Next Article in Journal
Molecular Detection and Analysis of Trypanosoma (Megatrypanum) spp. Diversity in Tabanidae (Diptera) Collected in Lithuania
Previous Article in Journal
Characterization of the Spatial Distribution of the Pepper Weevil, Anthonomus eugenii Cano (Col.: Curculionidae), in Pepper Fields in South Florida
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

A New Endemic Locality of Dermacentor reticulatus in Central–Southern Poland and Its Potential Epidemiological Implications

by
Marek Asman
1,*,
Katarzyna Bartosik
2,*,
Justyna Jakubas-Zawalska
3,
Agata Świętek
1,4 and
Joanna Witecka
5
1
Department of Medical and Molecular Biology, Faculty of Medical Sciences in Zabrze, Medical University of Silesia in Katowice, Jordana 19 St., 41-808 Zabrze, Poland
2
Department of Biology and Parasitology, Chair of Pharmacology and Biology, Faculty of Health Sciences, Medical University of Lublin, Radziwiłłowska 11 St., 20-080 Lublin, Poland
3
Sanitary-Epidemiological Station in Świnoujście, Dąbrowskiego 4 St., 72-600 Świnoujście, Poland
4
Silesia LabMed Research and Implementation Centre, Medical University of Silesia in Katowice, 19 Jordana St., 41-808 Zabrze, Poland
5
Department of Parasitology, Faculty of Pharmaceutical Sciences in Sosnowiec, Medical University of Silesia in Katowice, Jedności 8 St., 41-218 Sosnowiec, Poland
*
Authors to whom correspondence should be addressed.
Insects 2024, 15(8), 580; https://doi.org/10.3390/insects15080580
Submission received: 2 July 2024 / Revised: 28 July 2024 / Accepted: 29 July 2024 / Published: 30 July 2024
(This article belongs to the Section Medical and Livestock Entomology)

Simple Summary

Dermacentor reticulatus is an arthropod vector with great medical and veterinary importance. Its wide distribution and biological characteristics determine its important role in the circulation of pathogens in the parasite–host system. Its occurrence range is divided into western and eastern populations, which are separated from each other by the so-called Dermacentor-free zone localized in central Poland. This study aimed to estimate the potential epidemiological significance of D. reticulatus in the new endemic focus west of the Vistula River (Upper Silesia, central–southern Poland) and its co-occurrence with Ixodes ricinus. The molecular studies revealed the presence of Rickettsia spp. in 23.8% of the D. reticulatus specimens. In turn, 94.1% of the I. ricinus adults were infected with B. burgdorferi s.l., 11.7% with Babesia spp., and 5.8% with Rickettsia spp. Polymicrobial infections were noted in 17.6% of the I. ricinus. Our finding emphasizes the risk of infestation by both tick species and the risk of tick-borne infections in an area previously thought to be free of Dermacentor ticks. It is necessary to enhance medical and veterinary services for the more efficient diagnosis and prevention of tick-borne diseases in this region.

Abstract

Dermacentor reticulatus (Acari: Ixodidae) is an important arthropod vector in medical and veterinary contexts. Its geographic range is divided into western and eastern populations separated by a “Dermacentor-free zone” in central Poland. Recent faunistic studies showed a new endemic locality of the species in Upper Silesia to the west of the Vistula River (central–southern Poland) and its co-occurrence with I. ricinus. The prevalence of five tick-borne pathogens (TBPs), e.g., B. burgdorferi s.l., Bartonella spp., Rickettsia spp., and Babesia spp., in the ticks was assessed with polymerase chain reaction (PCR) methods. The molecular studies revealed the presence of Rickettsia spp. in 23.8% of the D. reticulatus specimens. In turn, 94.1% of the I. ricinus adults were infected with B. burgdorferi s.l., 11.7 % with Babesia spp., and 5.8% with Rickettsia spp. Coinfections with two TBPs were noted in 17.6% of the I. ricinus. These findings highlight not only the risk of infestation by both tick species in an area previously considered Dermacentor-free, but also the high prevalence of TBPs in the study area. Increased focus on medical and veterinary services appears necessary to diagnose and prevent tick-borne diseases in this region.

1. Introduction

Currently, 19 species of ticks are permanent elements of the Polish acarofauna [1]. After Ixodes ricinus (Linnaeus, 1758), Dermacentor reticulatus (Fabricius, 1794) is the tick species with the second-greatest epidemiological importance [1,2,3]. There are numerous reports on the sympatric occurrence of these species in Poland [4,5,6,7,8]. Dermacentor reticulatus inhabits mainly wet mixed forests, meadows, and scrub communities. This tick species is most common in meadows near forest borders and wet forests associated with river valleys, lake shores, and ravine systems. It also occurs in deciduous forests, clearings, forest meadows, and in forest steppes [1,2,9]. There are also literature reports on D. reticulatus occurrence in areas with a high degree of anthropopressure [4,6,10,11,12]. Dermacentor reticulatus is known to be a competent vector of, e.g., tick-borne encephalitis virus (TBEV), Omsk hemorrhagic fever virus, and spotted fever group (SFG) rickettsia, e.g., Rickettsia raoultii and Rickettsia slovaca, Babesia canis, Babesia caballi, and Theileria equi, [9,13,14].
The occurrence of various tick species in recently invaded areas is increasingly being observed [15,16,17,18]. Progressive climate change is probably one of the main factors responsible for the changes in their geographic distribution range [15,16,19,20]. Additionally, the loss of forest areas, fluctuations in host population numbers, changes in agricultural land use, and human activity are potential determinants as well [2,21,22]. The shift in the distribution range is particularly evident in the case of D. reticulatus, which is gradually being recorded in areas that separate the eastern from western populations of this tick in Europe. Recently, many new endemic areas of the occurrence of this species to the west of the Vistula River have been described in Poland [17,23,24]. Therefore, to protect human and animal health in accordance with the One Health concept, the constant tick expansion and the emergence of new tick-borne disease foci should be monitored. The aim of this study was to estimate the potential epidemiological significance of D. reticulatus occurring in a new endemic area in Upper Silesia, central–southern Poland, taking into account its co-occurrence with I. ricinus.

