Transcriptomic Profiling of Equine and Viral Genes in Peripheral Blood Mononuclear Cells in Horses during Equine Herpesvirus 1 Infection
Abstract
1. Introduction
2. Results
2.1. Clinical Disease and Viremia
2.2. Horse mRNA Sequencing and Differential Gene Expression
2.3. Gene Ontology (GO) Overrepresentation
2.4. In Silico Cell Sorting
2.5. Viral mRNA Sequencing
2.6. Identification of miRNAs
2.7. Differential Expression of miRNAs
3. Discussion
4. Materials and Methods
4.1. Viruses
4.2. Animals
4.3. Experiment Design
4.4. Sample Collection
4.5. RNA Isolation, Library Preparation, and Sequencing
4.6. Genome-Guided mRNA Alignment
4.7. Host and Viral miRNA Identification and Quantification
4.8. Differential Gene Expression
4.9. Gene Enrichment Analysis
4.10. Target Gene Analysis of Differentially Expressed miRNAs
4.11. Viral Gene Identification and Counting
4.12. In Silico Cell Sorting
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
| Symbol | Log2 Fold Change | Padj | PANTHER Family/Subfamily | Function—UniProtKB (Homo sapiens Ortholog) |
|---|---|---|---|---|
| Upregulated genes | ||||
| ENSECAG00000034754 | 6.4 | 3.8 × 10−22 | Interferon-induced transmembrane protein 3 (PTHR13999:SF4) | No UniProtKB function listed. |
| DDX60 | 6.1 | 1.1 × 10−65 | ATP-dependent RNA helicase DDX60-related (PTHR44533:SF3) | Positively regulates DDX58/RIG-I- and IFIH1/MDA5-dependent type I interferon and interferon-inducible gene expression in response to viral infection. |
| MX2 | 5.8 | 1.4 × 10−64 | Interferon-induced GTP-binding protein MX2 (PTHR11566:SF46) | Interferon-induced dynamin-like GTPase with potent antiviral activity against human immunodeficiency virus type 1 (HIV-1). |
| APOBEC3Z1B | 5.8 | 1.8 × 10−7 | DNA DC-DU-editing enzyme APOBEC-3G (PTHR13857:SF20) | No UniProtKB function listed. |
| ENSECAG00000032492 | 5.0 | 1.7 × 10−52 | Subfamily not named (PTHR44533:SF5) | No UniProtKB function listed. |
| CXCL9 | 4.8 | 5.7 × 10−34 | C-X-C motif chemokine 9 (PTHR10179:SF44) | Cytokine that affects the growth, movement, or activation state of cells that participate in immune and inflammatory response. Chemotactic for activated T cells. |
| NRGN | 4.6 | 8.6 × 10−4 | None | Acts as a “third messenger” substrate of protein kinase C-mediated molecular cascades during synaptic development and remodeling. Binds to calmodulin in the absence of calcium. |
| TNFSF15 | 4.5 | 4.9 × 10−4 | Tumor necrosis factor ligand superfamily member 15 (PTHR11471:SF24) | Mediates activation of NF-kappa-B. Inhibits vascular endothelial growth and angiogenesis (in vitro). Promotes activation of caspases and apoptosis. |
| ENSECAG00000004433 | 4.5 | 1.5 × 10−70 | Interferon-induced protein with tetratricopeptide repeats 1 (PTHR10271:SF30) | No UniProtKB function listed. |
| ENSECAG00000015137 | 4.4 | 1.5 × 10−3 | Granzyme B (PTHR24271:SF53) | No UniProtKB function listed. |
| CXCL11 | 4.4 | 1.5 × 10−7 | C-X-C motif chemokine 11 (PTHR10179:SF28) | Chemotactic for interleukin-activated T cells but not unstimulated T cells, neutrophils, or monocytes. |
| C3AR1 | 4.4 | 1.6 × 10−5 | C3A anaphylatoxin chemotactic receptor (PTHR24225:SF28) | Receptor for the chemotactic and inflammatory peptide anaphylatoxin C3a. This receptor stimulates chemotaxis, granule enzyme release, and superoxide anion production. |
| CXCL10 | 4.3 | 3.9 × 10−21 | C-X-C motif chemokine 10 (PTHR10179:SF47) | Pro-inflammatory cytokine that is involved in a wide variety of processes such as chemotaxis, differentiation, and activation of peripheral immune cells, regulation of cell growth, apoptosis, and modulation of angiostatic effects. Thereby plays an important role during viral infections by stimulating the activation and migration of immune cells to the infected sites. |
| ENSECAG00000001555 | 4.3 | 5.4 × 10−4 | Metallothionein-2 (PTHR23299:SF24) | No UniProtKB function listed. |
| ENSECAG00000032756 | 4.3 | 1.4 × 10−7 | DNA DC-DU-editing enzyme APOBEC-3G (PTHR13857:SF20) | No UniProtKB function listed. |
| SAMD9L | 4.2 | 5.3 × 10−53 | Sterile alpha motif domain-containing protein 9-like (PTHR16155:SF18) | May be involved in endosome fusion. Mediates downregulation of growth factor signaling via internalization of growth factor receptors. |
| MX1 | 4.2 | 5.8 × 10−79 | Interferon-induced dynamin-like GTPase with antiviral activity against a wide range of RNA viruses and some DNA viruses. | |
| BCL2L14 | 4.0 | 7.4 × 10−8 | Apoptosis facilitator BCL-2-like protein 14 (PTHR14965:SF1) | Plays a role in apoptosis. |
| GBP1 | 3.9 | 2.2 × 10−56 | Guanylate-binding protein 1 (PTHR10751:SF96) | Hydrolyzes GTP to GMP in two consecutive cleavage reactions. Exhibits antiviral activity against influenza virus. Promotes oxidative killing and delivers antimicrobial peptides to autophagolysosomes, providing broad host protection against different pathogen classes. |
| ACOD1 | 3.9 | 5.5 × 10−39 | Cis-Aconitate Decarboxylase (PTHR16943:SF11) | Involved in the inhibition of the inflammatory response. Acts as a negative regulator of the Toll-like receptor (TLRs-mediated inflammatory innate response by stimulating the tumor necrosis factor alpha-induced protein TNFAIP3 expression via reactive oxygen species (ROS) in LPS-tolerized macrophages. Involved in antimicrobial response of innate immune cells; ACOD1-mediated itaconic acid production contributes to the antimicrobial activity of macrophages. |
| IFIT3 | 3.9 | 8.2 × 10−91 | Interferon-induced protein with tetratricopeptide repeats 3 (PTHR10271:SF3) | IFN-induced antiviral protein which acts as an inhibitor of cellular as well as viral processes, cell migration, proliferation, signaling, and viral replication. |
| C1R | 3.8 | 2.3 × 10−19 | Complement C1R subcomponent (PTHR24255:SF25) | C1r B chain is a serine protease that combines with C1q and C1s to form C1, the first component of the classical pathway of the complement system. |
| ALPK1 | 3.8 | 2.2 × 10−3 | Alpha-protein kinase 1 (PTHR46747:SF1) | Serine/threonine-protein kinase that detects bacterial pathogen-associated molecular pattern metabolites (PAMPs) and initiates an innate immune response, a critical step for pathogen elimination and engagement of adaptive immunity. |
| ENSECAG00000028889 | 3.6 | 3.3 × 10−4 | Metallothionein-2 (PTHR23299:SF24) | No UniProtKB function listed. |
| IFI44 | 3.6 | 1.2 × 10−100 | Interferon-induced protein 44 (PTHR14241:SF3) | This protein aggregates to form microtubular structures. |
| ENSECAG00000033029 | 3.6 | 8.0 × 10−15 | Interferon-induced protein with tetratricopeptide repeats 1B (PTHR10271:SF16) | No UniProtKB function listed. |
| HSD11B1 | 3.5 | 1.1 × 10−11 | Corticosteroid 11-Beta-dehydrogenase isozyme 1 (PTHR44279:SF1) | Reversibly catalyzes the conversion of cortisol to the inactive metabolite cortisone. |
| OAS1 | 3.5 | 5.4 × 10−79 | 2′-5′-oligoadenylate synthase 1 (PTHR11258:SF13) | Interferon-induced dsRNA-activated antiviral enzyme which plays a critical role in cellular innate antiviral response. In addition, it may also play a role in other cellular processes such as apoptosis, cell growth, differentiation, and gene regulation. |
| SERPING1 | 3.5 | 3.3 × 10−13 | Plasma protease C1 inhibitor (PTHR11461:SF159) | Activation of the C1 complex is under control of the C1 inhibitor. |
| ENSECAG00000031838 | 3.5 | 7.1 × 10−4 | Unknown | No UniProtKB function listed. |
| CCL8 | 3.5 | 1.0 × 10−14 | C-C Motif Chemokine 8 (PTHR12015:SF168) | Chemotactic factor that attracts monocytes, lymphocytes, basophils, and eosinophils. |
| OASL | 3.4 | 6.1 × 10−89 | 2′–5′-oligoadenylate synthase-like protein (PTHR11258:SF16) | Does not have 2’-5’-OAS activity but can bind double-stranded RNA. |
| MYO1D | 3.4 | 5.1 × 10−6 | Unconventional myosin-ID (PTHR13140:SF417) | Unconventional myosin that functions as an actin-based motor protein with ATPase activity. |
| IFIH1 | 3.3 | 2.2 × 10−56 | Interferon-induced helicase C domain-containing protein 1 (PTHR14074:SF14) | Innate immune receptor which acts as a cytoplasmic sensor of viral nucleic acids and plays a major role in sensing viral infection and in the activation of a cascade of antiviral responses including the induction of type I interferons and proinflammatory cytokines. |
| ENSECAG00000035315 | 3.2 | 5.9 × 10−5 | Leukocyte immunoglobulin-like receptor subfamily B member 4 (PTHR11738:SF174) | No UniProtKB function listed. |
| OAS3 | 3.2 | 1.2 × 10−69 | 2′-5′-oligoadenylate synthase 3 (PTHR11258:SF4) | Interferon-induced, dsRNA-activated antiviral enzyme which plays a critical role in cellular innate antiviral response. In addition, it may also play a role in other cellular processes such as apoptosis, cell growth, differentiation. and gene regulation. |
| MPZ | 3.1 | 1.6 × 10−3 | Myelin protein P0 (PTHR13869:SF7) | Is an adhesion molecule necessary for normal myelination in the peripheral nervous system. It mediates adhesion between adjacent myelin wraps and ultimately drives myelin compaction |
| IFI6 | 3.1 | 1.8 × 10−70 | Interferon alpha-inducible protein 6 (PTHR16932:SF25) | Plays a role in apoptosis, negatively regulating the intrinsic apoptotic signaling pathway and TNFSF10-induced apoptosis. However, it has also been shown to have a pro-apoptotic activity. Has antiviral activity towards hepatitis C virus (HCV) by inhibiting the epidermal growth factor receptor (EGFR) signaling pathway, whose activation is required for entry of the virus into cells. |
| IRF7 | 3.1 | 4.9 × 10−12 | Interferon regulatory factor 7 (PTHR11949:SF2) | Key transcriptional regulator of type I interferon (IFN)-dependent immune responses and plays a critical role in the innate immune response against DNA and RNA viruses. |
| ENSECAG00000012132 | 3.1 | 2.0 × 10−55 | 2′–5′-oligoadenylate synthase-like protein 2 (PTHR11258:SF7) | No UniProtKB function listed. |
| ENSECAG00000032818 | 3.1 | 8.9 × 10−49 | Interferon-induced protein with tetratricopeptide repeats 5 (PTHR10271:SF28) | No UniProtKB function listed. |
| RF01955 | 3.0 | 1.5 × 10−2 | Unknown | No UniProtKB function listed. |
| ENSECAG00000017970 | 3.0 | 1.3 × 10−4 | Solute carrier family 23 member 4 (PTHR11119:SF22) | No UniProtKB function listed. |
| TGM2 | 3.0 | 2.6 × 10−18 | Protein-glutamine gamma-glutamyltransferase 2 (PTHR11590:SF6) | Catalyzes the cross-linking of proteins, such as WDR54, and the conjugation of polyamines to proteins. |
| TRIM22 | 3.0 | 2.0 × 10−139 | E3 ubiquitin-protein ligase TRIM22 (PTHR24103:SF650) | Interferon-induced antiviral protein involved in cell innate immunity. The antiviral activity could in part be mediated by TRIM22-dependent ubiquitination of viral proteins. |
| OAS2 | 3.0 | 6.5 × 10−66 | 2′-5′-oligoadenylate synthase 2 (PTHR11258:SF3) | Interferon-induced, dsRNA-activated antiviral enzyme which plays a critical role in cellular innate antiviral response. |
| IFIT5 | 3.0 | 7.4 × 10−9 | Interferon-induced protein with tetratricopeptide repeats 5 (PTHR10271:SF28) | Interferon-induced RNA-binding protein involved in the human innate immune response. Has a broad and adaptable RNA structure recognition important for RNA recognition specificity in antiviral defense. |
| SLC1A3 | 3.0 | 8.3 × 10−6 | Excitatory amino acid transporter 1 (PTHR11958:SF24) | Sodium-dependent, high-affinity amino acid transporter that mediates the uptake of L-glutamate and also L-aspartate and D-aspartate. |
| Downregulated genes | ||||
| FAM71A | −4.6 | 2.4 × 10−8 | Protein FAM71A (PTHR22574:SF15) | No UniProtKB function listed. |
| FN1 | −4.0 | 6.3 × 10−19 | Unknown | Fibronectins bind cell surfaces and various compounds including collagen, fibrin, heparin, DNA, and actin. Fibronectins are involved in cell adhesion, cell motility, opsonization, wound healing, and maintenance of cell shape. |
| DEFB1 | −3.3 | 1.7 × 10−4 | Beta-defensin 1 (PTHR21388:SF9) | Has bactericidal activity. |
| Scheme | Total Reads | Mapped Reads (Number of Reads) | Mapped Reads (%) |
|---|---|---|---|
| H1_PRE | 20,352,241 | 11,692,423 | 57.5 |
| H1_POST | 23,676,872 | 13,834,897 | 58.4 |
| H2_PRE | 20,994,711 | 10,117,799 | 48.2 |
| H2_POST | 20,255,481 | 9,999,105 | 49.4 |
| H3_PRE | 20,651,994 | 10,458,273 | 50.6 |
| H3_POST | 19,113,616 | 9,805,906 | 51.3 |
| H5_PRE | 20,352,426 | 9,223,249 | 45.3 |
| H5_POST | 18,477,943 | 9,073,071 | 49.1 |
| H6_PRE | 14,388,881 | 6,751,730 | 46.9 |
| H6_POST | 12,035,002 | 6,261,094 | 52.0 |
| H7_PRE | 17,643,353 | 8,970,565 | 50.8 |
| H7_POST | 13,916,919 | 6,010,956 | 43.2 |
| H9_PRE | 13,712,739 | 6,613,096 | 48.2 |
| H9_POST | 18,748,418 | 8,506,104 | 45.4 |
| Average | 18,165,757 | 9,094,162 | 49.7 |
References
- Pellett, P.; Roizman, B. Chapter 59. Herpesviridae. In Fields Virology; Knipe, D., Howley, P., Cohen, J., Griffin, D., Lamb, R., Martin, M., Racaniello, V., Roizman, B., Eds.; Lippincott, Williams & Wilkins: Philadelphia, PA, USA, 2013; pp. 1803–1822. [Google Scholar]
- Oladunni, F.S.; Horohov, D.W.; Chambers, T.M. EHV-1: A Constant Threat to the Horse Industry. Front. Microbiol. 2019, 10, 2668. [Google Scholar] [CrossRef] [PubMed]
- Pusterla, N.; Mapes, S.; Wilson, W.D. Prevalence of equine herpesvirus type 1 in trigeminal ganglia and submandibular lymph nodes of equids examined postmortem. Vet. Rec. 2010, 167, 376–378. [Google Scholar] [CrossRef] [PubMed]
- Allen, G.P. Antemortem detection of latent infection with neuropathogenic strains of equine herpesvirus-1 in horses. Am. J. Vet. Res. 2006, 67, 1401–1405. [Google Scholar] [CrossRef] [PubMed]
- Allen, G.P.; Bolin, D.C.; Bryant, U.; Carter, C.N.; Giles, R.C.; Harrison, L.R.; Hong, C.B.; Jackson, C.B.; Poonacha, K.; Wharton, R.; et al. Prevalence of latent, neuropathogenic equine herpesvirus-1 in the Thoroughbred broodmare population of central Kentucky. Equine Vet. J. 2008, 40, 105–110. [Google Scholar] [CrossRef]
- Slater, J.D.; Borchers, K.; Thackray, A.M.; Field, H.J. The trigeminal ganglion is a location for equine herpesvirus 1 latency and reactivation in the horse. J. Gen. Virol. 1994, 75, 2007–2016. [Google Scholar] [CrossRef]
- Giessler, K.S.; Samoilowa, S.; Soboll Hussey, G.; Kiupel, M.; Matiasek, K.; Sledge, D.J.; Liesche, F.; Schlegel, J.; Fux, R.; Goehring, L.S. Viral load and cell tropism during early latent Equid Herpesvirus 1 infection differ over time in lymphoid and neural tissue samples from experimentally infected horses. Front. Vet. Sci. 2020, 7. [Google Scholar] [CrossRef]
- Marenzoni, M.L.; Stefanetti, V.; Danzetta, M.L.; Timoney, P.J. Gammaherpesvirus infections in equids: A review. Vet. Med. 2015, 6, 91–101. [Google Scholar] [CrossRef][Green Version]
- Lunn, D.P.; Davis-Poynter, N.; Flaminio, M.J.B.F.; Horohov, D.W.; Osterrieder, K.; Pusterla, N.; Townsend, H.G.G. Equine herpesvirus-1 consensus statement. J. Vet. Intern. Med. 2009, 23, 450–461. [Google Scholar] [CrossRef]
- van Maanen, C. Equine herpesvirus 1 and 4 infections: An update. Vet. Q. 2002, 24, 58–78. [Google Scholar] [CrossRef]
- Gryspeerdt, A.C.; Vandekerckhove, A.P.; Garré, B.; Barbé, F.; Van de Walle, G.R.; Nauwynck, H.J. Differences in replication kinetics and cell tropism between neurovirulent and non-neurovirulent EHV1 strains during the acute phase of infection in horses. Vet. Microbiol. 2010, 142, 242–253. [Google Scholar] [CrossRef]
- Wilsterman, S.; Soboll-Hussey, G.; Lunn, D.P.; Ashton, L.V.; Callan, R.J.; Hussey, S.B.; Rao, S.; Goehring, L.S. Equine herpesvirus-1 infected peripheral blood mononuclear cell subpopulations during viremia. Vet. Microbiol. 2011, 149, 40–47. [Google Scholar] [CrossRef] [PubMed]
- Goodman, L.B.; Loregian, A.; Perkins, G.A.; Nugent, J.; Buckles, E.L.; Mercorelli, B.; Kydd, J.H.; Palù, G.; Smith, K.C.; Osterrieder, N.; et al. A point mutation in a herpesvirus polymerase determines neuropathogenicity. PLoS Pathog. 2007, 3, e160. [Google Scholar] [CrossRef] [PubMed]
- Scott, J.C.; Dutta, S.K.; Myrup, A.C. In vivo harboring of equine herpesvirus-1 in leukocyte populations and subpopulations and their quantitation from experimentally infected ponies. Am. J. Vet. Res. 1983, 44, 1344–1348. [Google Scholar] [PubMed]
- van Der Meulen, K.M.; Nauwynck, H.J.; Buddaert, W.; Pensaert, M.B. Replication of equine herpesvirus type 1 in freshly isolated equine peripheral blood mononuclear cells and changes in susceptibility following mitogen stimulation. J. Gen. Virol. 2000, 81, 21–25. [Google Scholar] [CrossRef] [PubMed]
- Laval, K.; Favoreel, H.W.; Nauwynck, H.J. Equine herpesvirus type 1 replication is delayed in CD172a+ monocytic cells and controlled by histone deacetylases. J. Gen. Virol. 2015, 96, 118–130. [Google Scholar] [CrossRef]
- Laval, K.; Favoreel, H.W.; Poelaert, K.C.K.; Van Cleemput, J.; Nauwynck, H.J. Equine herpesvirus type 1 enhances viral replication in CD172a+ monocytic cells upon adhesion to endothelial cells. J. Virol. 2015, 89, 10912–10923. [Google Scholar] [CrossRef]
- Poelaert, K.C.K.; Van Cleemput, J.; Laval, K.; Favoreel, H.W.; Couck, L.; Van den Broeck, W.; Azab, W.; Nauwynck, H.J. Equine herpesvirus 1 bridles T-lymphocytes to reach its target organs. J. Virol. 2019. [Google Scholar] [CrossRef]
- Allen, G.P. Risk factors for development of neurologic disease after experimental exposure to equine herpesvirus-1 in horses. Am. J. Vet. Res. 2008, 69, 1595–1600. [Google Scholar] [CrossRef]
- Soboll Hussey, G.; Hussey, S.B.; Wagner, B.; Horohov, D.W.; Van de Walle, G.R.; Osterrieder, N.; Goehring, L.S.; Rao, S.; Lunn, D.P. Evaluation of immune responses following infection of ponies with an EHV-1 ORF1/2 deletion mutant. Vet. Res. 2011, 42. [Google Scholar] [CrossRef]
- Holz, C.L.; Nelli, R.K.; Eilidh Wilson, M.; Zarski, L.M.; Azab, W.; Baumgardner, R.; Osterrieder, N.; Pease, A.; Zhang, L.; Hession, S.; et al. Viral genes and cellular markers associated with neurological complications during herpesvirus infections. J. Gen. Virol. 2017, 98. [Google Scholar] [CrossRef]
- Wimer, C.L.; Damiani, A.; Osterrieder, N.; Wagner, B. Equine herpesvirus type-1 modulates CCL2, CCL3, CCL5, CXCL9, and CXCL10 chemokine expression. Vet. Immunol. Immunopathol. 2011, 140, 266–274. [Google Scholar] [CrossRef]
- Wagner, B.; Wimer, C.; Freer, H.; Osterrieder, N.; Erb, H.N. Infection of peripheral blood mononuclear cells with neuropathogenic equine herpesvirus type-1 strain Ab4 reveals intact interferon-alpha induction and induces suppression of anti-inflammatory interleukin-10 responses in comparison to other viral strains. Vet. Immunol. Immunopathol. 2011, 143, 116–124. [Google Scholar] [CrossRef]
- Shukla, G.C.; Singh, J.; Barik, S. MicroRNAs: Processing, maturation, target recognition and regulatory functions. Mol. Cell. Pharmacol. 2011, 3, 83–92. [Google Scholar] [PubMed]
- Zheng, S.; Li, Y.; Zhang, Y.; Li, X.; Tang, H. MiR-101 regulates HSV-1 replication by targeting ATP5B. Antivir. Res. 2011, 89, 219–226. [Google Scholar] [CrossRef] [PubMed]
- Boss, I.W.; Renne, R. Viral miRNAs and immune evasion. Biochim. Biophys. Acta 2011, 1809, 708–714. [Google Scholar] [CrossRef] [PubMed]
- Zarski, L.M.; Seong, K.K.; Lee, Y.; Holz, C.L.; Nelli, R.K.; Weber, P.S.D.; Soboll Hussey, G. Administration of recombinant adenovirus expressing inhibitory IR2 protein for control of equine herpesvirus 1 infection and disease. 2020. prepare. [Google Scholar]
- Newman, A.M.; Steen, C.B.; Liu, C.L.; Gentles, A.J.; Chaudhuri, A.A.; Scherer, F.; Khodadoust, M.S.; Esfahani, M.S.; Luca, B.A.; Steiner, D.; et al. Determining cell type abundance and expression from bulk tissues with digital cytometry. Nat. Biotechnol. 2019, 37, 773–782. [Google Scholar] [CrossRef]
- Matsumura, T.; Kondo, T.; Sugita, S.; Damiani, A.M.; O’Callaghan, D.J.; Imagawa, H. An Equine Herpesvirus Type 1 Recombinant with a Deletion in the gE and gI Genes Is Avirulent in Young Horses. Virology 1998, 242, 68–79. [Google Scholar] [CrossRef] [PubMed]
- Shakya, A.K.; O’Callaghan, D.J.; Kim, S.K. Comparative Genomic Sequencing and Pathogenic Properties of Equine Herpesvirus 1 KyA and RacL11. Front. Vet. Sci. 2017, 4, 211. [Google Scholar] [CrossRef] [PubMed]
- Said, A.; Osterrieder, N. Equine herpesvirus type 1 (EHV-1) open reading frame 59 encodes an early protein that is localized to the cytosol and required for efficient virus growth. Virology 2014, 449, 263–269. [Google Scholar] [CrossRef]
- Lischka, P.; Sorg, G.; Kann, M.; Winkler, M.; Stamminger, T. A nonconventional nuclear localization signal within the UL84 protein of human cytomegalovirus mediates nuclear import via the importin alpha/beta pathway. J. Virol. 2003, 77, 3734–3748. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Huang, R.; Hu, Z.; Cao, Y.; Li, H.; Zhang, H.; Su, W.; Xu, Y.; Liang, L.; Melgiri, N.D.; Jiang, L. MiR-652-3p inhibition enhances endothelial repair and reduces atherosclerosis by promoting Cyclin D2 expression. EBioMedicine 2019, 40, 685–694. [Google Scholar] [CrossRef] [PubMed]
- Poudyal, D.; Herman, A.; Adelsberger, J.W.; Yang, J.; Hu, X.; Chen, Q.; Bosche, M.; Sherman, B.T.; Imamichi, T. A novel microRNA, hsa-miR-6852 differentially regulated by Interleukin-27 induces necrosis in cervical cancer cells by downregulating the FoxM1 expression. Sci. Rep. 2018, 8, 900. [Google Scholar] [CrossRef] [PubMed]
- Brosnahan, M.M.; Al Abri, M.A.; Brooks, S.A.; Antczak, D.F.; Osterrieder, N. Genome-wide association study of equine herpesvirus type 1-induced myeloencephalopathy identifies a significant single nucleotide polymorphism in a platelet-related gene. Vet. J. 2019, 245, 49–54. [Google Scholar] [CrossRef]
- Rubinstein, E. The complexity of tetraspanins. Biochem. Soc. Trans. 2011, 39, 501–505. [Google Scholar] [CrossRef]
- Haining, E.J.; Matthews, A.L.; Noy, P.J.; Romanska, H.M.; Harris, H.J.; Pike, J.; Morowski, M.; Gavin, R.L.; Yang, J.; Milhiet, P.-E.; et al. Tetraspanin Tspan9 regulates platelet collagen receptor GPVI lateral diffusion and activation. Platelets 2017, 28, 629–642. [Google Scholar] [CrossRef]
- Mossman, K.L.; Ashkar, A.A. Herpesviruses and the innate immune response. Viral Immunol. 2005, 18, 267–281. [Google Scholar] [CrossRef]
- Ivashkiv, L.B.; Donlin, L.T. Regulation of type I interferon responses. Nat. Rev. Immunol. 2014, 14, 36–49. [Google Scholar] [CrossRef]
- Kumari, P.; Narayanan, S.; Kumar, H. Herpesviruses: Interfering innate immunity by targeting viral sensing and interferon pathways. Rev. Med. Virol. 2015, 25, 187–201. [Google Scholar] [CrossRef]
- Dupuis, S.; Jouanguy, E.; Al-Hajjar, S.; Fieschi, C.; Al-Mohsen, I.Z.; Al-Jumaah, S.; Yang, K.; Chapgier, A.; Eidenschenk, C.; Eid, P.; et al. Impaired response to interferon-α/β and lethal viral disease in human STAT1 deficiency. Nat. Genet. 2003, 33, 388–391. [Google Scholar] [CrossRef]
- Bin, L.; Edwards, M.G.; Heiser, R.; Streib, J.; Richers, B.; Leung, D.Y.M. Identification of Novel Gene Signatures in Atopic Dermatitis Complicated by Eczema Herpeticum. J. Allergy Clin. Immunol. 2014, 133, AB193. [Google Scholar] [CrossRef][Green Version]
- Soboll Hussey, G.; Ashton, L.V.; Quintana, A.M.; Lunn, D.P.; Goehring, L.S.; Annis, K.; Landolt, G. Innate immune responses of airway epithelial cells to infection with equine herpesvirus-1. Vet. Microbiol. 2014, 170, 28–38. [Google Scholar] [CrossRef] [PubMed]
- Soboll Hussey, G.; Ashton, L.V.; Quintana, A.M.; Van de Walle, G.R.; Osterrieder, N.; Lunn, D.P. Equine herpesvirus type 1 pUL56 modulates innate responses of airway epithelial cells. Virology 2014, 464–465, 76–86. [Google Scholar] [CrossRef] [PubMed]
- Quintana, A.M.; Landolt, G.A.; Annis, K.M.; Hussey, G.S. Immunological characterization of the equine airway epithelium and of a primary equine airway epithelial cell culture model. Vet. Immunol. Immunopathol. 2011, 140, 226–236. [Google Scholar] [CrossRef]
- Poelaert, K.C.K.; Van Cleemput, J.; Laval, K.; Favoreel, H.W.; Soboll Hussey, G.; Maes, R.K.; Nauwynck, H.J. Abortigenic but Not Neurotropic Equine Herpes Virus 1 Modulates the Interferon Antiviral Defense. Front. Cell. Infect. Microbiol. 2018, 8, 312. [Google Scholar] [CrossRef]
- Oladunni, F.S.; Sarkar, S.; Reedy, S.; Balasuriya, U.B.R.; Horohov, D.W.; Chambers, T.M. Equid Herpesvirus 1 Targets the Sensitization and Induction Steps to Inhibit the Type I Interferon Response in Equine Endothelial Cells. J. Virol. 2019, 93. [Google Scholar] [CrossRef]
- Sarkar, S.; Balasuriya, U.B.R.; Horohov, D.W.; Chambers, T.M. Equine herpesvirus-1 suppresses type-I interferon induction in equine endothelial cells. Vet. Immunol. Immunopathol. 2015, 167, 122–129. [Google Scholar] [CrossRef]
- Scherer, C.A.; Magness, C.L.; Steiger, K.V.; Poitinger, N.D.; Caputo, C.M.; Miner, D.G.; Winokur, P.L.; Klinzman, D.; McKee, J.; Pilar, C.; et al. Distinct gene expression profiles in peripheral blood mononuclear cells from patients infected with vaccinia virus, yellow fever 17D virus, or upper respiratory infections. Vaccine 2007, 25, 6458–6473. [Google Scholar] [CrossRef][Green Version]
- Schmid, S.; Mordstein, M.; Kochs, G.; García-Sastre, A.; Tenoever, B.R. Transcription factor redundancy ensures induction of the antiviral state. J. Biol. Chem. 2010, 285, 42013–42022. [Google Scholar] [CrossRef]
- Groom, J.R.; Luster, A.D. CXCR3 ligands: Redundant, collaborative and antagonistic functions. Immunol. Cell Biol. 2011, 89, 207–215. [Google Scholar] [CrossRef]
- Poelaert, K.C.K.; Van Cleemput, J.; Laval, K.; Xie, J.; Favoreel, H.W.; Nauwynck, H.J. Equine herpesvirus 1 infection orchestrates the expression of chemokines in equine respiratory epithelial cells. J. Gen. Virol. 2019. [Google Scholar] [CrossRef] [PubMed]
- Johnstone, S.; Barsova, J.; Campos, I.; Frampton, A.R. Equine herpesvirus type 1 modulates inflammatory host immune response genes in equine endothelial cells. Vet. Microbiol. 2016, 192, 52–59. [Google Scholar] [CrossRef] [PubMed]
- Proost, P.; Wuyts, A.; van Damme, J. Human monocyte chemotactic proteins-2 and -3: Structural and functional comparison with MCP-1. J. Leukoc. Biol. 1996, 59, 67–74. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Iglesias, E.; Samri, A.; Kamkamidze, G.; Decoville, T.; Carcelain, G.; Autran, B. A systematic comparison of methods to measure HIV-1 specific CD8 T cells. J. Immunol. Methods 2003, 272, 23–34. [Google Scholar] [CrossRef]
- Guidotti, L.G.; Chisari, F.V. Noncytolytic control of viral infections by the innate and adaptive immune response. Annu. Rev. Immunol. 2001, 19, 65–91. [Google Scholar] [CrossRef] [PubMed]
- O’Neill, T.; Kydd, J.H.; Allen, G.P.; Wattrang, E.; Mumford, J.A.; Hannant, D. Determination of equid herpesvirus 1-specific, CD8+, cytotoxic T lymphocyte precursor frequencies in ponies. Vet. Immunol. Immunopathol. 1999, 70, 43–54. [Google Scholar] [CrossRef]
- Kydd, J.H.; Wattrang, E.; Hannant, D. Pre-infection frequencies of equine herpesvirus-1 specific, cytotoxic T lymphocytes correlate with protection against abortion following experimental infection of pregnant mares. Vet. Immunol. Immunopathol. 2003, 96, 207–217. [Google Scholar] [CrossRef]
- Paillot, R.; Ellis, S.A.; Daly, J.M.; Audonnet, J.C.; Minke, J.M.; Davis-Poynter, N.; Hannant, D.; Kydd, J.H. Characterisation of CTL and IFN-γ synthesis in ponies following vaccination with a NYVAC-based construct coding for EHV-1 immediate early gene, followed by challenge infection. Vaccine 2006, 24, 1490–1500. [Google Scholar] [CrossRef]
- Paillot, R.; Daly, J.M.; Luce, R.; Montesso, F.; Davis-Poynter, N.; Hannant, D.; Kydd, J.H. Frequency and phenotype of EHV-1 specific, IFN-γ synthesising lymphocytes in ponies: The effects of age, pregnancy and infection. Dev. Comp. Immunol. 2007, 31, 202–214. [Google Scholar] [CrossRef]
- Breathnach, C.C.; Soboll, G.; Suresh, M.; Lunn, D.P. Equine herpesvirus-1 infection induces IFN-gamma production by equine T lymphocyte subsets. Vet. Immunol. Immunopathol. 2005, 103, 207–215. [Google Scholar] [CrossRef]
- Favoreel, H.W.; Nauwynck, H.J.; Pensaert, M.B. Immunological hiding of herpesvirus-infected cells. Arch. Virol. 2000, 145, 1269–1290. [Google Scholar] [CrossRef] [PubMed]
- van der Meulen, K.M.; Nauwynck, H.J.; Pensaert, M.B. Absence of viral antigens on the surface of equine herpesvirus-1-infected peripheral blood mononuclear cells: A strategy to avoid complement-mediated lysis. J. Gen. Virol. 2003, 84, 93–97. [Google Scholar] [CrossRef] [PubMed]
- Carroll, M.C. The complement system in B cell regulation. Mol. Immunol. 2004, 41, 141–146. [Google Scholar] [CrossRef] [PubMed]
- Wagner, C.; Hänsch, G.M. Receptors for complement C3 on T-lymphocytes: Relics of evolution or functional molecules? Mol. Immunol. 2006, 43, 22–30. [Google Scholar] [CrossRef] [PubMed]
- Wagner, C.; Ochmann, C.; Schoels, M.; Giese, T.; Stegmaier, S.; Richter, R.; Hug, F.; Hänsch, G.M. The complement receptor 1, CR1 (CD35), mediates inhibitory signals in human T-lymphocytes. Mol. Immunol. 2006, 43, 643–651. [Google Scholar] [CrossRef] [PubMed]
- Wilson, J.G.; Tedder, T.F.; Fearon, D.T. Characterization of human T lymphocytes that express the C3b receptor. J. Immunol. 1983, 131, 684–689. [Google Scholar]
- Werfel, T.; Kirchhoff, K.; Wittmann, M.; Begemann, G.; Kapp, A.; Heidenreich, F.; Götze, O.; Zwirner, J. Activated Human T Lymphocytes Express a Functional C3a Receptor. J. Immunol. 2000, 165, 6599–6605. [Google Scholar] [CrossRef]
- Oikonomopoulou, K.; Ricklin, D.; Ward, P.A.; Lambris, J.D. Interactions between coagulation and complement—Their role in inflammation. Semin. Immunopathol. 2012, 34, 151–165. [Google Scholar] [CrossRef]
- Davis, A.E., 3rd. Biological effects of C1 inhibitor. Drug News Perspect. 2004, 17, 439–446. [Google Scholar] [CrossRef]
- Yeo, W.M.; Osterrieder, N.; Stokol, T. Equine herpesvirus type 1 infection induces procoagulant activity in equine monocytes. Vet. Res. 2013, 44, 16. [Google Scholar] [CrossRef]
- Stokol, T.; Yeo, W.M.; Burnett, D.; DeAngelis, N.; Huang, T.; Osterrieder, N.; Catalfamo, J. Equid Herpesvirus Type 1 Activates Platelets. PLoS ONE 2015, 10, e0122640. [Google Scholar] [CrossRef] [PubMed]
- Goehring, L.S.; Soboll Hussey, G.; Gomez Diez, M.; Benedict, K.; Maxwell, L.K.; Morley, P.S.; Sloet van Oldruitenborgh-Oosterbaan, M.M.; Lunn, D.P. Plasma D-Dimer Concentrations during Experimental EHV-1 Infection of Horses. J. Vet. Intern. Med. 2013, 27, 1535–1542. [Google Scholar] [CrossRef] [PubMed]
- Wilson, M.E.; Holz, C.L.; Kopec, A.K.; Dau, J.J.; Luyendyk, J.P.; Soboll Hussey, G. Coagulation parameters following equine herpesvirus type 1 infection in horses. Equine Vet. J. 2019, 51, 102–107. [Google Scholar] [CrossRef] [PubMed]
- Adams, R.L.C.; Bird, R.J. Review article: Coagulation cascade and therapeutics update: Relevance to nephrology. Part 1: Overview of coagulation, thrombophilias and history of anticoagulants. Nephrology 2009, 14, 462–470. [Google Scholar] [CrossRef] [PubMed]
- Sang, Y.; Miller, L.C.; Blecha, F. Macrophage Polarization in Virus-Host Interactions. J. Clin. Cell. Immunol. 2015, 6, 311. [Google Scholar] [CrossRef] [PubMed]
- Sutton, C.E.; Mielke, L.A.; Mills, K.H.G. IL-17-producing γδ T cells and innate lymphoid cells. Eur. J. Immunol. 2012, 42, 2221–2231. [Google Scholar] [CrossRef] [PubMed]
- van der Meulen, K.; Caij, B.; Pensaert, M.; Nauwynck, H. Absence of viral envelope proteins in equine herpesvirus 1-infected blood mononuclear cells during cell-associated viremia. Vet. Microbiol. 2006, 113, 265–273. [Google Scholar] [CrossRef]
- Lunn, D.P.; Holmes, M.A.; Gibson, J.; Field, H.J.; Kydd, J.H.; Duffus, W.P.H. Haematological changes and equine lymphocyte subpopulation kinetics during primary infection and attempted re-infection of specific pathogen free foals with EHV-1. Equine Vet. J. 1991, 23, 35–40. [Google Scholar] [CrossRef]
- McCulloch, J.; Williamson, S.A.; Powis, S.J.; Edington, N. The effect of EHV-1 infection upon circulating leucocyte populations in the natural equine host. Vet. Microbiol. 1993, 37, 147–161. [Google Scholar] [CrossRef]
- Gilkerson, J.R.; Whalley, J.M.; Drummer, H.E.; Studdert, M.J.; Love, D.N. Epidemiological studies of equine herpesvirus 1 (EHV-1) in Thoroughbred foals: A review of studies conducted in the Hunter Valley of New South Wales between 1995 and 1997. Vet. Microbiol. 1999, 68, 15–25. [Google Scholar] [CrossRef]
- Gilkerson, J.R.; Whalley, J.M.; Drummer, H.E.; Studdert, M.J.; Love, D.N. Epidemiology of EHV-1 and EHV-4 in the mare and foal populations on a Hunter Valley stud farm: Are mares the source of EHV-1 for unweaned foals. Vet. Microbiol. 1999, 68, 27–34. [Google Scholar] [CrossRef]
- Foote, C.E.; Love, D.N.; Gilkerson, J.R.; Whaley, J.M. Detection of EHV-1 and EHV-4 DNA in unweaned Thoroughbred foals from vaccinated mares on a large stud farm. Equine Vet. J. 2010, 36, 341–345. [Google Scholar] [CrossRef] [PubMed]
- Mumford, J.A.; Rossdale, P.D.; Jessett, D.M.; Gann, S.J.; Ousey, J. Serological and virological investigations of an equid herpesvirus 1 (EHV-1) abortion storm on a stud farm in 1985. J. Reprod. Fertil. Suppl. 1987, 35, 509–518. [Google Scholar] [PubMed]
- Cox, E.; Reddy, S.; Iofin, I.; Cohen, J.I. Varicella-Zoster Virus ORF57, Unlike Its Pseudorabies Virus UL3.5 Homolog, Is Dispensable for Viral Replication in Cell Culture. Virology 1998, 250, 205–209. [Google Scholar] [CrossRef] [PubMed]
- Dean, H.J.; Cheung, A.K. A 3′ coterminal gene cluster in pseudorabies virus contains herpes simplex virus UL1, UL2, and UL3 gene homologs and a unique UL3.5 open reading frame. J. Virol. 1993, 67, 5955–5961. [Google Scholar] [CrossRef]
- Chaudhuri, V.; Sommer, M.; Rajamani, J.; Zerboni, L.; Arvin, A.M. Functions of Varicella-Zoster Virus ORF23 Capsid Protein in Viral Replication and the Pathogenesis of Skin Infection. J. Virol. 2008, 82, 10231–10246. [Google Scholar] [CrossRef][Green Version]
- Sun, Y.; Brown, S.M. The Open Reading Frames 1, 2, 71, and 75 Are Nonessential for the Replication of Equine Herpesvirus Type 1 in Vitro. Virology 1994, 199, 448–452. [Google Scholar] [CrossRef]
- Hussey, G.S.; Goehring, L.S.; Lunn, D.P.; Hussey, S.B.; Huang, T.; Osterrieder, N.; Powell, C.; Hand, J.; Holz, C.; Slater, J. Experimental infection with equine herpesvirus type 1 (EHV-1) induces chorioretinal lesions. Vet. Res. 2013, 44, 118. [Google Scholar] [CrossRef]
- Drummer, H.E.; Reubel, G.H.; Studdert, M.J. Equine gammaherpesvirus 2 (EHV2) is latent in B lymphocytes. Arch. Virol. 1996, 141, 495–504. [Google Scholar] [CrossRef]
- Mekuria, Z.H.; El-Hage, C.; Ficorilli, N.P.; Washington, E.A.; Gilkerson, J.R.; Hartley, C.A. Mapping B lymphocytes as major reservoirs of naturally occurring latent equine herpesvirus 5 infection. J. Gen. Virol. 2017, 98, 461–470. [Google Scholar] [CrossRef]
- Wang, L.; Raidal, S.L.; Pizzirani, A.; Wilcox, G.E. Detection of respiratory herpesviruses in foals and adult horses determined by nested multiplex PCR. Vet. Microbiol. 2007, 121, 18–28. [Google Scholar] [CrossRef] [PubMed]
- Zarski, L.M.; High, E.A.; Nelli, R.K.; Bolin, S.R.; Williams, K.J.; Hussey, G. Development and application of a quantitative PCR assay to study equine herpesvirus 5 invasion and replication in equine tissues in vitro and in vivo. J. Virol. Methods 2017, 248. [Google Scholar] [CrossRef] [PubMed]
- Miglio, A.; Morelli, C.; Gialletti, R.; Lauteri, E.; Sforna, M.; Marenzoni, M.L.; Antognoni, M.T. Clinical and immunophenotypic findings in 4 forms of equine lymphoma. Can. Vet. J. 2019, 60, 33–40. [Google Scholar] [PubMed]
- Miglio, A.; Antognoni, M.T.; Morelli, C.; Gialletti, R. Third Eyelid T-cell-Rich Large B-cell Lymphoma Positive to EHV-5 in a Mare—A Case Report. J. Equine Vet. Sci. 2018, 70, 52–56. [Google Scholar] [CrossRef]
- Bell, S.A.; Balasuriya, U.B.R.; Gardner, I.A.; Barry, P.A.; Wilson, W.D.; Ferraro, G.L.; MacLachlan, N.J. Temporal detection of equine herpesvirus infections of a cohort of mares and their foals. Vet. Microbiol. 2006, 116, 249–257. [Google Scholar] [CrossRef]
- Akkutay, A.Z.; Osterrieder, N.; Damiani, A.; Tischer, B.K.; Borchers, K.; Alkan, F. Prevalence of equine gammaherpesviruses on breeding farms in Turkey and development of a TaqMan MGB real-time PCR to detect equine herpesvirus 5 (EHV-5). Arch. Virol. 2014, 159, 2989–2995. [Google Scholar] [CrossRef]
- Anders, S.; Pyl, P.T.; Huber, W. HTSeq—A Python framework to work with high-throughput sequencing data. Bioinformatics 2014, 31, 166–169. [Google Scholar] [CrossRef]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R.; Subgroup, 1000 Genome Project Data Processing. The Sequence Alignment/Map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef]
- Pertea, M.; Kim, D.; Pertea, G.M.; Leek, J.T.; Salzberg, S.L. Transcript-level expression analysis of RNA-seq experiments with HISAT, StringTie and Ballgown. Nat. Protoc. 2016, 11, 1650. [Google Scholar] [CrossRef]
- Andrews, S. FastQC: A Quality Control Tool for High Throughput Sequence Data. Available online: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on 2 January 2020).
- Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet. J. 2011, 17, 10–12. [Google Scholar] [CrossRef]
- Friedländer, M.R.; Mackowiak, S.D.; Li, N.; Chen, W.; Rajewsky, N. miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades. Nucleic Acids Res. 2011, 40, 37–52. [Google Scholar] [CrossRef] [PubMed]
- Griffiths-Jones, S.; Saini, H.K.; van Dongen, S.; Enright, A.J. miRBase: Tools for microRNA genomics. Nucleic Acids Res. 2007, 36, D154–D158. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
- Yu, G.; Wang, L.-G.; Han, Y.; He, Q.-Y. clusterProfiler: An R Package for Comparing Biological Themes Among Gene Clusters. Omics J. Integr. Biol. 2012, 16, 284–287. [Google Scholar] [CrossRef]
- Carlson, M. org.Hs.eg.db: Genome Wide Annotation for Human. 2019. Available online: https://bioconductor.org/packages/release/data/annotation/html/org.Hs.eg.db.html (accessed on 20 December 2020).
- Supek, F.; Bošnjak, M.; Škunca, N.; Šmuc, T. REVIGO Summarizes and Visualizes Long Lists of Gene Ontology Terms. PLoS ONE 2011, 6, e21800. [Google Scholar] [CrossRef] [PubMed]
- Agarwal, V.; Bell, G.W.; Nam, J.-W.; Bartel, D.P. Predicting effective microRNA target sites in mammalian mRNAs. Elife 2015, 4, e05005. [Google Scholar] [CrossRef] [PubMed]
- Robinson, J.T.; Thorvaldsdóttir, H.; Winckler, W.; Guttman, M.; Lander, E.S.; Getz, G.; Mesirov, J.P. Integrative genomics viewer. Nat. Biotechnol. 2011, 29, 24–26. [Google Scholar] [CrossRef]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2009, 26, 139–140. [Google Scholar] [CrossRef]








| Sample ID | Total Reads | Uniquely Mapped (Number of Reads) | Uniquely Mapped (%) |
|---|---|---|---|
| H1_PRE | 26,999,513 | 21,296,243 | 78.9 |
| H1_POST | 27,536,037 | 20,976,540 | 76.2 |
| H2_PRE | 35,256,030 | 29,155,433 | 82.7 |
| H2_POST | 42,517,852 | 33,582,323 | 79.0 |
| H3_PRE | 56,397,724 | 45,505,043 | 80.7 |
| H3_POST | 63,282,694 | 51,758,322 | 81.8 |
| H5_PRE | 93,180,427 | 75,568,952 | 81.1 |
| H5_POST | 27,862,507 | 23,309,213 | 83.7 |
| H6_PRE | 50,453,360 | 40,889,209 | 81.0 |
| H6_POST | 24,740,083 | 19,062,322 | 77.1 |
| H7_PRE | 26,710,306 | 20,926,895 | 78.3 |
| H7_POST | 52,898,636 | 43,121,055 | 81.5 |
| H9_PRE | 51,887,615 | 42,716,415 | 82.3 |
| H9_POST | 28,998,398 | 23,182,557 | 79.9 |
| Average | 43,480,084 | 35,075,037 | 80.3 |
| Pre-Challenge (% of Total Cell Population) | Post-Challenge (% of Total Cell Population) | |
|---|---|---|
| B cells naive | 42.07 ± 0.02 | 39.89 ± 0.01 |
| B cells memory | 0.00 ± 0.00 | 0.62 ± 0.01 |
| Plasma cells | 0.38 ± 0.00 | 0.00 ± 0.00 * |
| T cells CD8 | 2.37 ± 0.00 | 0.46 ± 0.00 ** |
| T cells CD4 naive | 5.52 ± 0.02 | 6.95 ± 0.02 |
| T cells CD4 memory resting | 1.34 ± 0.01 | 1.04 ± 0.01 |
| T cells CD4 memory activated | 5.55 ± 0.01 | 3.28 ± 0.01 |
| T cells follicular helper | 17.75 ± 0.02 | 16.69 ± 0.01 |
| T cells regulatory (Tregs) | 0.88 ± 0.00 | 1.05 ± 0.01 |
| T cells gamma delta | 1.11 ± 0.00 | 4.00 ± 0.00 ** |
| Natural killer cells resting | 2.32 ± 0.01 | 1.32 ± 0.01 |
| Natural killer cells activated | 0.18 ± 0.00 | 0.51 ± 0.00 |
| Monocytes | 4.38 ± 0.01 | 4.71 ± 0.01 |
| Macrophages M0 | 1.49 ± 0.00 | 0.00 ± 0.00 * |
| Macrophages M1 | 0.00 ± 0.00 | 2.14 ± 0.01 * |
| Macrophages M2 | 2.39 ± 0.00 | 3.18 ± 0.00 |
| Dendritic cells resting | 0.00 ± 0.00 | 0.66 ± 0.00 |
| Dendritic cells activated | 4.98 ± 0.00 | 5.84 ± 0.01 |
| Mast cells resting | 0.00 ± 0.00 | 0.64 ± 0.01 |
| Mast cells activated | 2.89 ± 0.01 | 1.54 ± 0.01 |
| Eosinophils | 4.22 ± 0.01 | 4.92 ± 0.01 |
| Neutrophils | 0.15 ± 0.00 | 0.55 ± 0.00 |
| ID | Log2 Fold | Padj | MirBase ID | Human Ortholog | Mature Sequence | Precursor Sequence | Differentially Expressed Gene Targets |
|---|---|---|---|---|---|---|---|
| Upregulated miRNAs | |||||||
| Equine_chr11_2567 | 1.2 | 3.5 × 10−8 | eca-miR-9104 | CTGACCTGAGGCCTCTGCTGCA | GAGTGGCTGGGCTCAGCAGGGCGGAGGGTCAGGAGGTGAGCTTGGCTCTGCTGACCTGAGGCCTCTGCTGCA | ||
| Equine_chrX_44985 | 1.1 | 1.3 × 10−17 | eca-miR-652 | hsa-miR-652-3p | AATGGCGCCACTAGGGTTG | CAACCCTAGGAGAGGGTGCCATTCACATAGACTATAATTGAATGGCGCCACTAGGGTTG | TNRC6A↓, NPTN↑, KPNA1↓, TP53↑ |
| Equine_chrX_45803 | 1.1 | 2.0 × 10−3 | eca-miR-2483 | TCTGTCAACCATCCAGCTGTTT | TCTGTCAACCATCCAGCTGTTTGGGGTGATGCAAACAAACATCTAGTTGGTTGAGAGAAT | ||
| Downregulated miRNAs | |||||||
| Equine_chr15_10631 | −1 | 1.4 × 10−2 | - | hsa-miR-6852-5p | ACCTGGGGATCTGAGGAG | ACCTGGGGATCTGAGGAGGCCCTTCCAGCCCCAAGGCTGGGAATGCTCCTGGTCCCCTTTCTTGC | IFIT5↑, Mx2↑, OAS3↑, OAS2↑, CCL8↑, BCL2LI4↑, MPZ↑, TGM2↑, HSDIIB1↑ FN1↓, DEFB1↓ |
| EHV-2_38 | −1 | 1.0 × 10−2 | - | TATGATAGTCCATACCCTTAAGT | TATGATAGTCCATACCCTTAAGTTTGATAAGTAAAAAATTTAAGTACGTGGACTGTCAACA | ||
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zarski, L.M.; Weber, P.S.D.; Lee, Y.; Soboll Hussey, G. Transcriptomic Profiling of Equine and Viral Genes in Peripheral Blood Mononuclear Cells in Horses during Equine Herpesvirus 1 Infection. Pathogens 2021, 10, 43. https://doi.org/10.3390/pathogens10010043
Zarski LM, Weber PSD, Lee Y, Soboll Hussey G. Transcriptomic Profiling of Equine and Viral Genes in Peripheral Blood Mononuclear Cells in Horses during Equine Herpesvirus 1 Infection. Pathogens. 2021; 10(1):43. https://doi.org/10.3390/pathogens10010043
Chicago/Turabian StyleZarski, Lila M., Patty Sue D. Weber, Yao Lee, and Gisela Soboll Hussey. 2021. "Transcriptomic Profiling of Equine and Viral Genes in Peripheral Blood Mononuclear Cells in Horses during Equine Herpesvirus 1 Infection" Pathogens 10, no. 1: 43. https://doi.org/10.3390/pathogens10010043
APA StyleZarski, L. M., Weber, P. S. D., Lee, Y., & Soboll Hussey, G. (2021). Transcriptomic Profiling of Equine and Viral Genes in Peripheral Blood Mononuclear Cells in Horses during Equine Herpesvirus 1 Infection. Pathogens, 10(1), 43. https://doi.org/10.3390/pathogens10010043

