Next Article in Journal
Flight Characteristics of Bactrocera dorsalis Associated with Long-Distance Migration
Previous Article in Journal
Dopamine Enhances Healthspan and Locomotor Performance via Antioxidant Defense in Silkworms, Bombyx mori
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Insects
Volume 17
Issue 2
10.3390/insects17020206
insects-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

DDX3 Regulates Reproduction in Locusta migratoria Potentially via Insulin/Insulin-like Growth Factor Signaling

by
Yi Jin
1,†,
Jiaying Xu
1,†,
Zeming Yuan
1,
Huazhang Zhao
1,
Shijia Yang
1,
Yutong Wang
1,
Bin Tang
1,
Junce Tian
2,* and
Shigui Wang
1,*
1
College of Life and Environmental Sciences, Hangzhou Normal University, Hangzhou 311121, China
2
State Key Laboratory for Quality and Safety of Agro-Products, Institute of Plant Protection and Microbiology, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Insects 2026, 17(2), 206; https://doi.org/10.3390/insects17020206
Submission received: 4 January 2026 / Revised: 6 February 2026 / Accepted: 8 February 2026 / Published: 14 February 2026
(This article belongs to the Section Insect Molecular Biology and Genomics)
Browse Figures
Versions Notes

Simple Summary

Locusta migratoria owes its significant agricultural impact to its exceptionally high reproductive output. We demonstrate that the conserved RNA helicase DDX3 functions as a key endogenous regulator of fecundity. RNAi-mediated knockdown of DDX3 (i) attenuated insulin/insulin-like growth factor signaling (IIS), (ii) depleted hemolymph trehalose and fat-body glycogen reserves, and (iii) transcriptionally repressed the yolk protein precursors VgA/B and the juvenile hormone regulator JHAMT. Consequently, ovarian maturation was arrested and egg production was significantly reduced. By establishing DDX3 as a critical node that integrates metabolic and reproductive signaling, our study provides additional predictions regarding the signaling pathways through which DDX3 regulates locust reproduction.

Abstract

Locusta migratoria (Orthoptera: Acrididae) is a major agricultural pest, characterized by its strong reproductive capacity and rapid reproduction rate. Consequently, identifying novel targets to control or reduce the fecundity of locusts is of significant practical importance. Insulin/insulin-like growth factor signaling (IIS) and the DEAD-box RNA helicase 3 (DDX3) exhibit extensive functional convergence; both govern key life-history traits in insects, including lifespan, metabolic homeostasis, and fecundity. Strikingly, each pathway can influence oogenesis through Notch signaling. Thus, we hypothesize that DDX3 may modulate insect reproduction associated with this pathway. After silencing DDX3 through RNA interference (RNAi), we found that the key genes of IIS were significantly downregulated and the content of trehalose and glycogen decreased significantly, proving that DDX3 inhibits reproduction associated with IIS. In addition, DDX3 interference led to a marked reduction in the mRNA expression of Vgs (VgA/B) and JHAMT, which was accompanied by a significant decrease in ovarian development. Furthermore, integrating our previous findings, we posit that DDX3 engages in locust reproduction via the regulation of pivotal IIS pathway genes such as InR and FOXO, thereby completing the putative regulatory circuitry through which DDX3 modulates reproductive processes. Our findings deepen the understanding of the endogenous circuitry governing locust reproduction and provide novel theoretical justification for targeting DDX3 in locust management strategies.

Graphical Abstract

1. Introduction

Locusta migratoria (Orthoptera: Acrididae) is a highly destructive agricultural pest characterized by rapid reproduction and swarming behavior [1,2]. In severe infestations, it triggers locust plagues, leading to substantial economic losses and significant ecological imbalances [2,3,4]. Therefore, it is of great practical significance to screen and discover new control targets that can effectively reduce or control locusts’ reproductive capacity, thereby enriching information and methods for locust pest management. RNA interference (RNAi) induces the silencing of target genes by exogenously introducing double-stranded RNA (dsRNA) [5]. As a new type of green and sustainable crop pest management and control strategy, it has been widely adopted due to its high efficiency and specificity [6,7].
Insulin/insulin-like growth factor signaling (IIS) regulates critical cellular processes such as proliferation and differentiation [8]. Insect IIS can affect the reproduction of insects by regulating the synthesis of yolk protoprotein [9]. Specifically, IIS directly influences insect reproduction [9] by interacting with the FOXO and Notch pathways to control ovarian development [10,11], thereby impacting reproductive performance. Thus far, three genes encoding insulin-related peptides—IRP (Insulin-Related Peptide), aIGF (arthropod insulin-like growth factor) and Gonadulin—have been characterized in L. migratoria, and their indispensable functions in locust reproduction have been experimentally established [12]. InR1 (LOCM107679) and InR2 (LOCM107370) are insulin-like peptide receptors that function as paralogs of the canonical insulin receptor [13].
The LmDDX family comprises 32 members, each carrying the nine canonical motifs plus DEXDc and HELICc domains. Every member has a unique structure and expression pattern, yet the family is evolutionarily conserved and essential for growth, development and reproduction; silencing individual genes triggers lethality or ecdysis arrest [14]. DEAD-box proteins, highly conserved regulators of RNA metabolism [15], include DDX3—an RNA helicase controlling splicing, translation and decay [16], which was selected for DDX3’s key role in locust reproduction via juvenile-hormone signaling, vitellogenin expression and oocyte maturation [17], offering targets for pest control and cross-species studies. Research on its reproductive functions has primarily centered on the Drosophila homolog, Belle. Studies have shown that Belle deficiency impairs Notch activation and follicular cell differentiation, resulting in cell cycle abnormalities [18]. The mRNA of mouse DDX3X is predominantly expressed in the ovary and embryo [19], indicating that DDX3X may play a critical role in germ cell development. A recent study demonstrated that DDX3 is essential for ovary development and oocyte maturation in L. migratoria. Specifically, interference with DDX3 results in the downregulation of Vg in the fat body and the upregulation of VgR in the ovary via the JHAMT signaling pathway, which ultimately inhibits ovary development and oocyte maturation [17]. Collectively, these findings highlight the conserved function of DDX3 in reproduction.
By comparing the roles of the IIS and DDX3 in reproduction, it becomes evident that they share notable similarities. Both pathways can modulate insect reproduction via the Notch signaling pathway. Furthermore, both the IIS and DDX3 exert regulatory influences on the insect life cycle. The DEAD-box helicase family plays a pivotal role in various aspects of RNA metabolism, including ribosome biogenesis, translation, RNA export, and RNA stability. Specifically, DDX1 and DDX3 in infected human astrocytoma cells (U87MG cells) have been shown to interact with VEEV-nsP3, suggesting a potential synergistic effect between DDX3 and DDX1 [20]. In a rat model, DDX1 knockout resulted in a marked reduction in proinsulin protein levels, whereas DDX1 overexpression significantly increased these levels, thereby demonstrating that DDX1 is essential for regulating insulin translation [21]. Consequently, we hypothesize that DDX3 may modulate insect reproduction associated with this pathway.
LmDDX3 has been identified as a key regulator of ovarian development and oocyte maturation in Locusta migratoria [17], yet its intrinsic regulatory mechanisms remain incompletely understood. Herein, we employed RNAi-mediated knockdown of DDX3 and quantified the expression of core IIS-pathway genes together with hemolymph sugar levels, thereby furnishing evidence that supports the hypothesis that DDX3 participates in locust reproduction via modulation of key IIS signaling components such as InR and FOXO.
Our findings deepen the understanding of the endogenous circuitry controlling L. migratoria reproduction and furnish additional theoretical support for exploiting DDX3 as a molecular target in locust management strategies.

2. Materials and Methods

2.1. Experimental Insects

Insects used in this study were obtained from the Yunnan Jianshui Xiangyu Grasshopper Breeding Base. The eggs for the experiment were incubated in a controlled-environment chamber set at a temperature of 28–32 °C, relative humidity of 70–80%, and a photoperiod of 16:8 (light/dark). The locust eggs were mixed with autoclaved vermiculite and placed into pre-prepared disposable plastic containers (23.2 cm × 16.3 cm × 10.9 cm) for incubation. After hatching, the locusts were transferred to well-ventilated cages (50 cm × 50 cm × 50 cm), with each cage housing 150–200 individuals. They were provided with fresh wheat and bran as food sources.

2.2. Bioinformatics Analysis

The LmDDX3 protein sequence (accession number MN329086.1) was retrieved from GeneBank. Homology searches between L. migratoria and other species were carried out using BLAST (https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 1 May 2023)) against the NCBI database. The sequences demonstrating the highest homology scores were chosen for subsequent analysis. A phylogenetic tree was constructed using the neighbor-joining method [22] based on these sequences. Evolutionary distances were calculated using the Poisson correction model, and bootstrap values from 1000 replicates were used to assess the robustness of the phylogenetic relationships.

2.3. RNA Extraction and RT-qPCR

Total RNA was extracted using Trizol reagent (TaKaRa, Dalian, China) and its concentration was assessed using a NanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham, MA, USA) and 1.0% agarose gel electrophoresis. High-quality RNA samples were selected for cDNA synthesis, following the protocol provided in the PrimeScriptTM RT Reagent Kit (Takara, Kusatsu, Shiga, Japan). The cDNA was diluted 10 times for the subsequent general polymerase chain reaction (PCR), reverse transcription quantitative PCR (RT-qPCR), and dsRNA synthesis studies.
RT-qPCR was performed using the Bio-Rad Real-Time PCR Assay System (Bio-Rad, Hercules, CA, USA). All primers were designed using Primer 5.0 software (Table 1). The gene expressions of DDX3, Insulin-like peptides (ILP), Insulin receptor substrate (Chico), Forkhead box O (FOXO), insulin-like peptide receptors (LOCM107679 and LOCM107370), Vgs (VgA/B), VgR and JHAMT were detected via RT-qPCR. The qPCR reactions were conducted in a total volume of 10 μL, comprising 1 μL of 5-fold diluted cDNA template, 0.4 μL each of forward and reverse primers, 5 μL of TB Green® Premix Ex Taq™ II (Tli RNaseH Plus) (Takara, Kusatsu, Japan), and 3.2 μL of ddH2O. The thermal cycling conditions were as follows: initial denaturation at 95 °C for 3 min, followed by 32 cycles of 95 °C for 30 s (denaturation), 54 °C for 30 s (annealing), and 72 °C for 10 s (extension). β-actin served as an internal reference gene, and relative gene expression levels were determined using the 2−∆∆CT method [23]. Each treatment consisted of three biological replicates with no fewer than five test insects per replicate.

2.4. Tissue-Specific Expression Analysis

To investigate the tissue-specific expression pattern of LmDDX3, five tissues—fat body, ovary, midgut, epidermis, and brain—were dissected from sexually mature female locusts. Each treatment contained three biological replicates, and each replicate contained five locusts. The tissues were immediately snap-frozen in liquid nitrogen and stored at −80 °C for subsequent total RNA extraction. The expression levels of LmDDX3 across different tissues were analyzed using RT-qPCR.

2.5. RNA Interference (RNAi)

To further investigate the function of LmDDX3, we used RNA interference (RNAi) technology to knockdown the expression of the target gene, and the green fluorescent protein (GFP) gene was used as a negative control. dsDDX3 (681 bp) and dsGFP (365 bp) were synthesized in vitro using the T7 RiboMAX Express RNAi System (Promega Corporation, Madison, WI, USA). The specific primers used for synthesizing dsRNA are listed in Table 1. We selected healthy, newly emerged female adults and injected each individual with 10 μL of double-stranded RNA at a concentration of 2000 ng/μL [24]. We ensured that no fewer than 45 individuals were injected in both the dsDDX3 group and the dsGFP control group. At 6 d post-injection, we collected the hemolymph, fat bodies, and ovaries. The hemolymph was used for sugar content analysis, while the fat bodies and ovaries were utilized to assess the expression levels of DDX3, key components of the IIS pathway, and reproduction-related genes. Ovarian development should be evaluated on the 8 d and 10 d after injection. For each experimental group, we assessed ovarian development in a minimum of 15 individuals. Ovarian morphology should be imaged using a dissecting stereomicroscope (Leica, Wetzlar, Germany), and the length and weight of each ovary should be systematically recorded.