2. Materials and Methods

2.1. Tick Collection and Study Site

Ticks were collected from vegetation in mid-April 2023 with the flagging method [1] between 11.00 a.m. and 1.00 p.m. in selected areas of Sławków (50°30′19.8″ N; 19°40′72.6″ E) 329 m a.s.l. (Upper Silesia, central–southern Poland). The flagging method was used for at least 1 h by one person at each study site. Both an open landscape, e.g., a meadow located close to a mixed forest, and an ecotone near the forest border were the collection sites. The ticks were collected in four plots with a total area of 51 ha located near areas protected under the Natura 2000 Łąki w Sławkowie program PLH 240043. The areas comprise a mosaic of meadow habitats, including Molinia meadows, fresh meadows, and wetlands dominated by meadow communities of the orders Molinietalia and Arrhenatheretalia characterized by a very rich flora composition. The most valuable natural communities from the Molinion alliance cover an area of approximately 28.6% of the meadow complex. The valuable natural areas in Sławków, e.g., the ecological corridors of the Biała Przemsza valley, the Sławkowska Struga valley, the Bobrek spring area, small natural marsh areas, and wetlands formed during the construction of rope park facilities, are protected under the provisions of the Nature Protection Act [25].
The tick specimens were placed in the sterile 50 mL polypropylene tubes and stored in 70% ethyl alcohol. Next, the species, developmental stage, and sex of the ticks were identified under the Olympus SZ-40 binocular microscope (Tokyo, Japan) according to the guides to tick identification developed by Siuda [26] and Nowak-Chmura [1]. The risk of tick attacks was assessed using a 5-classed scale proposed by Supergan and Karbowiak [27].

2.2. Molecular Analyses

Individual tick specimens were rinsed sequentially in 70% ethanol and sterile ultrapure water to prevent DNA contamination and homogenized using sterile garnet sharp particles, 0.3 mm in diameter (Tissue Grinding Tool, Eurix, Gdańsk, Poland). DNA was isolated from single ticks with the ammonia method [28], and its concentration was measured spectrophotometrically at the 260/280 wavelength using the Implen NanoPhotometer PEARL (Munich, Germany). Then, the samples were frozen at −20 °C and stored for further molecular studies. Tick-borne pathogens (TBPs) were detected in DNA isolates obtained from a single tick with the real-time PCR, PCR, and nested PCR methods. To detect B. burgdorferi s.l., real-time PCR analysis was performed using the EURx Borrelia qPCR Detection Kit (Gdańsk, Poland) according to the manufacturer’s protocol. The nested PCR and PCR methods were used for the detection of A. phagocytophilum and Babesia spp., respectively. Two pairs of primers specific to the 16S rRNA gene were applied to detect the presence of A. phagocytophilum [29]. For the detection of Babesia spp. and Bartonella spp. in the ticks, a pair of primers specific to the 18S rRNA gene and the rpoB gene, respectively, was used [30,31]. Rickettsia spp. were detected with the use of a pair of primers specific to the gltA gene [32]. Oligonucleotide primers used in detection of TBPs and PCR conditions are included in Table 1. The amplification products were separated electrophoretically in 2% ethidium bromide-stained agarose gels, visualized under ultraviolet light, and photographed in a Vilber Lourmat device (Collegien, France). Next, Babesia spp.-positive samples were isolated from the gels and purified using the EURx GeneMATRIX Agarose-OUT DNA Purification Kit (Gdańsk, Poland) according to the manufacturer’s protocol. Sequencing was performed by Genomed (Warsaw, Poland).

2.3. Statistical Analysis

The prevalence of TBPs in ticks was calculated according to the following formula [33]:
Prevalence = n u m b e r   o f   i n f e c t e d   t i c k   s p e c i m e n s n u m b e r   o f   t i c k s   e x a m i n e d × 100 %

3. Results

In this survey, a new locality of D. reticulatus occurrence was confirmed in an area regarded as a Dermacentor-free zone in central–southern Poland (Figure 1). Ticks of this species were mainly collected from open areas overgrown with grasses near residential buildings (Figure 2). In total, 65 ticks, including 48 D. reticulatus and 17 I. ricinus adults, were collected from the vegetation in the study area. Only adults of both tick species were collected (Table 2).
On the basis of the scale proposed by Supergan and Karbowiak [27], the risk of D. reticulatus tick attack was assessed as high in the open meadow habitat (26–50 adult ticks collected by one person per 1 h) and as moderate in the ecotone habitat (11–25 adult ticks, respectively). In turn, the risk of I. ricinus attack was higher in the transition zone between the meadow and the forest, where it was rated as middle (11–25 ticks collected by one person per 1 h) in contrast to the low risk in the area open patch (4–10 ticks, respectively).
In total, Rickettsia spp. were detected in 10/48 (23.8%) of the D. reticulatus adults. These pathogens were identified in 7/23 (30.4%) males and only 3/25 (12.0%) females. None of the other studied pathogens were present in the analyzed D. reticulatus ticks.
In turn, the presence of B. burgdorferi s.l., Babesia spp., and Rickettsia spp. was shown in I. ricinus. In total, 13 monoinfections with B. burgdorferi s.l., 2 coinfections with B. burgdorferi s.l. and Babesia spp., and 1 coinfection with B. burgdorferi s.l. and Rickettsia spp. were detected. This spirochete was found in 13/17 (75.5%) adults of I. ricinus. B. burgdorferi s.l. was detected in 6/10 (60.0%) I. ricinus females and in 7/7 (100.0%) males. In turn, the coinfection with B. burgdorferi s.l. and Babesia spp. was detected in only 2/10 (20.0%) females of this tick species. The coinfection with B. burgdorferi s.l., and Rickettsia spp. was found in 1/10 (10.0%) I. ricinus females. No Anaplasma phagocytophilum or Bartonella spp. were detected in the I. ricinus ticks.
The analysis of the amplicon sequencing data revealed species diversity among the Babesia spp. detected in the I. ricinus ticks. Babesia microti was identified in one female. The sequence exhibited 100% identity with the sequence of B. microti (sequence ID: MK609547.1 human blood, Singapore pathogen imported from the US). In turn, Babesia venatorum EU01 was present in another female of the I. ricinus. In this case, the sequence exhibited 100% identity with the sequence of Babesia sp. “venatorum” (sequence ID: MG344777.1 cervid Czech republic, KM289157.1 Ixodes ricinus Spain, GQ888709.1 the Netherlands—reindeer, HM113372.1 Ixodes ricinus Italy).

4. Discussion

The progressive expansion of D. reticulatus, a vector with unique adaptive abilities, has been observed throughout Europe in recent decades [6,7,8]. In Poland, where the so-called Dermacentor-free zone is found, the increase in the distribution range of this species is regularly investigated, and new endemic locations of this tick species have been described [3,18,23,34,35,36]. Mierzejewska et al. reported 21 new locations of this tick species on the west side of the Vistula River and 22 locations in western Poland [23]. These researchers found D. reticulatus in Wielkopolskie, Kujawsko-Pomorskie, and Łódzkie Provinces. In turn, Karbowiak and Kiewra discovered the presence of D. reticulatus in the natural habitat of Lower Silesia (south-western Poland) [35]. Further studies confirmed the permanent occurrence of D. reticulatus in this area; therefore, this tick species can be regarded as a typical element of the fauna in this region of Poland [17,36]. Similarly, faunistic studies conducted in Lubuskie Province showed new areas of the occurrence of this tick species in western Poland [24,34]. To date, the area of Upper Silesia has been considered D. reticulatus-free, as this tick has not been found in samples collected from vegetation in this region. Research on the distribution of this tick species conducted in 2012–2014 in some areas of this province gave negative results [27]. There were also no reports of the permanent presence of D. reticulatus in the neighboring provinces in the west (Opolskie Province) and the east (Małopolskie Province). Currently, only three incidents of single infestations of D. reticulatus species in dogs have been recorded in Upper Silesia [37,38]. However, in studies of this type, it is difficult to unequivocally confirm the constant presence of ticks in the local environment, and it is impossible to determine the exact place of their origin. In turn, the results presented in this study verify for the first time the occurrence of a D. reticulatus population in a new locality in this part of Poland. Unexpectedly, the relatively large numbers of the D. reticulatus specimens collected from vegetation indicate that this is a new endemic area of the occurrence of this tick species. In addition, in this newly discovered location, D. reticulatus has been reported to outnumber I. ricinus, which, except for in eastern Poland, is relatively rare even where tick habitats have been known for a long time [5,6]. Similar results were obtained in research conducted in eastern and central Poland, showing the dominance of D. reticulatus over I. ricinus in open areas where these two tick species were sympatric [8]. Dermacentor reticulatus is characterized by a wide spectrum of temperature and humidity tolerance, which has been confirmed in both laboratory and field studies [12,22,39,40,41]. Nevertheless, the mosaic landscape probably supports increased animal mobility, which in turn results in the creation of routes used by the hosts of these ticks [21]. The appearance of D. reticulatus in the analyzed locality is probably associated with the presence of migration routes for tick hosts, mainly Artiodactyla and Canidae, which can transport ticks over long distances [22,42,43,44,45].
The molecular analysis of D. reticulatus adults conducted to detect the occurrence of five TBPs in sites located in other regions indicated the presence of a wide TBP spectrum, including TBEV, Rickettsia spp., A. phagocytophilum, Bartonella spp., B. burgdorferi s.l., Borrelia afzelii, B. canis, B. microti, B. venatorum, B. vogeli, Francisella-like endosymbionts, and Toxoplasma gondii [8,22,24,46,47,48,49]. The PCR analysis of the studied D. reticulatus specimens gave positive results only in the case of Rickettsia spp. The prevalence of these pathogens was commonly noted in D. reticulatus from eastern Poland; for example, Błaszkiewicz identified Rickettsia spp. in 38 out of 100 adult ticks collected from vegetation, which made up 14% of females and 62% of males [22]. A comparable prevalence of tick-borne rickettsiae in questing D. reticulatus was also reported from Lublin Province by Wójcik-Fatla et al. [50]. The researchers identified the Rickettsia raoultii etiological agent of tick-borne lymphadenopathy in 280 of 528 adult ticks (53.8%), which made up 53.8% of males and 52.5% of females collected with the flagging method. In a study on the distribution and epidemiological role of D. reticulatus conducted in south-eastern Poland (Subcarpathian region), including extensive screening for the presence of TBPs, a high prevalence of Rickettsia spp. in adults of this tick species was demonstrated. In the group of 120 tested individuals, R. raoultii was detected in 69 ticks (57.5%), i.e., in 59.6% of D. reticulatus females and 55.1% of males, while R. helvetica was detected in 0.8% of the ticks, i.e., in one female [51].
In Central Europe, i.e., the Czech Republic, Slovakia, and Hungary, the mean prevalence of Rickettsia species in D. reticulatus adults assessed by Balážová et al. was 47.9%, with no significant differences between sexes [52]. The presence of rickettsiae in tick females and males increases the risk of infection with this pathogen in hosts present in tick habitats. Animals and, less frequently, humans are parasitized by specimens of both sexes [53].
The presence of both monoinfection with B. burgdorferi s.l. and coinfections with B. burgdorferi s.l. and Babesia spp., as well as B. burgdorferi s.l. and Rickettsia spp., was detected in the sympatric I. ricinus ticks collected in the study area. The percentage of I. ricinus infected with B. burgdorferi s.l. in southern Poland varies from 0% in some areas of Kraków–Częstochowa Upland to even 62% in some regions of Beskid Żywiecki [54,55]. The prevalence of TBPs confirmed in this study was higher than that shown by Asman et al. [55] and much higher than in other areas of southern Poland, where the number of infected ticks ranged from 4.5% to 15.0% [56,57]. Such a high percentage of I. ricinus ticks infected with B. burgdorferi s.l. may have resulted from the small number of tested ticks, but it undoubtedly indicates a high potential risk of infection with this pathogen in the studied area.
Reports suggest that concurrent Lyme disease and babesiosis influence the severity of the disease by modifying the course and clinical picture of the polymicrobial infection [58,59]. Studies conducted in various regions of Poland showed that coinfections with B. burgdorferi s.l. and B. microti were usually detected in a low percentage of examined I. ricinus ticks and varied from 0.6 to 2.0% in eastern Poland, 0.3% in northern Poland, to 0.6% in north-western Poland. Moreover, this co-existence was noted more frequently in adult ticks, mainly females, than in nymphs [60,61,62]. The long-term study on the occurrence of both these pathogens and their co-existence in ticks in Poland conducted by Pawełczyk et al. showed that B. microti appeared more often in ticks infected with B. burgdorferi s.l. [53]. However, in addition to the effect of the species, the diversity of the profile of pathogens infecting ticks may also be related to the biotic and abiotic factors prevailing in their natural habitats [63,64].
The sequencing analysis of B. microti showed that this strain represented the US type and was noted in humans who traveled to the US [65]. In turn, the sequence of Babesia venatorum EU1 exhibited 100% identity with the sequence of Babesia venatorum EU1 isolated from juvenile Rangifer tarandus with babesiosis in the Netherlands and I. ricinus collected from Italy [66,67]. The present study confirms that I. ricinus serves as a vector of these Babesia species in the research area.
The knowledge of mutual interactions between I. ricinus and D. reticulatus co-occurring in the same habitats is still incomplete. It has been demonstrated that the co-feeding of I. ricinus and D. reticulatus on the same host has a beneficial effect on the reproductive success of both tick species [68]. Pathogen transmission occurring in ticks co-feeding in close proximity on the same host increases the risk of the co-existence of multiple tick-borne pathogens or TBP strains in tick organisms [69]. Research conducted by Buczek et al. also indicates that I. ricinus and D. reticulatus are engaged in oral–anal contact in the non-parasitic phase of the life cycle, which may possibly support the circulation of TBPs in nature [7]. Since we also observed this type of behavior in ticks sampled in habitats other than those described by Buczek et al., the research on its epidemiological implications seems to be highly justified.

5. Conclusions

The presented data confirm the progress in the spread of D. reticulatus in southern Poland. The results obtained in the study revealed that, in the studied area in Upper Silesia, there is a new endemic site of D. reticulatus occurrence that is sympatric to the I. ricinus population and characterized by a high TBP prevalence. Our findings indicate the urgent need to implement effective strategies for the surveillance of TBDs and public campaigns that promote knowledge about the risk of exposure to ticks and tick-borne infections and the preventive measures to avoid tick bites. This seems to be particularly important in areas newly populated by certain tick species, where the risk associated with the occurrence of vector-borne diseases transmitted by those ticks was not previously taken into account.

Author Contributions

M.A., K.B. and J.W. research design; M.A., K.B. and J.W. acquisition of data; M.A., K.B. and J.W. data analysis; M.A., J.J.-Z., A.Ś. and J.W. writing—original draft; M.A. and K.B. revision of the manuscript; M.A. and K.B., supervision; M.A. and J.W. obtained the funding for the study. All authors have read and agreed to the published version of the manuscript.

Funding

This study was funded by an internal grants from the Medical University of Silesia in Katowice, financed by the Polish Ministry of Science and Higher Education (grant nos. BNW-1-058/K/3/I, and Young Scientist Grant No. BNW-2-023/N/4/F).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in the study are included in the article; further inquiries can be directed to the corresponding authors.

Acknowledgments

We are grateful to Marcin Wasilewski for preparing a map of the research area.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Nowak-Chmura, M. Fauna of Ticks (Ixodida) of Central Europe; Scientific Publishing House of the Pedagogical University: Krakow, Poland, 2013. (In Polish) [Google Scholar]
  2. Karbowiak, G. The occurrence of the Dermacentor reticulatus tick-its expansion to new areas and possible causes. Ann. Parasitol. 2014, 60, 37–47. [Google Scholar] [PubMed]
  3. Dwużnik-Szarek, D.; Mierzejewska, E.J.; Kiewra, D.; Czułowska, A.; Robak, A.; Bajer, A. Update on prevalence of Babesia canis and Rickettsia spp. in adult and juvenile Dermacentor reticulatus ticks in the area of Poland (2016–2018). Sci. Rep. 2022, 12, 5755. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Kubiak, K.; Sielawa, H.; Dziekońska-Rynko, J.; Kubiak, D.; Rydzewska, M.; Dzika, E. Dermacentor reticulatus ticks (Acari: Ixodidae) distribution in north-eastern Poland: An endemic area of tick-borne diseases. Exp. Appl. Acarol. 2018, 75, 289–298. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Stańczak, J.; Biernat, B.; Racewicz, M.; Zalewska, M.; Matyjasek, A. Prevalence of different Rickettsia spp. in Ixodes ricinus and Dermacentor reticulatus ticks (Acari: Ixodidae) in north-eastern Poland. Ticks Tick Borne Dis. 2018, 9, 427–434. [Google Scholar] [CrossRef] [Scilit]
  6. Grochowska, A.; Dunaj-Małyszko, J.; Pancewicz, S.; Czupryna, P.; Milewski, R.; Majewski, P.; Moniuszko-Malinowska, A. Prevalence of Tick-Borne Pathogens in Questing Ixodes ricinus and Dermacentor reticulatus Ticks Collected from Recreational Areas in Northeastern Poland with Analysis of Environmental Factors. Pathogens 2022, 11, 468. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Buczek, W.; Buczek, A.; Witecka, J.; Asman, M. Prevalence of pathogens in sympatric Ixodes ricinus and Dermacentor reticulatus ticks in Eastern Poland and their potential impact on oral-anal contacts between ticks. Ann. Agric. Environ. Med. 2023, 30, 259–265. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Zając, Z.; Obregon, D.; Foucault-Simonin, A.; Wu-Chuang, A.; Moutailler, S.; Galon, C.; Kulisz, J.; Woźniak, A.; Bartosik, K.; Cabezas-Cruz, A. Disparate dynamics of pathogen prevalence in Ixodes ricinus and Dermacentor reticulatus ticks occurring sympatrically in diverse habitats. Sci. Rep. 2023, 13, 10645. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  9. Földvári, G.; Široký, P.; Szekeres, S.; Majoros, G.; Sprong, H. Dermacentor reticulatus: A vector on the rise. Parasit. Vectors 2016, 9, 314. [Google Scholar] [CrossRef] [Scilit]
  10. Medlock, J.M.; Hansford, K.M.; Vaux, A.G.C.; Cull, B.; Abdullah, S.; Pietzsch, M.E.; Wall, R.; Johnson, N.; Phipps, L.P. Distribution of the tick Dermacentor reticulatus in the United Kingdom. Med. Vet. Entomol. 2017, 31, 281–288. [Google Scholar] [CrossRef] [Scilit]
  11. Kolomiiets, V.; Rakowska, P.; Rymaszewska, A. New problems of environmental ecology: Ticks and tick-borne pathogens in city parks of Ukraine. Environ. Microbiol. Rep. 2022, 14, 591–594. [Google Scholar] [CrossRef] [Scilit]
  12. Buczek, W.; Bartosik, K.; Buczek, A. Development of Dermacentor reticulatus ticks in human household conditions. J. Pest Sci. 2024, 97, 1069–1079. [Google Scholar] [CrossRef] [Scilit]
  13. Rubel, F.; Brugger, K.; Pfeffer, M.; Chitimia-Dobler, L.; Didyk, Y.M. Geographical distribution of Dermacentor marginatus and Dermacentor reticulatus in Europe. Ticks Tick Borne Dis. 2016, 7, 224–233. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Ličková, M.; Fumačová Havlíková, S.; Sláviková, M.; Slovák, M.; Drexler, J.F.; Klempa, B. Dermacentor reticulatus is a vector of tick-borne encephalitis virus. Ticks Tick Borne Dis. 2020, 11, 101414. [Google Scholar] [CrossRef] [Scilit]
  15. Garcia-Vozmediano, A.; Krawczyk, A.I.; Sprong, H.; Rossi, L.; Ramassa, E.; Tomassone, L. Ticks climb the mountains: Ixodid tick infestation and infection by tick-borne pathogens in the Western Alps. Ticks Tick Borne Dis. 2020, 11, 101489. [Google Scholar] [CrossRef] [Scilit]
  16. Hvidsten, D.; Frafjord, K.; Gray, J.S.; Henningsson, A.J.; Jenkins, A.; Kristiansen, B.E.; Lager, M.; Rognerud, B.; Slåtsve, A.M.; Stordal, F.; et al. The distribution limit of the common tick, Ixodes ricinus, and some associated pathogens in north-western Europe. Ticks Tick Borne Dis. 2020, 11, 101388. [Google Scholar] [CrossRef] [Scilit]
  17. Kiewra, D.; Szymanowski, M.; Czułowska, A.; Kolanek, A. The local-scale expansion of Dermacentor reticulatus ticks in Lower Silesia, SW Poland. Ticks Tick Borne Dis. 2021, 12, 101599. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Zając, Z.; Kulisz, J.; Woźniak, A.; Bartosik, K.; Foucault-Simonin, A.; Moutailler, S.; Cabezas-Cruz, A. Tick Activity, Host Range, and Tick-Borne Pathogen Prevalence in Mountain Habitats of the Western Carpathians, Poland. Pathogens 2023, 12, 1186. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Gray, J.S.; Dautel, H.; Estrada-Peña, A.; Kahl, O.; Lindgren, E. Effects of climate change on ticks and tick-borne diseases in Europe. Interdiscip. Perspect. Infect. Dis. 2009, 2009, 593232. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  20. Medlock, J.M.; Hansford, K.M.; Bormane, A.; Derdakova, M.; Estrada-Peña, A.; George, J.-C.; Golovljova, I.; Jaenson, T.G.T.; Jensen, J.-K.; Jensen, P.M.; et al. Driving forces for changes in geographical distribution of Ixodes ricinus ticks in Europe. Parasit. Vectors 2013, 6, 1. [Google Scholar] [CrossRef] [Scilit]
  21. Mierzejewska, E.J.; Estrada-Peña, A.; Bajer, A. Spread of Dermacentor reticulatus is associated with the loss of forest area. Exp. Appl. Acarol. 2017, 72, 399–413. [Google Scholar] [CrossRef] [Scilit]
  22. Błaszkiewicz, P. Dermacentor reticulatus as a Vector of Pathogens in Anthropopressure Unaffected Areas in Eastern Poland. Ph.D. Dissertation, Medical University of Lublin, Lublin, Poland, 27 September 2022. (In Polish) [Google Scholar]
  23. Mierzejewska, E.J.; Estrada-Peña, A.; Alsarraf, M.; Kowalec, M.; Bajer, A. Mapping of Dermacentor reticulatus expansion in Poland in 2012–2014. Ticks Tick Borne Dis. 2016, 7, 94–106. [Google Scholar] [CrossRef] [Scilit]
  24. Opalińska, P.; Wierzbicka, A.; Asman, M. The PCR and nested PCR detection of Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum and Babesia microti in Dermacentor reticulatus F. collected in a new location in Poland (Trzciel, Western Poland). Acta Parasitol. 2016, 61, 849–854. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Kolesiński, M.; Nowak-Kolesińska, A.; Walker, M.; Błasiak, M. Sławków Commune—Study of Conditions and Directions of Spatial Development of the City of Sławków. 2016. Available online: https://bip.slawkow.pl/res/serwisy/pliki/14583591?version=1.0 (accessed on 14 January 2024). (In Polish)
  26. Siuda, K. Ticks of Poland (Acari: Ixodida). Part II. Systematic and Distribution; The Polish Parasitological Society: Warszawav, Poland, 1993. (In Polish) [Google Scholar]
  27. Supergan, M.; Karbowiak, G. The estimation scale of endangerment with tick attacks on recreational towns areas. Przegląd Epidemiol. 2009, 63, 67–71. [Google Scholar]
  28. Guy, E.C.; Stanek, G. Detection of Borrelia burgdorferi in patients with Lyme disease by the polymerase chain reaction. J. Clin. Pathol. 1991, 44, 610–611. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Massung, R.F.; Slater, K.; Owens, J.H.; Nicholson, W.I.; Mather, T.N.; Solberg, V.B.; Olson, J.G. Nested PCR assay for detection of granulocytic ehrlichiae. J. Clin. Microbiol. 1998, 36, 1090–1095. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. Blaschitz, M.; Narodoslavsky-Gföller, M.; Kanzler, M.; Stanek, G.; Walochnik, J. Babesia species occurring in Austrian Ixodes ricinus ticks. Appl. Environ. Microbiol. 2008, 74, 4841–4846. [Google Scholar] [CrossRef] [Scilit]
  31. Renesto, P.; Gouvernet, J.; Drancourt, M.; Roux, V.; Raoult, D. Use of rpoB gene analysis for detection and identification of Bartonella species. J. Clin. Microbiol. 2001, 39, 430–437. [Google Scholar] [CrossRef] [Scilit]
  32. Regnery, R.L.; Spruill, C.L.; Plikaytis, B.D. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J. Bacteriol. 1991, 173, 1576–1589. [Google Scholar] [CrossRef] [Scilit]
  33. Le, C.T.; Boen, J.R. Health and Numbers: Basic Biostatistical Methods; John Wiley: Chichester, UK, 1995. [Google Scholar]
  34. Nowak, M. Discover of Dermacentor reticulatus (Acari: Amblyommidae) populations in the Lubuskie Province (Western Poland). Exp. Appl. Acarol. 2011, 54, 191–197. [Google Scholar] [CrossRef] [Scilit]
  35. Karbowiak, G.; Kiewra, D. New locations of Dermacentor reticulatus ticks in Western Poland. The first evidence of the merge in D. reticulatus occurrence areas? Wiadomości Parazytol. 2010, 56, 333–340. [Google Scholar]
  36. Kiewra, D.; Czułowska, A. Evidence for an increased distribution range of Dermacentor reticulatus in south-west Poland. Exp. Appl. Acarol. 2013, 59, 501–506. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Cuber, P.; Solarz, K.; Mosiałek, A.; Jakubiec-Spanier, M.; Spanier, A. The first record and occurrence of the ornate cow tick Dermacentor reticulatus (Fabricius, 1794) in south-western Poland. Ann. Parasitol. 2013, 59, 49–51. [Google Scholar]
  38. Pawełczyk, O.; Kotela, D.; Asman, M.; Witecka, J.; Wilhelmsson, P.; Bubel, P.; Solarz, K. The first records of canine Babesiosis in dogs from Dermacentor reticulatus -free zone in Poland. Pathogens 2022, 11, 1329. [Google Scholar] [CrossRef] [Scilit]
  39. Zahler, M.; Gothe, R. Effect of temperature and humidity on longevity of unfed adults and on oviposition of engorged females of Dermacentor reticulatus (Ixodidae). Appl. Parasitol. 1995, 36, 200–211. [Google Scholar] [PubMed]
  40. Zahler, M.; Gothe, R. Effect of temperature and humidity on egg hatch, moulting and longevity of larvae and nymphs of Dermacentor reticulatus (Ixodidae). Appl. Parasitol. 1995, 36, 53–65. [Google Scholar]
  41. Meyer-König, A.; Zahler, M.; Gothe, R. Studies on the critical water mass and the rehydration potential of unfed adult Dermacentor marginatus and D. reticulatus ticks (Acari: Ixodidae). Exp. Appl. Acarol. 2001, 25, 505–516. [Google Scholar] [CrossRef] [Scilit]
  42. Scandura, M.; Iacolina, L.; Apollonio, M. Genetic diversity in the European wild boar Sus scrofa: Phylogeography, population structure and wild x domestic hybridization. Mammal Rev. 2011, 41, 125–137. [Google Scholar] [CrossRef] [Scilit]
  43. Andersen, L.W.; Harms, V.; Caniglia, R.; Kluth, G.; Madsen, A.B.; Jędrzejewska, B.; Kluth, G.; Madsen, A.B.; Nowak, C.; Pertoldi, C.; et al. Long-distance dispersal of a wolf, Canis lupus, in northwestern Europe. Mammal Rev. 2015, 60, 163–168. [Google Scholar] [CrossRef] [Scilit]
  44. Wymazał, A.; Nowak, S.; Mysłajek, R.W.; Bajer, A.; Welc-Falęciak, R.; Szewczyk, M.; Kwiatkowska, I.; Stępniak, K.M.; Figura, M.; Kloch, A. Tick-borne infections in wolves from an expanding population in Eastern Europe. Ticks Tick Borne Dis. 2024, 15, 102272. [Google Scholar] [CrossRef] [Scilit]
  45. Mysterud, A.; Qviller, L.; Meisingset, E.L.; Viljugrein, H. Parasite load and seasonal migration in red deer. Oecologia 2016, 180, 401–407. [Google Scholar] [CrossRef] [Scilit]
  46. Mierzejewska, E.J.; Pawełczyk, A.; Radkowski, M.; Welc-Falęciak, R.; Bajer, A. Pathogens vectored by the tick, Dermacentor reticulatus, in endemic regions and zones of expansion in Poland. Parasit. Vectors 2015, 8, 490. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Zając, V.; Wójcik-Fatla, A.; Sawczyn, A.; Cisak, E.; Sroka, J.; Kloc, A.; Zając, Z.; Buczek, A.; Dutkiewicz, J.; Bartosik, K. Prevalence of infections and co-infections with 6 pathogens in Dermacentor reticulatus ticks collected in eastern Poland. Ann. Agric. Environ. Med. 2017, 24, 26–32. [Google Scholar] [CrossRef] [Scilit]
  48. Grochowska, A.; Dunaj, J.; Pancewicz, S.; Czupryna, P.; Majewski, P.; Wondim, M.; Tryniszewska, E. Detection of Borrelia burgdorferi s.l., Anaplasma phagocytophilum and Babesia spp. in Dermacentor reticulatus ticks found within the city of Białystok, Poland-first data. Exp. Appl. Acarol. 2021, 85, 63–73. [Google Scholar] [CrossRef] [Scilit]
  49. Dunaj, J.; Trzeszczkowski, A.; Moniuszko-Malinowska, A.; Rutkowski, K.; Pancewicz, S. Assessment of tick-borne pathogens presence in Dermacentor reticulatus ticks in north-eastern Poland. Adv. Med. Sci. 2021, 66, 113–118. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  50. Wójcik-Fatla, A.; Cisak, E.; Zając, V.; Sroka, J.; Sawczyn, A.; Dutkiewicz, J. Study on tick-borne rickettsiae in eastern Poland. I. Prevalence in Dermacentor reticulatus (Acari: Amblyommidae). Ann. Agric. Environ. Med. 2013, 20, 276–279. [Google Scholar]
  51. Zając, Z.; Kulisz, A.; Woźniak, A.; Obregón, D.; Foucault-Simonin, A.; Bartosik, K.; Moutailler, S.; Cabezas-Cruz, A. Spatial Distribution and Pathogen Profile of Dermacentor reticulatus Ticks in Southeastern Poland: A Genetic and Environmental Analysis. Transbound. Emerg. Dis. 2024, 2024, 5458278. [Google Scholar] [CrossRef] [Scilit]
  52. Balážová, A.; Földvári, G.; Bilbija, B.; Nosková, E.; Široký, P. High Prevalence and Low Diversity of Rickettsia in Dermacentor reticulatus Ticks, Central Europe. Emerg. Infect. Dis. 2022, 28, 893–895. [Google Scholar] [CrossRef] [Scilit]
  53. Pawełczyk, A.; Bednarska, M.; Hamera, A.; Religa, E.; Poryszewska, M.; Mierzejewska, E.J.; Welc-Falęciak, R. Long-term study of Borrelia and Babesia prevalence and co-infection in Ixodes ricinus and Dermacentor recticulatus ticks removed from humans in Poland, 2016–2019. Parasit. Vectors 2021, 14, 348. [Google Scholar] [CrossRef] [Scilit]
  54. Asman, M.; Solarz, K.; Szilman, E.; Szilman, P.; Sikora, B.; Jakubas-Zawalska, J. The occurrence of three tick-borne pathogens in Ixodes ricinus ticks collected from the area of the Kraków-Częstochowa Upland (Southern Poland). Acarologia 2018, 58, 967–975. [Google Scholar] [CrossRef] [Scilit]
  55. Asman, M.; Pindel, Ł.; Solarz, K. The risks of occupational exposure to spirochaetes Borrelia and Babesia sp. in ticks (Acari: Ixodida) collected from recreational areas of Silesian area of Zywiecki Landscape Park. In Arthropods. Threat to Human and Animals Health; Buczek, A., Błaszak, C., Eds.; Koliber: Lublin, Poland, 2014; pp. 140–153. (In Polish) [Google Scholar]
  56. Asman, M.; Witecka, J.; Solarz, K.; Zwonik, A.; Szilman, P. Occurrence of Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum and Babesia microti in Ixodes ricinus ticks collected from selected areas of Opolskie Province in south-west Poland. Ann. Agric. Environ. Med. 2019, 26, 544–547. [Google Scholar] [CrossRef] [Scilit]
  57. Strzelczyk, J.K.; Gaździcka, J.; Cuber, P.; Asman, M.; Trapp, G.; Gołąbek, K.; Zalewska-Ziob, M.; Nowak-Chmura, M.; Siuda, K.; Wiczkowski, A.; et al. Prevalence of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks collected from southern Poland. Acta Parasitol. 2015, 60, 666–674. [Google Scholar] [CrossRef] [Scilit]
  58. Krause, P.J.; Telford, S.R., 3rd; Spielman, A.; Sikand, V.; Ryan, R.; Diane Christianson, R.N.; Burke, G.; Brassard, P.; Pollack, R.; Peck, J.; et al. Concurrent Lyme disease and babesiosis. Evidence for increased severity and duration of illness. JAMA 1996, 275, 1657–1660. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  59. Djokic, V.; Akoolo, L.; Primus, S.; Schlachter, S.; Kelly, K.; Bhanot, P.; Parveen, N. Protozoan Parasite Babesia microti Subverts Adaptive Immunity and Enhances Lyme Disease Severity. Front. Microbiol. 2019, 10, 1596. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  60. Sawczyn-Domańska, A.; Zwoliński, J.; Kloc, A.; Wójcik-Fatla, A. Prevalence of Borrelia, Neoehrlichia mikurensis and Babesia in ticks collected from vegetation in eastern Poland. Exp. Appl. Acarol. 2023, 90, 409–428. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  61. Stańczak, J.; Gabre, R.M.; Kruminis-Łozowska, W.; Racewicz, M.; Kubica-Biernat, B. Ixodes ricinus as a vector of Borrelia burgdorferi sensu lato, Anaplasma phagocytophilum and Babesia microti in urban and suburban forests. Ann. Agric. Environ. Med. 2004, 11, 109–114. [Google Scholar] [PubMed]
  62. Skotarczak, B.; Wodecka, B.; Cichocka, A. Coexistence DNA of Borrelia burgdorferi sensu lato and Babesia microti in Ixodes ricinus ticks from north-western Poland. Ann. Agric. Environ. Med. 2002, 9, 25–28. [Google Scholar] [PubMed]
  63. Grochowska, A.; Milewski, R.; Pancewicz, S.; Dunaj, J.; Czupryna, P.; Milewska, A.J.; Róg-Makal, M.; Grygorczuk, S.; Moniuszko-Malinowska, A. Comparison of tick-borne pathogen prevalence in Ixodes ricinus ticks collected in urban areas of Europe. Sci. Rep. 2020, 10, 6975. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  64. Dyczko, D.; Kiewra, D.; Kolanek, A.; Błażej, P. The influence of local environmental factors in southwestern Poland on the abundance of Ixodes ricinus and prevalence of infection with Borrelia burgdorferi s.l. and B. miyamotoi. Parasitol. Res. 2022, 121, 1575–1585. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  65. Lim, P.L.; Chavatte, J.M.; Vasoo, S.; Yang, J. Imported Human Babesiosis, Singapore, 2018. Emerg. Infect. Dis. 2020, 26, 826–828. [Google Scholar] [CrossRef] [Scilit]
  66. Kik, M.; Nijhof, A.M.; Balk, J.A.; Jongejan, F. Babesia sp. EU1 infection in a forest reindeer, The Netherlands. Emerg. Infect. Dis. 2011, 17, 936–938. [Google Scholar] [CrossRef] [Scilit]
  67. Cassini, R.; Bonoli, C.; Montarsi, F.; Tessarin, C.; Marcer, F.; Galuppi, R. Detection of Babesia EU1 in Ixodes ricinus ticks in northern Italy. Vet. Parasitol. 2010, 171, 151–154. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  68. Bartosik, K.; Buczek, A.; Borzęcki, A.; Kulina, D. Study of the non-parasitic stage in Ixodes ricinus after co-feeding with Dermacentor reticulatus in three infestations. Ann. Agric. Environ. Med. 2017, 24, 90–95. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  69. States, S.L.; Huang, C.I.; Davis, S.; Tufts, D.M.; Diuk-Wasser, M.A. Co-feeding transmission facilitates strain coexistence in Borrelia burgdorferi, the Lyme disease agent. Epidemics 2017, 19, 33–42. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Geographical location of the new endemic locality of Dermacentor reticulatus ticks to the west of the Vistula River (Wisła in Polish) in Sławków, Upper Silesia, central–southern Poland (50°30′19.8′′ N; 19°40′72.6′′ E) (prepared by Marcin Wasilewski, marcinwasilewski.eu on the basis of OpenStreetMap; © authors OpenStreetMap).
Figure 1. Geographical location of the new endemic locality of Dermacentor reticulatus ticks to the west of the Vistula River (Wisła in Polish) in Sławków, Upper Silesia, central–southern Poland (50°30′19.8′′ N; 19°40′72.6′′ E) (prepared by Marcin Wasilewski, marcinwasilewski.eu on the basis of OpenStreetMap; © authors OpenStreetMap).
Insects 15 00580 g001
Figure 2. Sites of the occurrence of Dermacentor reticulatus in Sławków, Upper Silesia, central–southern Poland (50°30′19.8′′ N; 19°40′72.6′′ E). (A) Meadow habitat, (B) ecotone habitat.
Figure 2. Sites of the occurrence of Dermacentor reticulatus in Sławków, Upper Silesia, central–southern Poland (50°30′19.8′′ N; 19°40′72.6′′ E). (A) Meadow habitat, (B) ecotone habitat.
Insects 15 00580 g002
Table 1. Oligonucleotide primes used in detection of Anaplasma phagocytophilum, Bartonella spp., Rickettsia spp., Babesia spp., and polymerase chain reaction (PCR) conditions.
Table 1. Oligonucleotide primes used in detection of Anaplasma phagocytophilum, Bartonella spp., Rickettsia spp., Babesia spp., and polymerase chain reaction (PCR) conditions.
Pathogen
(Gene Detected)
PrimerSequence
(5′-3′)
Size of Amplification Product
[bp]
PCR Conditions
[°C/s]
No. of CyclesReference
DenaturationAnnealingExtension
Anaplasma phagocytophilum (16S rRNA)ge3aCACATGCAAGTCGAACGGATTATTC93294/3055/3072/6040[29]
ge10rTTCCGTTAAGAAGGATCTAATCTCC
ge9fAACGGATTATTCTTTATAG
CTTGCT
54694/3055/3072/6030
ge2GGCAGTATTAAAAGCAGCTCCAGG
Bartonella spp.
(rpoB)
1400FCGCATTGGCTTACTTCGTATG82594/3053/3072/4535[31]
2300RGTAGACTGATTAGAACGCTG
Rickettsia spp. (gltA)RpCS.877pGGGGGCCTGCTCACGGCGG38195/2048/3060/12035[32]
RpCS.1258nATTGCAAAAAGTACAGTGAACA
Babesia spp.
(18S rRNA)
BabforGACTAGGGATTGGAGGTC62094/6053/4572/9035[30]
BabrevGAATAATTCACCGGATCACTC
Table 2. Number of ticks (Acari: Ixodida) collected by flagging sampling in Sławków (central–southern Poland) in mid-April 2023.
Table 2. Number of ticks (Acari: Ixodida) collected by flagging sampling in Sławków (central–southern Poland) in mid-April 2023.
Tick SpeciesMeadow Habitat
N (%)
Ecotone Habitat
N (%)
Total
FMAFMA
Dermacentor reticulatus16
(88.9)
14
(93.3)
30
(90.9)
9
(52.9)
9
(60.0)
18
(56.3)
48
(100)
Ixodes ricinus2
(11.1)
1
(6.7)
3
(9.1)
8
(47.1)
6
(40.0)
14
(43.7)
17
(100)
Total *18
(100)
15
(100)
33
(100)
17
(100)
15
(100)
32
(100)
N—number of ticks; F—females; M—males, A—adults of both sexes (females and males); * number of adult ticks of each sex in the particular collection site; only adults of both tick species were collected.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Asman, M.; Bartosik, K.; Jakubas-Zawalska, J.; Świętek, A.; Witecka, J. A New Endemic Locality of Dermacentor reticulatus in Central–Southern Poland and Its Potential Epidemiological Implications. Insects 2024, 15, 580. https://doi.org/10.3390/insects15080580

AMA Style

Asman M, Bartosik K, Jakubas-Zawalska J, Świętek A, Witecka J. A New Endemic Locality of Dermacentor reticulatus in Central–Southern Poland and Its Potential Epidemiological Implications. Insects. 2024; 15(8):580. https://doi.org/10.3390/insects15080580

Chicago/Turabian Style

Asman, Marek, Katarzyna Bartosik, Justyna Jakubas-Zawalska, Agata Świętek, and Joanna Witecka. 2024. "A New Endemic Locality of Dermacentor reticulatus in Central–Southern Poland and Its Potential Epidemiological Implications" Insects 15, no. 8: 580. https://doi.org/10.3390/insects15080580

APA Style

Asman, M., Bartosik, K., Jakubas-Zawalska, J., Świętek, A., & Witecka, J. (2024). A New Endemic Locality of Dermacentor reticulatus in Central–Southern Poland and Its Potential Epidemiological Implications. Insects, 15(8), 580. https://doi.org/10.3390/insects15080580

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop