Occurrence and Genetic Correlations of Yersinia spp. Isolated from Commensal Rodents in Northeastern Poland
Abstract
:1. Introduction
2. Material and Methods
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Nguyen, S.V.; Muthappa, D.M.; Hurley, D.; Donoghue, O.; McCabe, E.; Anes, K.; Schaffer, J.; Murphy, B.P.; Buckley, J.F.; Fanning, S. Yersinia hibernica sp. nov., isolated from pig-production environments. Int. J. Syst. Evol. Microbiol. 2019, 7, 2023–2027. [Google Scholar] [CrossRef]
- EFSA. Monitoring and identification of human enteropahogenic Yersinia spp. EFSA J. 2007, 595, 1–30. [Google Scholar]
- Sulakvelidze, A. Yersiniae other than Y. enterocolitica, Y. pseudotuberculosis, and Y. pestis: The ignored species. Microbes Infect. 2000, 2, 497–513. [Google Scholar] [CrossRef]
- The European Union One Health 2019 Zoonoses Report. EFSA J. 2021, 19, 6404. [CrossRef]
- Bottone, E.J. Yersinia enterocolitica: The charisma continues. Clin. Microbiol. Rev. 1997, 10, 257–276. [Google Scholar] [CrossRef]
- Tsubocura, M.; Aleksic, S. A simplified antigenic scheme for serotyping of Yersinia pseudotuberculosis: Phenotypic characterization of reference strains and preparation of O and H factor sera. Contrib. Microbiol. Immunol. 1995, 13, 99–105. [Google Scholar]
- Bari, L.; Hossain, M.A.; Isshiki, K.; Ukuku, D. Behavior of Yersinia enterocolitica in Foods. J. Pathog. 2011, 2011, 420732. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wauters, G.; Kandolo, K.; Janssens, M. Revised biogrouping scheme of Yersinia enterocolitica. Contrib. Microbiol. Immunol. 1987, 9, 14–21. [Google Scholar] [PubMed]
- Thoerner, P.; Bin Kingombe, C.I.; Bogli-Stuber, K.; Bissing-Choisat, B.; Wassenaar, T.M.; Frey, J.; Jemmi, T. PCR detection of virulence genes in Yersinia enterocolitica and Yersinia pseudotuberculosis and investigation of virulence gene distribution. Appl. Environ. Microbiol. 2003, 69, 1810–1816. [Google Scholar] [CrossRef] [Green Version]
- Campioni, F.; Falcão, J.P. Genotypic diversity and virulence markers of Yersinia enterocolitica biotype 1A strains isolated from clinical and non-clinical origins. APMIS 2014, 122, 215–222. [Google Scholar] [CrossRef]
- Wren, B. The Yersiniae—A model genus to study the rapid evolution of bacterial pathogen. Nat. Rev. Microbiol. 2003, 1, 55–64. [Google Scholar] [CrossRef]
- Amphlett, A. Far East Scarlet-Like Fever: A Review of the Epidemiology, Symptomatology, and Role of Superantigenic Toxin: Yersinia pseudotuberculosis-Derived Mitogen A. Open Forum Infect. Dis. 2015, 3, ofv202. [Google Scholar] [CrossRef] [Green Version]
- Savin, C.; Criscuolo, A.; Guglielmini, J.; Le Guern, A.-S.; Carniel, E.; Pizarro-Cerdá, J.; Brisse, S. Genus-wide Yersinia core-genome multilocus sequence typing for species identification and strain characterization. Microb. Genom. 2019, 5, e000301. [Google Scholar] [CrossRef]
- Gurtler, M.; Alter, T.; Kasimir, S.; Fehlhaber, K. Prevalence of Yersinia enterocolitica in fattening pigs. J. Food. Prot. 2005, 68, 850–854. [Google Scholar] [CrossRef]
- Backhans, A.; Jacobson, M.; Hansson, I.; Lebbad, M.; Thisted Lambertz, S.; Gammelgård, E.; Saager, M.; Akande, O.; Fellström, C. Occurrence of pathogens in wild rodents caught on Swedish pig and chicken farms. Epidemiol. Infect. 2013, 141, 1885–1891. [Google Scholar] [CrossRef] [PubMed]
- Hayashidani, H.; Ishiyama, Y.; Okatani, T.A.; Yoshida, S.; Ishikawa, M.; Kato, Y.; Ohtomo, Y.; Saito, M.; Horisaka, T.; Kaneko, K.; et al. Molecular genetic typing of Yersinia enterocolitica serovar O:8 isolated in Japan. Adv. Exp. Med. Biol. 2003, 529, 363–365. [Google Scholar] [PubMed]
- Kruse, H.; Kirkemo, A.M.; Handeland, K. Wildlife as a source of zoonotic infections. Emerg. Infect. Dis. 2004, 10, 2067–2072. [Google Scholar] [CrossRef]
- Han, B.A.; Schmidt, J.P.; Bowden, S.E.; Drake, J.M. Rodent reservoirs of future zoonotic diseases. Proc. Natl. Acad. Sci. USA 2015, 112, 7039–7044. [Google Scholar] [CrossRef] [Green Version]
- Pockock, M.J.O.; Searle, J.B.; Betts, W.B.; White, P.C.L. Patterns of infection by Salmonella and Yersinia spp. in commensal house mouse (Mus musculus domesticus) populations. J. Appl. Microbiol. 2001, 90, 755–760. [Google Scholar] [CrossRef] [PubMed]
- Syczyło, K.; Platt-Samoraj, A.; Bancerz-Kisiel, A.; Szczerba-Turek, A.; Pajdak, J.; Łabuć, S.; Procajło, Z.; Socha, P.; Chuzhebayeva, G.; Szweda, W. The prevalence of Yersinia enterocolitica in game animals in Poland. PLoS ONE 2018, 13, e0195136. [Google Scholar] [CrossRef] [PubMed]
- Platt-Samoraj, A.; Syczyło, K.; Bancerz-Kisiel, A.; Szczerba-Turek, A.; Giżejewska, A.; Szweda, W. Yersinia enterocolitica strains isolated from beavers (Castor fiber). Pol. J. Vet. Sci. 2015, 18, 449–451. [Google Scholar] [CrossRef]
- Platt-Samoraj, A.; Żmudzki, J.; Pajdak-Czaus, J.; Szczerba-Turek, A.; Bancerz-Kisiel, A.; Procajło, Z.; Łabuć, S.; Szweda, W. The Prevalence of Yersinia enterocolitica and Yersinia pseudotuberculosis in small wild rodents in Poland. Vector-Borne Zoonotic Dis. 2020, 20, 586–592. [Google Scholar] [CrossRef] [PubMed]
- PN-EN ISO 10273: Microbiology of Food and Animal Feed. Horizontal Method for the Detection of Microbiology of Food and Animal Feed. Horizontal Method for the Detection of Presumably Pathogenic Yersinia enterocolitica. 2005. Polish Committee for Standardization: Polish Norm—European Norm (with appendix PN-EN ISO 10273:2005/Ap1, 2005; PN-EN ISO 10273:2005/Ap2, 2006). Available online: https://www.iso.org/standard/34564.html (accessed on 27 August 2021).
- Niskanen, T.; Laukkanen, R.; Murros, A.; Björkroth, J.; Skurnik, M.; Korkeala, H.; Fredriksson-Ahomaa, M. Characterisation of non-pathogenic Yersinia pseudotuberculosis-like isolated from food and environmental samples. Int. J. Food Microbiol. 2009, 129, 150–156. [Google Scholar] [CrossRef] [PubMed]
- Harnett, N.; Lin, Y.P.; Krishan, C. Detection of pathogenic Yersinia enterocolitica using the multiplex polymerase chain reaction. Epidemiol. Infect. 1996, 117, 59–69. [Google Scholar] [CrossRef] [Green Version]
- Platt-Samoraj, A.; Ugorski, M.; Szweda, W.; Szczerba-Turek, A.; Wojciech, Ł.; Procajło, Z. Analysis of the Presence of ail, ystA and ystB genes in Yersinia enterocolitica strains isolated from aborting sows and aborted fetuses. J. Vet. Med. B 2006, 53, 341–346. [Google Scholar] [CrossRef] [PubMed]
- Larkin, M.A.; Blackshields, G.; Brown, N.P.; Chenna, R.; McGettigan, P.A.; McWilliam, H.; Valentin, F.; Wallace, I.M.; Wilm, A.; Lopez, R.; et al. Clustal W and Clustal X version 2.0. Bioinformatics 2007, 23, 2947–2948. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sneath, P.H.A.; Sokal, R.R. Numerical Taxonomy; Freeman: San Francisco, CA, USA, 1973. [Google Scholar]
- Tan, S.Y.; Dutta, A.; Jakubovics, N.S.; Ang, M.Y.; Siow, C.C.; Mutha, N.V.R.; Heydari, H.; Wee, W.Y.; Wong, G.J.; Choo, S.W. YersiniaBase: A genomic resource and analysis platform for comparative analysis of Yersinia. BMC Bioinform. 2015, 16, 9. [Google Scholar] [CrossRef] [Green Version]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.K. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
- Backhans, A.; Fellström, C. Rodents on pig and chicken farms—A potential threat to human and animal health. Infect. Ecol. Epidemiol. 2012, 2, 1793. [Google Scholar] [CrossRef]
- Oda, S.; Kabeya, H.; Sato, S.; Shimonagane, A.; Inoue, K.; Hayashidani, H.; Takada, N.; Fujita, H.; Kawabata, H.; Maruyama, S. Isolation of pathogenic Yersinia enterocolitica 1B/O:8 from Apodemus mice in Japan. J. Wildl. Dis. 2015, 51, 260–264. [Google Scholar] [CrossRef]
- Backhans, A.; Fellström, C.; Lambertz, S.T. Occurrence of pathogenic Yersinia enterocolitica and Yersinia pseudotuberculosis in small wild rodents. Epidemiol. Infect. 2011, 139, 1230–1238. [Google Scholar] [CrossRef] [PubMed]
- Kapperud, G. Yersinia enterocolitica in small rodents from Norway, Sweden and Finland. Acta Pathol. Microbiol. Immunol. Scand. B 1975, 83B, 335–342. [Google Scholar] [CrossRef] [PubMed]
- Servan, J.; Brault, J.; Alonso, J.M.; Bercovier, H.; Mollaret, H.H. Yersinia enterocolitica among small wild mammals in France. Comp. Immunol. Microbiol. Infect. Dis. 1979, 1, 321–333. [Google Scholar] [CrossRef]
- Bancerz-Kisiel, A.; Pieczywek, M.; Łada, P.; Szweda, W. The most important virulence markers of Yersinia enterocolitica and their role during infection. Genes 2018, 9, 235. [Google Scholar] [CrossRef] [Green Version]
- Platt-Samoraj, A.; Syczyło, K.; Szczerba-Turek, A.; Bancerz-Kisiel, A.; Procajło, Z.; Łabuć, S.; Szweda, W. Presence of ail and ystB genes in Yersinia enterocolitica biotype 1A isolates from game animals in Poland. Vet. J. 2017, 221, 11–13. [Google Scholar] [CrossRef]
- Joutsen, S.; Johansson, P.; Laukkanen-Ninios, R.; Björkroth, J.; Fredriksson-Ahomaa, M. Two copies of the ail gene found in Yersinia enterocolitica and Yersinia kristensenii. Vet. Microbiol. 2020, 247, 108798. [Google Scholar] [CrossRef] [PubMed]
- Joutsen, S.; Laukkanen-Ninios, R.; Henttonen, H.; Niemimaa, H.; Voutilainen, L.; Kallio, L.; Helle, H.; Korkeala, H.; Fredriksson-Ahomaa, M. Yersinia spp. in wild rodents and shrews in Finland. Vector-Borne Zoonotic Dis. 2017, 17, 303–311. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fukushima, H.; Gomyoda, M.; Kaneko, S. Mice and moles inhabiting mountainous areas of Shimane Peninsula as sources of infection with Yersinia pseudotuberculosis. J. Clin. Microbiol. 1990, 28, 2448–2455. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene | Primer Sequences | Product Size (bp—base pairs) | Source |
---|---|---|---|
ail | 5′TGGTTATGCGCAAAGCCATGT3′ 5′TGGAAGTGGGTTGAATTGCA 3′ | 356 | [25] |
ystA | 5′GTCTTCATTTGGAGGATTCGGC3′ 5′AATCACTACTGACTTCGGCTGG3′ | 134 | [25] |
ystB | 5′TGTCAGCATTTATTCTCAACT3′ 5′GCCGATAATGTATCATCAAG3′ | 180 | [26] |
inv | CGGTACGGCTCAAGTTAATCTG CCGTTCTCCAATGTACGTATCC | 183 | [9] |
Isolate No. | Acc. No. | Yersinia | Gene | Biotype | Serotype | Source/Isolate Name |
---|---|---|---|---|---|---|
1. | MZ496229 | Y. enterocolitica | ystB | 1A | O:5 | 9 (Mus musculus) |
2. | MZ496230 | Y. enterocolitica | ystB | 1A | O:5 | 11 (Apodemus agrarius) |
3. | MZ496231 | Y. enterocolitica | ystB | 1A | NT | 12 (Mus musculus) |
4. | MZ496232 | Y. enterocolitica | ystB | 1A | NT | 41 (Mus musculus) |
5. | MZ496233 | Y. enterocolitica | ystB | 1A | NT | 53 (Mus musculus) |
6. | MZ491080 | Y. kristensenii | ail | - | 54 (Mus musculus) | |
7. | MZ496234 | Y. enterocolitica | ystB | 1A | NT | 56 (Mus musculus) |
8. | MZ491082 | Y. pseudotuberculosis | inv | I | - | 70 (Mus musculus) |
9. | MZ496235 | Y. enterocolitica | ystB | 1A | NT | 100 (Apodemus agrarius) |
10. | MZ496236 | Y. enterocolitica | ystB | 1A | NT | 102 (Apodemus agrarius) |
11. | MZ496237 | Y. enterocolitica | ystB | 1A | NT | 107 (Mus musculus) |
12. | MZ496238 | Y. enterocolitica | ystB | 1A | NT | 108 (Mus musculus) |
13. | MZ496239 | Y. enterocolitica | ystB | 1A | NT | 110 (Apodemus agrarius) |
14. | MZ496240 | Y. enterocolitica | ystB | 1A | NT | 114 (Mus musculus) |
15. | MZ496241 | Y. enterocolitica | ystB | 1A | NT | 142 (Mus musculus) |
16. | MZ496242 | Y. enterocolitica | ystB | 1A | NT | 143 (Apodemus agrarius) |
17. | MZ496243 | Y. enterocolitica | ystB | 1A | NT | 144 (Apodemus agrarius) |
18. | MZ496244 | Y. enterocolitica | ystB | 1A | NT | 146 (Mus musculus) |
19. | MZ496245 | Y. enterocolitica | ystB | 1A | NT | 147 (Apodemus agrarius) |
20. | MZ496246 | Y. enterocolitica | ystB | 1A | NT | 148 (Mus musculus) |
21. | MZ496247 | Y. enterocolitica | ystB | 1A | NT | 149 (Apodemus agrarius) |
22. | MZ496248 | Y. enterocolitica | ystB | 1A | NT | 150 (Mus musculus) |
23. | MZ496249 | Y. enterocolitica | ystB | 1A | NT | 151 (Mus musculus) |
24. | MZ496250 | Y. enterocolitica | ystB | 1A | NT | 152 (Apodemus agrarius) |
25. | MZ496251 | Y. enterocolitica | ystB | 1A | NT | 154 (Mus musculus) |
26. | MZ496252 | Y. enterocolitica | ystB | 1A | O:5 | 164 (Apodemus agrarius) |
27. | MZ496253 | Y. enterocolitica | ystB | 1A | NT | 170 (Mus musculus) |
28. | MZ496254 | Y. enterocolitica | ystB | 1A | NT | 178 (Mus musculus) |
29. | MZ496255 | Y. enterocolitica | ystB | 1A | NT | 182 (Mus musculus) |
30. | MZ496256 | Y. enterocolitica | ystB | 1A | O:5 | 183 (Mus musculus) |
31. | MZ496257 | Y. enterocolitica | ystB | 1A | NT | 201 (Apodemus agrarius) |
32. | MZ496258 | Y. enterocolitica | ystB | 1A | NT | 202 (Apodemus agrarius) |
33. | MZ496259 | Y. enterocolitica | ystB | 1A | NT | 203a (Apodemus agrarius) |
34. | MZ496260 MZ491081 | Y. enterocolitica | ystB, ail | 1A | O:3 | 203b (Apodemus agrarius) |
35. | MZ496261 | Y. enterocolitica | ystB | 1A | NT | 204a (Rattus norvegicus) |
36. | MZ496262 | Y. enterocolitica | ystB | 1A | NT | 204b (Rattus norvegicus) |
37. | MZ496263 | Y. enterocolitica | ystB | 1A | NT | 205 (Apodemus agrarius) |
38. | MZ496264 | Y. enterocolitica | ystB | 1A | NT | 206 (Apodemus agrarius) |
39. | MZ496265 | Y. enterocolitica | ystB | 1A | NT | 207 (Apodemus agrarius) |
40. | MZ496266 | Y. enterocolitica | ystB | 1A | O:5 | 209a (Apodemus agrarius) |
41. | MZ496267 | Y. enterocolitica | ystB | 1A | NT | 209b (Apodemus agrarius) |
42. | MZ496268 | Y. enterocolitica | ystB | 1A | NT | 213 (Apodemus agrarius) |
43. | MZ496269 | Y. enterocolitica | ystB | 1A | NT | 223 (Apodemus agrarius) |
44. | MZ496270 | Y. enterocolitica | ystB | 1A | O:8 | 227 (Apodemus agrarius) |
45. | MZ496271 | Y. enterocolitica | ystB | 1A | O:8 | 228 (Apodemus agrarius) |
46. | MZ496272 | Y. enterocolitica | ystB | 1A | NT | 244 (Rattus norvegicus) |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Platt-Samoraj, A.; Kończyk-Kmiecik, K.; Bakuła, T. Occurrence and Genetic Correlations of Yersinia spp. Isolated from Commensal Rodents in Northeastern Poland. Pathogens 2021, 10, 1247. https://doi.org/10.3390/pathogens10101247
Platt-Samoraj A, Kończyk-Kmiecik K, Bakuła T. Occurrence and Genetic Correlations of Yersinia spp. Isolated from Commensal Rodents in Northeastern Poland. Pathogens. 2021; 10(10):1247. https://doi.org/10.3390/pathogens10101247
Chicago/Turabian StylePlatt-Samoraj, Aleksandra, Klaudia Kończyk-Kmiecik, and Tadeusz Bakuła. 2021. "Occurrence and Genetic Correlations of Yersinia spp. Isolated from Commensal Rodents in Northeastern Poland" Pathogens 10, no. 10: 1247. https://doi.org/10.3390/pathogens10101247
APA StylePlatt-Samoraj, A., Kończyk-Kmiecik, K., & Bakuła, T. (2021). Occurrence and Genetic Correlations of Yersinia spp. Isolated from Commensal Rodents in Northeastern Poland. Pathogens, 10(10), 1247. https://doi.org/10.3390/pathogens10101247