2.6. Glycogen and Trehalose Determination

To determine the sugar content, hemolymph samples were collected at 6 d post-injection for subsequent analysis. Each experimental group consisted of three biological replicates, with five locusts selected per replicate. The samples were then stored at 4 °C and centrifuged at 1520× g for 20 min to pellet the blood cells. Following this, 5 μL of hemolymph was combined with 32 μL of phosphate-buffered saline (PBS) and 148 μL of 10% trichloroacetic acid, and the resulting mixture was used as the test sample.
For glycogen determination, 30 μL of serum or glucose standard was mixed with 600 μL of anthrone reagent, incubated at 90 °C for 10 min, and cooled on ice, and absorbance was measured at 620 nm [25]. For trehalose measurement, 30 μL of serum or trehalose standard was treated with 30 μL of 1% H2SO4, incubated at 90 °C for 10 min, and cooled in an ice bath for 3 min, followed by the addition of 30 μL of 30% KOH. The mixture was then incubated at 90 °C for another 10 min and cooled in an ice bath for 3 min, and subsequently 600 μL of developer was added. After a final incubation at 90 °C for 10 min, the mixture was cooled in an ice bath, and absorbance was measured at 630 nm [26].

2.7. Statistical Analysis

IBM SPSS Statistics 26.0 was employed for statistical analysis. Gene expression data from various tissues were analyzed using one-way analysis of variance followed by Duncan’s test (different lowercase letters above the bars indicate statistically significant differences). All other data were analyzed using Student’s t-test to determine significant differences between groups (* p < 0.05; ** p < 0.01; *** p < 0.001). Data are expressed as the mean ± standard error (SE) of three replicates. Graphical representations were created using GraphPad Prism 9.3.1 software (La Jolla, CA, USA).

3. Results

3.1. Bioinformatics of DDX3

In the DDX3 protein of L. migratoria, residues 189–437 encompass the N-terminal deconjugase domain of the DDX3-box deconjugase, while residues 442–573 contain the C-terminal deconjugase domain, both belonging to the sulfur difluoride deconjugase family (Figure S1). The DDX3 protein sequences of L. migratoria were compared with those from other species using BLAST from NCBI. Several sequences exhibiting the highest homology scores were selected, and a phylogenetic tree was constructed using MEGA version 10.2.6 (Figure 1). The results indicated that the DDX3 amino acid sequence of L. migratoria is more closely related to those of Schistocerca americana (XP_046991122.1) and Schistocerca nitens (XP_049802040.1).

3.2. Tissue Expression Patterns of DDX3

The tissue-specific expression pattern of DDX3 was analyzed in normally developing locusts, revealing significant variations in expression levels across different tissues (Figure 2). DDX3 transcript abundance was highest in the ovary, epidermis and brain, intermediate in the fat body, and lowest in the midgut, implying a preferential role in reproductive and other physiological processes.

3.3. Effect of RNAi on IIS and Sugar Content

The DDX3 in locusts was knocked down by injecting 20 μg of dsDDX3. The results demonstrated that DDX3 expression was significantly reduced in fat bodies (t = 12.861; df = 4; p < 0.001) of the experimental group (Figure 3A), confirming the effectiveness of the DDX3 interference.
After interfering with DDX3 expression, the expression levels of ILP (t = 4.325; df = 4; p < 0.05) and FOXO (t = 3.550; df = 4; p < 0.05) in the IIS pathway were significantly downregulated. Additionally, the expression of insulin-like peptide receptor genes InR1 (t = 5.384; df = 4; p < 0.01) and InR2 (t = 6.611; df = 4; p < 0.01) was markedly reduced (Figure 3B). These findings indicate that DDX3 modulates the expression of several genes associated with the IIS.
The sugar content serves as an indicator of the impact of DDX3 on energy metabolism in L. migratoria. To evaluate this effect, we measured the sugar levels in hemolymph samples collected from paired 6-day-old female locusts. Compared to the control group, the experimental group exhibited significantly lower trehalose levels (t = 4.778; df = 4; p < 0.01), with a decrease of about 27.6% (Figure 3C), and significantly reduced glycogen levels (t = 2.796; df = 4; p < 0.05), with a decrease of about 25.8% (Figure 3D).

3.4. Effects on Reproduction After RNAi of DDX3

The DDX3 in locusts was knocked down by injecting 20 μg of dsDDX3. The results demonstrated that DDX3 expression was significantly reduced in the ovaries (t = 6.441; df = 4; p < 0.01) of the experimental group (Figure 4A). JHAMT, VgA, VgB, VgR1 and VgR2 are critical genes involved in reproduction in L. migratoria. Following dsDDX3 injection, the expression levels of JHAMT (t = 7.235; df = 4; p < 0.01), VgA (t = 4.867; df = 4; p < 0.01) and VgB (t = 4.930; df = 4; p < 0.01) in ovaries were significantly downregulated, while those of VgR1 (t = 2.259; df = 4; p > 0.05) and VgR2 (t = 1.413; df = 4; p > 0.05) were downregulated but not to a statistically significant extent (Figure 4B).
To further investigate the impact of DDX3 on reproduction, we examined ovarian development in detail. In the paired 8-day control and experimental groups, it was observed that following DDX3 interference, the ovaries in the experimental group exhibited significantly reduced length (t = 7.529; df = 18; p < 0.001) (Figure 4C) and weight (t = 10.550; df = 16; p < 0.001) (Figure 4D). Additionally, the ovaries showed signs of underdevelopment, characterized by indistinct boundaries between sections and a lighter coloration in the paired 8 days (Figure 4E). When comparing the ovarian development of the paired 10-day control and experimental groups, significant reductions in ovary length (t = 5.884; df = 17; p < 0.001) (Figure 4E) and weight (t = 16.24; df = 15; p < 0.001) (Figure 4G) were also noted in the experimental group after DDX3 interference. While the control group displayed evident oocytes in the paired 10 days, the ovarian development in the experimental group resembled that of the control group at the 8-day pairing stage (Figure 4H).

4. Discussion

The IIS governs several life activities, including reproduction, longevity, and growth metabolism in insects [27,28]. The core function of DDX3 resides in protein translation. Human DDX3 participates in the translational process and physically interacts with the initiation factor eIF3 [29]. In Drosophila, Belle (the DDX3 ortholog) promotes the translation of specific target mRNAs, including cyclin B mRNA in an ATPase activity-dependent manner [30]. Several studies have demonstrated that DDX3 exerts both direct and indirect effects on insulin synthesis [18]. In Moushimi amaya, mass spectrometry analysis revealed the interaction between VEEV nsP3 and the host helicases DDX1 and DDX3 in infected cells, highlighting the synergistic effect between DDX3 and DDX [17]. Additionally, this study employed ultraviolet crosslinking RNA immunoprecipitation (UV-RIP) using an anti-DDX1 antibody, demonstrating that DDX1 binds directly to insulin mRNA [20,21]. Collectively, these findings suggest that the DEAD-box helicase family may serve as an upstream regulatory factor in the IIS, offering theoretical support for investigating how DDX3 modulates insect reproduction associated with this pathway.
Upon RNAi-mediated knockdown of DDX3, we analyzed the mRNA expression levels of key genes in the IIS. Interference with DDX3 resulted in a general downregulation of critical genes, including FOXO, ILP, InR1, and InR2 (Figure 3B), indicating that DDX3 plays a role in modulating the IIS. Furthermore, the IIS in insects is closely related to sugar content. In the IIS, FOXO plays a crucial role in regulating glucose levels and is involved in the transcriptional cascade that controls glucose metabolism [31,32] and gluconeogenesis [33]. The overexpression of FOXO in Bombyx mori led to a significant increase in hemolymph glucose and trehalose concentrations. In Hyphantria cunea, FOXO knockout resulted in reduced trehalose and glycogen levels. In addition, ILP silencing significantly reduced the trehalose content in Bemisia tabaci [34]. This is consistent with our findings. In our study, upon interfering with DDX3, the expression levels of FOXO and ILP in the IIS were markedly decreased. This reduction subsequently resulted in a highly significant decline in trehalose content and glycogen content in the hemolymph of female locusts (Figure 3C,D). These findings confirm that the IIS pathway is associated with DDX3 in L. migratoria.
The indispensable function of DDX3 in L. migratoria reproduction has been unequivocally established [17]. DDX3 is essential for female fertility by governing translational control during oogenesis. In Drosophila, Belle mutants exhibit female sterility and immature oocytes; likewise, oocyte-specific deletion of Ddx3x in mice also results in female infertility and impaired oogenesis [35]. Silencing DDX3 suppresses the expression of Vg, thereby impairing ovarian development in L. migratoria [36], which aligns with our findings (Figure 4). Wang et al. proposed that DDX3 promotes Vg expression—directly or indirectly—via a juvenile hormone-dependent modulation of Vg, thereby driving oocyte maturation and ovarian growth; however, they did not experimentally evaluate whether DDX3 influences JHAMT. Our results not only confirm that DDX3 governs locust fecundity through Vgs (VgA/B) but also provide the demonstration that RNAi-mediated silencing of DDX3 elicits a significant reduction in JHAMT transcript levels (Figure 4B). Collectively, these data establish that DDX3 can indirectly modulate Vg expression via its action on JHAMT. In the IIS, FOXO [37] and ILP [38,39] genes are closely associated with reproduction. In L. migratoria, FOXO interference severely reduced the trehalose content, thus greatly reducing the synthesis and uptake of Vg [40]. Similarly, in Sepiella japonica, the inhibition of ILP expression reduces the expression of Vg, indicating that ILP indirectly regulates reproduction by modulating vitellogenin [41]. These findings align with our observation that dsDDX3 interference in L. migratoria significantly downregulates the expression levels of FOXO and ILP genes within the IIS (Figure 3B). As discussed earlier, DDX3 influences the IIS. While we cannot exclude the involvement of other potential signaling molecules, the results of this study, combined with prior analyses, suggest that DDX3 regulates reproduction in L. migratoria associated with the IIS, potentially contributing to a reduction in locust population density.
Additionally, we present a model that elucidates how DDX3 further regulates reproduction in locusts associated with the IIS pathway (Figure 5). The DDX helicase family plays a crucial role in cellular RNA metabolism, from transcriptional regulation to translation initiation [42]. Among the DDX proteins, DDX1 can directly interact with insulin mRNA [21], while DDX3 exhibits a synergistic effect with DDX1 [20]. In insects, the IIS has been thoroughly studied. When DDX3 is silenced, the expression of ILP in the insulin signaling pathway is first inhibited, reducing the expression of the downstream Chico gene and subsequently suppressing the expression of FOXO [43]. InR functions as a pivotal upstream regulator of FOXO within the IIS pathway. In our parallel study, RNAi-mediated silencing of InR in L. migratoria phenocopied the reproductive deficits observed upon DDX3 knockdown; InR downregulation markedly repressed VgA/VgB transcription and consequently retarded ovarian maturation. In L. migratoria and other insects, the insulin/PI3K–AKT–TOR cascade phosphorylates and cytosolically retains FOXO. RNAi-mediated silencing of InR or forced activation of FOXO (by starvation or transgenic RNAi) drives FOXO into the nucleus, where it represses JHAMT transcription, suppresses juvenile hormone biosynthesis and consequently arrests oocyte maturation [44]. Kr-h1 functions as an obligate mediator of JH-induced Vg synthesis and oocyte maturation. JHAMT governs Kr-h1 expression by dictating endogenous JH titer, and Kr-h1 in turn directly trans-activates Vg transcription. Consequently, the JHAMT–JH–Kr-h1 axis constitutes a core regulatory module coupling Vg production to ovarian development [45,46]. Combined with our prior research, the Hippo signaling pathway represents a critical target for FOXO transcription factors. We propose that DDX3 further regulates the transcription of Vg/VgRs by modulating JHAMT-Kr-h1 and the Hippo-Notch signaling pathway via ILP-InR-FOXO, which are target genes of the IIS pathway, thereby ultimately influencing locust reproduction.
This study proposes the regulatory pathways of DDX3 in modulating IIS-mediated reproduction, which is conducive to supplementing and improving the potential mechanism of DDX3 affecting insect reproductive development. Moreover, the exceptional fecundity of L. migratoria is a primary driver of its devastating outbreaks; our findings therefore furnish a strengthened theoretical framework for exploiting DDX3 as a molecular leverage point in locust-management strategies. Accumulated evidence has established that chitosan nanoparticles (CNPs) substantially enhance RNA-interference efficiency in Locusta migratoria. Beyond chitosan, alternative platforms—including protamine–lipid hybrid particles (PS/CF), zeolitic imidazolate framework-8@polydopamine (ZIF-8@PDA), and layered double-hydroxide (LDH) clay nanosheets—have achieved notable success in other pest systems and merit evaluation for locust control [47]. In subsequent studies, we will further investigate the application of dsDDX3-loaded nanoparticles for locust control and evaluate their stability and toxicological profiles in vivo in locusts. Furthermore, integrating our previous findings, we posit that DDX3 engages in locust reproduction via the regulation of pivotal IIS-pathway genes such as InR and FOXO, thereby completing the putative regulatory circuitry through which DDX3 modulates reproductive processes.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/insects17020206/s1. Figure S1: Bioinformatics analysis of DDX3.

Author Contributions

Y.J.: Writing—original draft preparation, Validation, Investigation, Data curation. J.X.: Writing—original draft preparation, Investigation, Data curation. Z.Y.: Investigation. H.Z.: Supervision. S.Y.: Conceptualization. Y.W.: Data curation. B.T.: Formal analysis. J.T.: Writing—review and editing, Methodology, Investigation. S.W.: Writing—review and editing, Methodology, Investigation, Formal analysis. Y.J. and J.X. have contributed equally to this work. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the National Natural Science Foundation of China (Grant Nos. 30970473 and 31270459) and the National College Students Innovation and Entrepreneurship Training Program (Grant Number 202410346019).

Data Availability Statement

The dataset used is available on request from the authors. The raw data supporting the conclusions of this article will be made available by the authors on request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Sangbaramou, R.; Camara, I.; Huang, X.Z.; Shen, J.; Tan, S.Q.; Shi, W.P. Behavioral thermoregulation in Locusta migratoria manilensis in response to the entomopathogenic fungus, Beauveria bassiana. PLoS ONE 2018, 13, e0206816. [Google Scholar] [CrossRef] [PubMed]
  2. Zhang, L.; Lecoq, M.; Latchininsky, A.; Hunter, D. Locust and grasshopper management. Annu. Rev. Entomol. 2019, 64, 15–34. [Google Scholar] [CrossRef]
  3. Zhang, J.; Liu, X.; Zhang, J.; Li, D.; Sun, Y.; Guo, Y.; Ma, E.; Zhu, K.Y. Silencing of two alternative splicing-derived mRNA variants of chitin synthase 1 gene by RNAi is lethal to the oriental migratory locust, Locusta migratoria manilensis. Insect Biochem. Mol. Biol. 2010, 40, 824–833. [Google Scholar] [CrossRef]
  4. Ye, S.; Lu, S.; Bai, X.; Gu, J. ResNet-Locust-BN network-based automatic identification of east asian migratory locust species and instars from RGB images. Insects 2020, 11, 458. [Google Scholar] [CrossRef] [PubMed]
  5. Bernstein, E.; Caudy, A.A.; Hammond, S.M.; Hannon, G.J. Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 2001, 409, 363–366. [Google Scholar] [CrossRef]
  6. Yan, S.; Ren, B.; Zeng, B.; Shen, J. Improving RNAi efficiency for pest control in crop species. Bio Tech. 2020, 68, 283–290. [Google Scholar] [CrossRef] [PubMed]
  7. Hough, J.; Howard, J.D.; Brown, S.; Portwood, D.E.; Kilby, P.M.; Dickman, M.J. Strategies for the production of dsRNA biocontrols as alternatives to chemical pesticides. Front. Bioeng. Biotechnol. 2022, 10, 980592. [Google Scholar] [CrossRef]
  8. Salminen, A.; Kaarniranta, K.; Kauppinen, A. Insulin/IGF-1 signaling promotes immunosuppression via the STAT3 pathway: Impact on the aging process and age-related diseases. Inflamm. Res. 2021, 70, 1043–1061. [Google Scholar] [CrossRef]
  9. Hansen, I.A.; Attardo, G.M.; Rodriguez, S.D.; Drake, L.L. Four-way regulation of mosquito yolk protein precursor genes by juvenile hormone-, ecdysone-, nutrient-, and insulin-like peptide signaling pathways. Front. Physiol. 2014, 5, 103. [Google Scholar] [CrossRef]
  10. Hsu, H.J.; Drummond-Barbosa, D. Insulin signals control the competence of the Drosophila female germline stem cell niche to respond to Notch ligands. Dev. Biol. 2011, 350, 290–300. [Google Scholar] [CrossRef]
  11. Zeng, B.; Huang, Y.; Xu, J.; Shiotsuki, T.; Bai, H.; Palli, S.R.; Huang, Y.; Tan, A. The FOXO transcription factor controls insect growth and development by regulating juvenile hormone degradation in the silkworm, Bombyx mori. J. Biol. Chem. 2017, 292, 11659–11669. [Google Scholar] [CrossRef] [PubMed]
  12. Veenstra, J.A.; Leyria, J.; Orchard, I.; Lange, A.B. Identification of Gonadulin and Insulin-Like Growth factor from migratory locusts and their importance in reproduction in Locusta migratoria. Front. Endocrinol. 2021, 12, 693068. [Google Scholar] [CrossRef] [PubMed]
  13. Wang, S.; Liu, X.; Xia, Z.; Xie, G.; Tang, B.; Wang, S. Transcriptome analysis of the molecular mechanism underlying immunity- and reproduction trade-off in Locusta migratoria infected by Micrococcus luteus. PLoS ONE 2019, 14, e0211605. [Google Scholar] [CrossRef] [PubMed]
  14. Wang, J.; Zhang, X.; Deng, S.; Ma, E.; Zhang, J.; Xing, S. Molecular characterization and RNA interference analysis of the DEAD-box gene family in Locusta migratoria. Gene 2020, 728, 144297. [Google Scholar] [CrossRef]
  15. Rocak, S.; Linder, P. DEAD-box proteins: The driving forces behind RNA metabolism. Nat. Rev. Mol. Cell Biol. 2004, 5, 232–241. [Google Scholar] [CrossRef]
  16. Soto-Rifo, R.; Rubilar, P.S.; Limousin, T.; de Breyne, S.; Décimo, D.; Ohlmann, T. DEAD-box protein DDX3 associates with eIF4F to promote translation of selected mRNAs. EMBO J. 2012, 31, 3745–3756. [Google Scholar] [CrossRef]
  17. Wang, J.; Li, T.; Deng, S.; Ma, E.; Zhang, J.; Xing, S. The RNA helicase DDX3 is required for ovarian development and oocyte maturation in Locusta migratoria. Arch. Insect Biochem. Physiol. 2021, 106, e21775. [Google Scholar] [CrossRef]
  18. Poulton, J.S.; Huang, Y.C.; Smith, L.; Sun, J.; Leake, N.; Schleede, J.; Stevens, L.M.; Deng, W.M. The microRNA pathway regulates the temporal pattern of Notch signaling in Drosophila follicle cells. Development 2011, 138, 1737–1745. [Google Scholar] [CrossRef]
  19. Vong, Q.P.; Li, Y.; Lau, Y.F.; Dym, M.; Rennert, O.M.; Chan, W.Y. Structural characterization and expression studies of Dby and its homologs in the mouse. J. Androl. 2006, 27, 653–661. [Google Scholar] [CrossRef]
  20. Amaya, M.; Brooks-Faulconer, T.; Lark, T.; Keck, F.; Bailey, C.; Raman, V.; Narayanan, A. Venezuelan equine encephalitis virus non-structural protein 3 (nsP3) interacts with RNA helicases DDX1 and DDX3 in infected cells. Antivir. Res. 2016, 131, 49–60. [Google Scholar] [CrossRef]
  21. Li, Z.; Zhou, M.; Cai, Z.; Liu, H.; Zhong, W.; Hao, Q.; Cheng, D.; Hu, X.; Hou, J.; Xu, P.; et al. RNA-binding protein DDX1 is responsible for fatty acid-mediated repression of insulin translation. Nucleic Acids Res. 2018, 46, 12052–12066. [Google Scholar] [CrossRef]
  22. Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar] [CrossRef]
  23. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef]
  24. Wang, Y.L.; Yang, M.L.; Jiang, F.; Zhang, J.Z.; Kang, L. MicroRNA-dependent development revealed by RNA interference-mediated gene silencing of LmDicer1 in the migratory locust. Insect Sci. 2013, 20, 53–60. [Google Scholar] [CrossRef]
  25. Mollaei, M.; Izadi, H.; Moharramipour, S.; Behroozi Moghadam, E. Physiology of hibernating larvae of the pistachio twig borer, Kermania pistaciella Amsel (Lepidoptera: Tineidae), collected from Akbari Cultivar of Pistacia vera L. Neotrop. Entomol. 2017, 46, 58–65. [Google Scholar] [CrossRef]
  26. Wang, S.S.; Li, G.Y.; Liu, Y.K.; Luo, Y.J.; Xu, C.D.; Li, C.; Tang, B. Regulation of carbohydrate metabolism by trehalose-6-phosphate synthase 3 in the brown planthopper, Nilaparvata lugens. Front. Physiol. 2020, 11, 575485. [Google Scholar] [CrossRef] [PubMed]
  27. Murphy, C.T.; Hu, P.J. Insulin/insulin-like growth factor signaling in C. elegans. In WormBook: The Online Review of C. elegans Biology; National Library of Medicine: Pasadena, CA, USA, 2013; pp. 1–43. [Google Scholar] [CrossRef]
  28. Nässel, D.R.; Liu, Y.; Luo, J. Insulin/IGF signaling and its regulation in Drosophila. Gen. Comp. Endocrinol. 2015, 221, 255–266. [Google Scholar] [CrossRef] [PubMed]
  29. Lee, C.S.; Dias, A.P.; Jedrychowski, M.; Patel, A.H.; Hsu, J.L.; Reed, R. Human DDX3 functions in translation and interacts with the translation initiation factor eIF3. Nucleic Acids Res. 2008, 36, 4708–4718. [Google Scholar] [CrossRef] [PubMed]
  30. Liao, S.E.; Kandasamy, S.K.; Zhu, L.; Fukunaga, R. DEAD-box RNA helicase Belle posttranscriptionally promotes gene expression in an ATPase activity-dependent manner. RNA 2019, 25, 825–839. [Google Scholar] [CrossRef]
  31. Furuyama, T.; Yamashita, H.; Kitayama, K.; Higami, Y.; Shimokawa, I.; Mori, N. Effects of aging and caloric restriction on the gene expression of Foxo1, 3, and 4 (FKHR, FKHRL1, and AFX) in the rat skeletal muscles. Microsc. Res. Tech. 2002, 59, 331–334. [Google Scholar] [CrossRef]
  32. Kousteni, S. FoxO1, the transcriptional chief of staff of energy metabolism. Bone 2012, 50, 437–443. [Google Scholar] [CrossRef]
  33. van der Horst, A.; Burgering, B.M. Stressing the role of FoxO proteins in lifespan and disease. Nat. Rev. Mol. Cell Biol. 2007, 8, 440–450. [Google Scholar] [CrossRef]
  34. Xu, H.; Zhang, Z.; Zhang, Z.; Peng, J.; Gao, Y.; Li, K.; Chen, J.; Du, J.; Yan, S.; Zhang, D.; et al. Effects of insulin-like peptide 7 in Bemisia tabaci MED on tomato chlorosis virus transmission. Pest Manag. Sci. 2023, 79, 1508–1517. [Google Scholar] [CrossRef]
  35. Tsai, S.Y.; Lin, C.H.; Jiang, Y.T.; Huang, G.J.; Pi, H.; Hung, H.Y.; Tarn, W.Y.; Lai, M.C. DDX3 is critical for female fertility via translational control in oogenesis. Cell Death Discov. 2024, 10, 472. [Google Scholar] [CrossRef]
  36. Roy, S.; Saha, T.T.; Zou, Z.; Raikhel, A.S. Regulatory pathways controlling female insect reproduction. Annu. Rev. Entomol. 2018, 63, 489–511. [Google Scholar] [CrossRef]
  37. Ge, H.; Wei, J.; Guan, D.; Wang, Z.; Li, H.; Zhang, H.; Qian, K.; Wang, J. Elongator subunit Elp3 regulates reproduction in Tribolium castaneum by interacting with FOXO. Insect Sci. 2025; online. [Google Scholar] [CrossRef] [PubMed]
  38. Wu, Q.; Brown, M.R. Signaling and function of insulin-like peptides in insects. Annu. Rev. Entomol. 2006, 51, 1–24. [Google Scholar] [CrossRef]
  39. Ling, L.; Raikhel, A.S. Amino acid-dependent regulation of insulin-like peptide signaling is mediated by TOR and GATA factors in the disease vector mosquito Aedes aegypti. Proc. Natl. Acad. Sci. USA 2023, 120, e2303234120. [Google Scholar] [CrossRef]
  40. Xu, J.; Yuan, Z.; Zhao, H.; Wu, X.; Cai, N.; Ma, T.; Tang, B.; Chen, G.; Wang, S. RNAi-mediated FoxO silencing inhibits reproduction in Locusta migratoria. Insects 2024, 15, 891. [Google Scholar] [CrossRef] [PubMed]
  41. Lü, Z.; Yao, C.; Zhao, S.; Zhang, Y.; Gong, L.; Liu, B.; Liu, L. Characterization of insulin-like peptide (ILP) and its potential role in ovarian development of the cuttlefish Sepiella japonica. Curr. Issues Mol. Biol. 2022, 44, 2490–2504. [Google Scholar] [CrossRef] [PubMed]
  42. Cargill, M.; Venkataraman, R.; Lee, S. DEAD-box RNA helicases and genome stability. Genes 2021, 12, 1471. [Google Scholar] [CrossRef] [PubMed]
  43. Huangfu, N.; Zhu, X.; Wang, L.; Zhang, K.; Li, D.; Chen, L.; Gao, X.; Niu, L.; Gao, M.; Ji, J.; et al. Insulin receptor substrate-1 (IRS1) regulates oogenesis and vitellogenesis in Propylea japonica by mediating the FOXO transcription factor expression, independent of JHAMT and 20E signaling pathways. J. Agric. Food Chem. 2023, 71, 300–310. [Google Scholar] [CrossRef] [PubMed]
  44. Wu, Z.; Yang, L.; He, Q.; Zhou, S. Regulatory mechanisms of vitellogenesis in insects. Front. Cell Dev. Biol. 2021, 8, 593613. [Google Scholar] [CrossRef] [PubMed]
  45. Song, J.; Li, W.; Gao, L.; Yan, Q.; Zhang, X.; Liu, M.; Zhou, S. miR-276 and miR-182013-5p modulate insect metamorphosis and reproduction via dually regulating juvenile hormone acid methyltransferase. Commun. Biol. 2024, 7, 1604. [Google Scholar] [CrossRef]
  46. Kayukawa, T.; Jouraku, A.; Ito, Y.; Shinoda, T. Molecular mechanism underlying juvenile hormone-mediated repression of precocious larval-adult metamorphosis. Proc. Natl. Acad. Sci. USA 2017, 114, 1057–1062. [Google Scholar] [CrossRef]
  47. Liu, J.; He, Q.; Lin, X.; Smagghe, G. Recent progress in nanoparticle-mediated RNA interference in insects: Unveiling new frontiers in pest control. J. Insect Physiol. 2025, 167, 104884. [Google Scholar] [CrossRef]
Insects 17 00206 g001
Figure 1. Phylogenetic tree analysis of DDX3. Red circle indicates the DDX3 protein sequence from Locusta migratoria identified in this study. Numbers on branches represents bootstrap support values (%) from 1000 replicates, indicating the reliability of each node.
Figure 1. Phylogenetic tree analysis of DDX3. Red circle indicates the DDX3 protein sequence from Locusta migratoria identified in this study. Numbers on branches represents bootstrap support values (%) from 1000 replicates, indicating the reliability of each node.
Insects 17 00206 g001
Insects 17 00206 g002
Figure 2. Relative expression of DDX3 in different tissues. Relative expression levels of LmDDX3 in various tissues of female adults 6 days post-emergence, including fat body, ovary, midgut, epidermis, and brain. Each value is presented as mean ± SE. Lowercase letters above the error bars indicate significant differences among the tissues (Duncan’s test, p < 0.05). Each group includes three biological replicates, with each replicate consisting of no fewer than five individuals.
Figure 2. Relative expression of DDX3 in different tissues. Relative expression levels of LmDDX3 in various tissues of female adults 6 days post-emergence, including fat body, ovary, midgut, epidermis, and brain. Each value is presented as mean ± SE. Lowercase letters above the error bars indicate significant differences among the tissues (Duncan’s test, p < 0.05). Each group includes three biological replicates, with each replicate consisting of no fewer than five individuals.
Insects 17 00206 g002
Insects 17 00206 g003
Figure 3. Changes in IIS and sugar content after RNAi of DDX3 gene in L. migratoria. (A) Effects of RNAi on the fat bodies of L. migratoria. (B) Impact of dsDDX3 injection on the expressions of reproduction-related genes, including ILP (Insulin-like peptides), Chico (Insulin receptor substrate), FOXO (Forkhead box O), InR1 (LOCM107679) and InR2 (LOCM107370). InR1 and InR2 are insulin-like peptide receptors that function as paralogs of the canonical insulin receptor. The fat body 6 days after dsRNA injection was selected as the experimental material. (C) Changes in trehalose in L. migratoria after RNAi. The hemolymph 6 days after dsRNA injection was selected as the experimental material. (D) Changes in total glycogen in L. migratoria after RNAi. The hemolymph 6 days after dsRNA injection was selected as the experimental material. Each experimental group consisted of three biological replicates with a minimum of five locusts per replicate. Each value is presented as mean ± SE, and * denotes a significant difference between the two groups (Student’s t-test; “*” p < 0.05, “**” p < 0.01 and “***” p < 0.001).
Figure 3. Changes in IIS and sugar content after RNAi of DDX3 gene in L. migratoria. (A) Effects of RNAi on the fat bodies of L. migratoria. (B) Impact of dsDDX3 injection on the expressions of reproduction-related genes, including ILP (Insulin-like peptides), Chico (Insulin receptor substrate), FOXO (Forkhead box O), InR1 (LOCM107679) and InR2 (LOCM107370). InR1 and InR2 are insulin-like peptide receptors that function as paralogs of the canonical insulin receptor. The fat body 6 days after dsRNA injection was selected as the experimental material. (C) Changes in trehalose in L. migratoria after RNAi. The hemolymph 6 days after dsRNA injection was selected as the experimental material. (D) Changes in total glycogen in L. migratoria after RNAi. The hemolymph 6 days after dsRNA injection was selected as the experimental material. Each experimental group consisted of three biological replicates with a minimum of five locusts per replicate. Each value is presented as mean ± SE, and * denotes a significant difference between the two groups (Student’s t-test; “*” p < 0.05, “**” p < 0.01 and “***” p < 0.001).
Insects 17 00206 g003
Insects 17 00206 g004
Figure 4. Expression of reproduction-related indices after RNAi of DDX3 in L. migratoria. (A) Effects of RNAi on the ovaries of L. migratoria. (B) Effects of RNAi on the expression of reproduction-related genes of L. migratoria. The ovary 6 days after dsRNA injection was selected as the experimental material. (C,D) Ovarian length and weight were measured in each group 8 days after dsRNA injection (n = 15). (E) Macroscopic comparison of the control group and the experimental group of the 8-day-old ovaries. (F,G) Ovarian length and weight were measured in each group 10 days after dsRNA injection (n = 15). (H) Macroscopic comparison of the control group and the experimental group of the 10-day-old ovaries. Each experimental group consisted of three biological replicates with a minimum of five locusts per replicate. Each value is presented as mean ± SE, and asterisk denotes a significant difference between the two groups (Student’s t-test; “**” p < 0.01, and “***” p < 0.001).
Figure 4. Expression of reproduction-related indices after RNAi of DDX3 in L. migratoria. (A) Effects of RNAi on the ovaries of L. migratoria. (B) Effects of RNAi on the expression of reproduction-related genes of L. migratoria. The ovary 6 days after dsRNA injection was selected as the experimental material. (C,D) Ovarian length and weight were measured in each group 8 days after dsRNA injection (n = 15). (E) Macroscopic comparison of the control group and the experimental group of the 8-day-old ovaries. (F,G) Ovarian length and weight were measured in each group 10 days after dsRNA injection (n = 15). (H) Macroscopic comparison of the control group and the experimental group of the 10-day-old ovaries. Each experimental group consisted of three biological replicates with a minimum of five locusts per replicate. Each value is presented as mean ± SE, and asterisk denotes a significant difference between the two groups (Student’s t-test; “**” p < 0.01, and “***” p < 0.001).
Insects 17 00206 g004
Insects 17 00206 g005
Figure 5. The regulatory prediction of DDX3 and the IIS on the reproduction pathways of L. migratoria. DDX3 affects the expression of insulin receptor substrate (IRS/Chico) via insulin-like peptide (ILP) and insulin-like peptide receptor (InR), and subsequently acting on the key transcription factor FOXO downstream of the insulin signaling pathway. FOXO modulates the transcription of Vg/VgRs via the Hippo-Notch signaling cascade and JHAMT, ultimately affecting locust reproduction. PI3K: Phosphoinositide 3-Kinase; PIP2: Phosphatidylinositol 4,5-bisphosphate; PIP3: Phosphatidylinositol 3,4,5-trisphosphate; PDK: Phosphoinositide-dependent kinase-1; AKT: Protein Kinase B; Kr-h1: Krüppel homolog 1.
Figure 5. The regulatory prediction of DDX3 and the IIS on the reproduction pathways of L. migratoria. DDX3 affects the expression of insulin receptor substrate (IRS/Chico) via insulin-like peptide (ILP) and insulin-like peptide receptor (InR), and subsequently acting on the key transcription factor FOXO downstream of the insulin signaling pathway. FOXO modulates the transcription of Vg/VgRs via the Hippo-Notch signaling cascade and JHAMT, ultimately affecting locust reproduction. PI3K: Phosphoinositide 3-Kinase; PIP2: Phosphatidylinositol 4,5-bisphosphate; PIP3: Phosphatidylinositol 3,4,5-trisphosphate; PDK: Phosphoinositide-dependent kinase-1; AKT: Protein Kinase B; Kr-h1: Krüppel homolog 1.
Insects 17 00206 g005
Table 1. Primers for PCR.
Table 1. Primers for PCR.
Primer NameF-Primer Sequence (5′-3′)R-Primer Sequence (5′-3′)GenBank
FOXOGAACTCGATCCGGCATAACCCGCCTCCACCTTCTTCTTGMN427928.1
Lm-VgACTCTTTCGTCCAACAGCCGCTCGCAACCATTCCCTTCAKF171066.3
Lm-VgBGAACTCAAGGGTCGTGGCATGGGTGAAGCAGCGGAATKX709496.1
Lm-VgR1ATAAAGGTCTACCATCCAGCCCGACAGGCACAGGTGAGGAGTTKF377827.1
Lm-VgR2GGCAAAAGGGATCACTCGAGCCACCATCAGCCCAAAATLOCMI16155
Lm-JHAMTCGTGTGAGACTGTGAGGGAGGTATTACGCTGATGGACGAU74469.1
ILPTTCCTCCTGTCGCCCAAACGAGCTTGAGCGCATTX17024.1
InRGCGATGTGCYRTYAAGACTGGCTTTCTGGTGCCATCCAMZ160906.1
InR1AAGCAAGAAGGTTCGCA
TCA		AGTCAGGGTCCAGCCAT
AGAG		LOCMI07679
InR2CGGCAACAACCTCTTCTTCAAGGATGTCCGTCAGCGAGTGLOCMI07370
DDX3GCTGGTCTGGACTTGGACCGCCGCTGTATTCTGTMN427928.1
β-actinGACGAAGAAGTTGCCGCTC TCCCATTCCCACCATCACAKC118986
dsDDX3TAATACGACTCACTATAGGGAGATGAGCAAGTGAGAGACCTGGTAATACGACTCACTATAGGGAGACCTGTGCGACCAATACGATGMN427928.1
dsGFPTAATACGACTCACTATAGGGAAGGGCGAGGAGCTGTTCACCGTAATACGACTCACTATAGGGCAGCAGGACCATGTGATCGCGCL29345.1
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Jin, Y.; Xu, J.; Yuan, Z.; Zhao, H.; Yang, S.; Wang, Y.; Tang, B.; Tian, J.; Wang, S. DDX3 Regulates Reproduction in Locusta migratoria Potentially via Insulin/Insulin-like Growth Factor Signaling. Insects 2026, 17, 206. https://doi.org/10.3390/insects17020206

AMA Style

Jin Y, Xu J, Yuan Z, Zhao H, Yang S, Wang Y, Tang B, Tian J, Wang S. DDX3 Regulates Reproduction in Locusta migratoria Potentially via Insulin/Insulin-like Growth Factor Signaling. Insects. 2026; 17(2):206. https://doi.org/10.3390/insects17020206

Chicago/Turabian Style

Jin, Yi, Jiaying Xu, Zeming Yuan, Huazhang Zhao, Shijia Yang, Yutong Wang, Bin Tang, Junce Tian, and Shigui Wang. 2026. "DDX3 Regulates Reproduction in Locusta migratoria Potentially via Insulin/Insulin-like Growth Factor Signaling" Insects 17, no. 2: 206. https://doi.org/10.3390/insects17020206

APA Style

Jin, Y., Xu, J., Yuan, Z., Zhao, H., Yang, S., Wang, Y., Tang, B., Tian, J., & Wang, S. (2026). DDX3 Regulates Reproduction in Locusta migratoria Potentially via Insulin/Insulin-like Growth Factor Signaling. Insects, 17(2), 206. https://doi.org/10.3390/insects17020206

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop