (1.8) | 0 (0.0) |
E-OXT-S-SPE-AMP-CET-DO-AMOX-CEFT | 9 | 0 (0.0) | 1 (1.8) | 0 (0.0) |
E-OXT-S-SPE-DO-SXT | 6 | 0 (0.0) | 1 (1.8) | 0 (0.0) |
E-OXT-S-SPE-AMP-DO-AMOX | 7 | 0 (0.0) | 1 (1.8) | 0 (0.0) |
E-OXT-K-S-SPE-DO | 6 | 0 (0.0) | 1 (1.8) | 0 (0.0) |
E-OXT-S-SPE-DO-AMOX-SXT | 7 | 0 (0.0) | 0 (0.0) | 1 (1.7) |
E-S | 2 | 0 (0.0) | 0 (0.0) | 1 (1.7) |
E-S-SPE-AMP-CET-CN-CEFT | 7 | 0 (0.0) | 0 (0.0) | 1 (1.7) |
E-S-SPE-AMP-CET-CN | 6 | 0 (0.0) | 0 (0.0) | 1 (1.7) |
E-S-SPE-CET-DO | 5 | 0 (0.0) | 0 (0.0) | 1 (1.7) |
E-OXT-S-SPE-SXT | 5 | 0 (0.0) | 0 (0.0) | 1 (1.7) |
E-OXT-C--S-SPE-DO | 6 | 0 (0.0) | 0 (0.0) | 1 (1.7) |
E-OXT-S-SPE-DO-CN | 6 | 0 (0.0) | 0 (0.0) | 1 (1.7) |
E-OXT-C-K-S-SPE-CET-DO-SXT | 10 | 0 (0.0) | 0 (0.0) | 1 (1.7) |
Reaction 1 (STM) (Five-Plex) | Product Size (bp) | |
---|---|---|
STM716F 5′ ACCGCTGCTTAATCCTGATGG 3′ | STM0716R 5′ TGGCCCTGAGCCAGCTTTT 3′ | 187 |
STM1350R 5′ TCAAAATTACCGGGCGCA 3′ | STM1350R 5′ TTTTAAGACTACATACGCGCATGAA 3′ | 171 |
STM0839F 5′ TCCAGTATGAAACAGGCAACGTGT 3′ | STM0839R 5′ GCGACGCATTGTTCGATTGAT 3′ | 137 |
STM4525F 5′ TGGCGGCAGAAGCGATG 3′ | STM4525R 5′ CTTCATTCAGCAACTGACGCTGAG 3′ | 114 |
STM4538F 5′ TGGTCACCGCGCGTGAT 3′ | STM4538R 5′ CGAACGCCAGGTTCATTTGT 3′ | 93 |
Reaction 2 (STY) (five-plex) | ||
STY0311F 5′ TGGTATGGTTAAGCGGAGAATGG 3′ | STY0312R 5′ GAGAGTCATAGCCCACACCAAAG 3′ | 301 |
STY0346F 5′ GGCTGGAGCAGCCTTACAAAA 3′ | STY0347R 5′ AAGAGTTGCCTGGCTGGTAAAA 3′ | 262 |
STY2299F 5′ AATCCCCCCCCCTCAAAAA 3′ | STY2300R 5′ GGTACACCGTTTACTGTTTGCTGGA 3′ | 220 |
STM3845F 5′ ATATCTCATCGTCTCCTTTTCGTGT 3′ | STM3845R 5′ GAAGGTCCGGATAGGCATTCT 3′ | 181 |
STY2349F 5′ AATTACGGAGCAGCAGATCGAGG 3′ | STY2349R 5′ TGCGGCCAGCTGTTCAAA 3′ | 124 |
Reaction 3 (PT4) (monoplex) | ||
PT4F 5′ GGCGATATATAAGTACGACCATCATGG 3′ | PT4R 5′ GCACGCGGCACAGTTAAAA 3′ | 225 |
Reaction 4 (STM7) (monoplex) | ||
STM2150F 5′ CATAACCCGCCTCGACCTCAT 3′ | STM2150R 5′ AGATGTCGTGAGAAGCGGTGG 3′ | 101 |
Class of Antimicrobial Agents | Type of Antimicrobial Agents Used | Concentration (µg) |
---|---|---|
Aminoglycosides | Spectinomycin (SPE) | 100 |
Streptomycin (S) | 10 | |
Kanamycin (K) | 30 | |
Gentamycin (CN) | 10 | |
Beta lactams | Ampicillin (AMP) | 10 |
Amoxicillin-clavulanic acid (AMOX) | 30 | |
Cephalosporin | Ceftazidime (CAZ) | 30 |
Cefotaxime (CET) | 30 | |
Fluoroquinolones | Nalidixic acid (NA) | 30 |
Norfloxacin (NOR) | 10 | |
Ciprofloxacin (CIP) | 5 | |
Macrolides | Erythromycin (E) | 15 |
Phenicols | Chloramphenicol (C) | 30 |
Sulphonamides | Sulfamethoxazole-trimethoprim (SXT) | 23.75/1.25 |
Tetracyclines | Oxytetracycline (OXT) | 30 |
Doxycycline (DO) | 30 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mokgophi, T.M.; Gcebe, N.; Fasina, F.; Adesiyun, A.A. Antimicrobial Resistance Profiles of Salmonella Isolates on Chickens Processed and Retailed at Outlets of the Informal Market in Gauteng Province, South Africa. Pathogens 2021, 10, 273. https://doi.org/10.3390/pathogens10030273
Mokgophi TM, Gcebe N, Fasina F, Adesiyun AA. Antimicrobial Resistance Profiles of Salmonella Isolates on Chickens Processed and Retailed at Outlets of the Informal Market in Gauteng Province, South Africa. Pathogens. 2021; 10(3):273. https://doi.org/10.3390/pathogens10030273
Chicago/Turabian StyleMokgophi, Thelma M., Nomakorinte Gcebe, Folorunso Fasina, and Abiodun A. Adesiyun. 2021. "Antimicrobial Resistance Profiles of Salmonella Isolates on Chickens Processed and Retailed at Outlets of the Informal Market in Gauteng Province, South Africa" Pathogens 10, no. 3: 273. https://doi.org/10.3390/pathogens10030273
APA StyleMokgophi, T. M., Gcebe, N., Fasina, F., & Adesiyun, A. A. (2021). Antimicrobial Resistance Profiles of Salmonella Isolates on Chickens Processed and Retailed at Outlets of the Informal Market in Gauteng Province, South Africa. Pathogens, 10(3), 273. https://doi.org/10.3390/pathogens10030273