Functional Analysis of CPSF30 in Nilaparvata lugens Using RNA Interference Reveals Its Essential Role in Development and Survival
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Insects
2.2. Total RNA Extraction and cDNA Synthesis
2.3. Cloning and Sequencing of the NlCPSF30 Gene
2.4. Sequence and Phylogenetic Analysis
2.5. Expression Pattern Analysis of NlCPSF30
2.6. Double-Stranded RNA (dsRNA) Synthesis
2.7. RNAi
2.8. Survival Phenotype Analysis of BPH After RNAi
2.9. Effects of NlCPSF30 Knockdown on the Expression of Hormone-Related Genes
2.10. Data Analysis
3. Results
3.1. Sequence Analysis of NlCPSF30
3.2. Phylogenetic Analysis of NlCPSF30
3.3. Spatial and Temporal Expression Analyses of NlCPSF30
3.4. Effect of NlCPSF30 by RNAi on the Survival of BPH
3.5. The Impact of NlCPSF30 Knockdown on the Expression of Hormone-Related Genes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Piyaphongkul, J.; Pritchard, J.; Bale, J. Heat stress impedes development and lowers fecundity of the brown planthopper Nilaparvata lugens (Stål). PLoS ONE 2012, 7, e47413. [Google Scholar] [CrossRef] [PubMed]
- Shi, S.; Wang, H.; Zha, W.; Wu, Y.; Liu, K.; Xu, D.; He, G.; Zhou, L.; You, A. Recent advances in the genetic and biochemical mechanisms of rice resistance to brown planthoppers (Nilaparvata lugens Stål). Int. J. Mol. Sci. 2023, 24, 16959. [Google Scholar] [CrossRef] [PubMed]
- Younas, M.U.; Wang, G.; Du, H.; Zhang, Y.; Ahmad, I.; Rajput, N.; Li, M.; Feng, Z.; Hu, K.; Khan, N.U.; et al. Approaches to reduce rice blast disease using knowledge from host resistance and pathogen pathogenicity. Int. J. Mol. Sci. 2023, 24, 4985. [Google Scholar] [CrossRef] [PubMed]
- Yang, M.; Cheng, L.; Yan, L.; Shu, W.; Wang, X.; Qiu, Y. Mapping and characterization of a quantitative trait locus resistance to the brown planthopper in the rice variety IR64. Hereditas 2019, 156, 22. [Google Scholar] [CrossRef]
- Agrawal, N.; Dasaradhi, P.V.; Mohmmed, A.; Malhotra, P.; Bhatnagar, R.K.; Mukherjee, S.K. RNA interference: Biology, mechanism, and applications. Microbiol. Mol. Biol. Rev. 2003, 67, 657–685. [Google Scholar] [CrossRef]
- Pallis, S.; Alyokhin, A.; Manley, B.; Rodrigues, T.B.; Buzza, A.; Barnes, E.; Narva, K. Toxicity of a novel dsRNA-based insecticide to the Colorado potato beetle in laboratory and field trials. Pest Manag. Sci. 2022, 78, 3836–3848. [Google Scholar] [CrossRef]
- Rodrigues, T.B.; Mishra, S.K.; Sridharan, K.; Barnes, E.R.; Alyokhin, A.; Tuttle, R.; Kokulapalan, W.; Garby, D.; Skizim, N.J.; Tang, Y.-W.; et al. First sprayable double-stranded RNA-based biopesticide product targets Proteasome subunit beta type-5 in colorado potato beetle (Leptinotarsa decemlineata). Front. Plant Sci. 2021, 12, 728652. [Google Scholar] [CrossRef]
- Liu, F.; Yang, B.; Zhang, A.; Ding, D.; Wang, G. Plant-mediated RNAi for controlling Apolygus lucorum. Front. Plant Sci. 2019, 10, e21400. [Google Scholar] [CrossRef]
- Yang, X.-B.; Zhou, C.; Gong, M.-F.; Yang, H.; Long, G.-Y.; Jin, D.-C.; Chiu, J. Identification and RNAi-based functional analysis of four chitin deacetylase genes in Sogatella furcifera (Hemiptera: Delphacidae). J. Insect Sci. 2021, 21, 9. [Google Scholar] [CrossRef]
- Xu, C.; Li, F.; Hou, M.; Liu, Y.; Ons, S. Molecular characterization of Vitellogenin-like1 gene in Sogatella furcifera (Hemiptera: Delphacidae), and its function on reproduction. J. Insect Sci. 2024, 24, 17. [Google Scholar] [CrossRef]
- Liu, Y.; Dai, H.; Bamu, A.; Lin, X. Peroxisome biogenesis factor PEX14 is crucial for survival and fecundity of female brown planthopper, Nilaparvata lugens (Stål). Insect Biochem. Mol. Biol. 2024, 170, 104139. [Google Scholar] [CrossRef] [PubMed]
- Gao, H.; Jiang, X.; Zheng, S.; Li, Y.; Lin, X. Role of Groucho and Groucho1-like in regulating metamorphosis and ovary development in Nilaparvata lugens (Stål). Int. J. Mol. Sci. 2022, 23, 1197. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.X.; Feng, Z.J.; Chen, Z.S.; Zhang, Z.F.; Zhang, Y.; Liu, T.X. Use of tyrosine hydroxylase RNAi to study Megoura viciae (Hemiptera: Aphididae) sequestration of its host’s l-DOPA for body melanism. J. Insect Physiol. 2019, 114, 136–144. [Google Scholar] [CrossRef] [PubMed]
- Yang, S.; Zou, Z.; Xin, T.; Cai, S.; Wang, X.; Zhang, H.; Zhong, L.; Xia, B. Knockdown of hexokinase in Diaphorina citri Kuwayama (Hemiptera: Liviidae) by RNAi inhibits chitin synthesis and leads to abnormal phenotypes. Pest Manag. Sci. 2022, 78, 4303–4313. [Google Scholar] [CrossRef] [PubMed]
- Edmonds, M. A history of poly A sequences: From formation to factors to function. Prog. Nucleic Acid Res. Mol. Biol. 2002, 71, 285–389. [Google Scholar]
- Boreikaitė, V.; Passmore, L.A. 3′-end processing of eukaryotic mRNA: Machinery, regulation, and impact on gene expression. Annu. Rev. Biochem. 2023, 92, 199–225. [Google Scholar] [CrossRef]
- Bai, C.; Tolias, P.P. Drosophila clipper/CPSF 30K is a post-transcriptionally regulated nuclear protein that binds RNA containing GC clusters. Nucleic Acids Res. 1998, 26, 1597–1604. [Google Scholar] [CrossRef]
- Christofori, G.; Keller, W. 3′ cleavage and polyadenylation of mRNA precursors in vitro requires a poly(A) polymerase, a cleavage factor, and a snRNP. Cell 1988, 54, 875–889. [Google Scholar] [CrossRef]
- Takagaki, Y.; Ryner, L.C.; Manley, J.L. Four factors are required for 3′-end cleavage of pre-mRNAs. Genes Dev. 1989, 3, 1711–1724. [Google Scholar] [CrossRef]
- Thomas, P.E.; Wu, X.; Liu, M.; Gaffney, B.; Ji, G.; Li, Q.Q.; Hunt, A.G. Genome-wide control of polyadenylation site choice by CPSF30 in Arabidopsis. Plant Cell 2012, 24, 4376–4388. [Google Scholar] [CrossRef]
- Pritts, J.D.; Oluyadi, A.A.; Huang, W.; Shimberg, G.D.; Kane, M.A.; Wilks, A.; Michel, S.L.J. Understanding RNA binding by the nonclassical zinc finger protein CPSF30, a key factor in polyadenylation during pre-mRNA processing. Biochemistry 2021, 60, 780–790. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.; Zhang, Y.; Hamilton, K.; Manley, J.L.; Shi, Y.; Walz, T.; Tong, L. Molecular basis for the recognition of the human AAUAAA polyadenylation signal. Proc. Natl. Acad. Sci. USA 2018, 115, e1419-28. [Google Scholar] [CrossRef] [PubMed]
- Addepalli, B.; Hunt, A.G. A novel endonuclease activity associated with the Arabidopsis ortholog of the 30-kDa subunit of cleavage and polyadenylation specificity factor. Nucleic Acids Res. 2007, 35, 4453–4463. [Google Scholar] [CrossRef] [PubMed]
- Chakrabarti, M.; Hunt, A.G. CPSF30 at the interface of alternative polyadenylation and cellular signaling in plants. Biomolecules 2015, 5, 1151–1168. [Google Scholar] [CrossRef]
- Pritts, J.D.; Hursey, M.S.; Michalek, J.L.; Batelu, S.; Stemmler, T.L.; Michel, S.L.J. Unraveling the RNA binding properties of the iron-sulfur zinc finger protein CPSF30. Biochemistry 2020, 59, 970–982. [Google Scholar] [CrossRef]
- Tacahashi, Y.; Helmling, S.; Moore, C.L. Functional dissection of the zinc finger and flanking domains of the Yth1 cleavage/polyadenylation factor. Nucleic Acids Res. 2003, 31, 1744–1752. [Google Scholar] [CrossRef]
- Bai, C.; Tolias, P.P. Cleavage of RNA hairpins mediated by a developmentally regulated CCCH zinc finger protein. Mol. Cell. Biol. 1996, 16, 6661–6667. [Google Scholar] [CrossRef]
- Hou, Y.; Sun, J.; Wu, B.; Gao, Y.; Nie, H.; Nie, Z.; Quan, S.; Wang, Y.; Cao, X.; Li, S. CPSF30-L-mediated recognition of mRNA m(6)A modification controls alternative polyadenylation of nitrate signaling-related gene transcripts in Arabidopsis. Mol. Plant 2021, 14, 688–699. [Google Scholar] [CrossRef]
- Ye, C.; Feng, Y.; Yu, F.; Jiao, Q.; Wu, J.; Ye, Z.; Zhang, P.; Sun, C.; Pang, K.; Hao, P.; et al. RNAi-mediated silencing of the autophagy-related gene NlATG3 inhibits survival and fecundity of the brown planthopper, Nilaparvata lugens. Pest Manag. Sci. 2021, 77, 4658–4668. [Google Scholar] [CrossRef]
- Ren, Z.W.; Zhuo, J.C.; Zhang, C.X.; Wang, D. Characterization of NlHox3, an essential gene for embryonic development in Nilaparvata lugens. Arch. Insect Biochem. Physiol. 2018, 98, e21448. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Shangguan, X.; Zhang, J.; Liu, B.; Zhao, Y.; Wang, H.; Wang, Z.; Guo, J.; Rao, W.; Jing, S.; Guan, W.; et al. A mucin-like protein of planthopper is required for feeding and induces immunity response in plants. Plant Physiol. 2018, 176, 552–565. [Google Scholar] [CrossRef] [PubMed]
- Mao, Y.; Li, Y.; Gao, H.; Lin, X. Krüppel homologue 1 interacts directly with Hairy and regulates ecdysis in the brown planthopper. Insect Mol. Biol. 2020, 29, 293–300. [Google Scholar] [CrossRef] [PubMed]
- Mao, Y.; Li, Y.; Gao, H.; Lin, X. The direct interaction between E93 and Kr-h1 mediated their antagonistic effect on ovary development of the brown planthopper. Int. J. Mol. Sci. 2019, 20, 2431. [Google Scholar] [CrossRef] [PubMed]
- Jiang, J.; Xu, Y.; Lin, X. Role of Broad-Complex (Br) and Krüppel homolog 1 (Kr-h1) in the ovary development of Nilaparvata lugens. Front. Physiol. 2017, 8, 1013. [Google Scholar] [CrossRef]
- Barabino, S.M.; Hübner, W.; Jenny, A.; Minvielle-Sebastia, L.; Keller, W. The 30-kD subunit of mammalian cleavage and polyadenylation specificity factor and its yeast homolog are RNA-binding zinc finger proteins. Genes Dev. 1997, 11, 1703–1716. [Google Scholar] [CrossRef]
- Gaiano, N.; Amsterdam, A.; Kawakami, K.; Allende, M.; Becker, T.; Hopkins, N. Insertional mutagenesis and rapid cloning of essential genes in zebrafish. Nature 1996, 383, 829–832. [Google Scholar] [CrossRef]
- Hamilton, K.; Tong, L. Molecular mechanism for the interaction between human CPSF30 and hFip1. Genes Dev. 2020, 34, 1753–1761. [Google Scholar] [CrossRef]
- Barabino, S.M.; Ohnacker, M.; Keller, W. Distinct roles of two Yth1p domains in 3′-end cleavage and polyadenylation of yeast pre-mRNAs. EMBO J. 2000, 19, 3778–3787. [Google Scholar] [CrossRef]
- Wang, W.; Ma, Y.; Yang, R.R.; Cheng, X.; Huang, H.J.; Zhang, C.X.; Bao, Y.Y. An MD-2-related lipid-recognition protein is required for insect reproduction and integument development. Open Biol. 2021, 11, 210170. [Google Scholar] [CrossRef]
- Wang, W.; Zhu, T.; Wan, P.; Wei, Q.; He, J.; Lai, F.; Fu, Q. SPARC plays an important role in the oviposition and nymphal development in Nilaparvata lugens Stål. BMC Genom. 2022, 23, 682. [Google Scholar] [CrossRef] [PubMed]
- Lu, K.; Chen, X.; Li, Y.; Li, W.; Zhou, Q. Lipophorin receptor regulates Nilaparvata lugens fecundity by promoting lipid accumulation and vitellogenin biosynthesis. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2018, 219–220, 28–37. [Google Scholar] [CrossRef] [PubMed]
- Li, D.-T.; Chen, X.; Wang, X.-Q.; Moussian, B.; Zhang, C.-X. The fatty acid elongase gene family in the brown planthopper, Nilaparvata lugens. Insect Biochem. Mol. Biol. 2019, 108, 32–43. [Google Scholar] [CrossRef] [PubMed]
- Xi, Y.; Pan, P.L.; Ye, Y.X.; Yu, B.; Xu, H.J.; Zhang, C.X. Chitinase-like gene family in the brown planthopper, Nilaparvata lugens. Insect Mol. Biol. 2014, 24, 29–40. [Google Scholar] [CrossRef] [PubMed]
- Yu, R.; Xu, X.; Liang, Y.; Tian, H.; Pan, Z.; Jin, S.; Wang, N.; Zhang, W. The insect ecdysone receptor is a good potential target for RNAi-based pest control. Int. J. Biol. Sci. 2014, 10, 1171–1180. [Google Scholar] [CrossRef]
- Huang, J.; Zhang, N.; Shan, J.; Peng, Y.; Guo, J.; Zhou, C.; Shi, S.; Zheng, X.; Wu, D.; Guan, W.; et al. Salivary protein 1 of brown planthopper is required for survival and induces immunity response in plants. Front. Plant Sci. 2020, 11, 571280. [Google Scholar] [CrossRef]
- Lyu, Z.; Xiong, M.; Mao, J.; Li, W.; Jiang, G.; Zhang, W. A dsRNA delivery system based on the rosin-modified polyethylene glycol and chitosan induces gene silencing and mortality in Nilaparvata lugens. Pest Manag. Sci. 2023, 79, 1518–1527. [Google Scholar] [CrossRef]
- List, F.; Tarone, A.M.; Zhu-Salzman, K.; Vargo, E.L. RNA meets toxicology: Efficacy indicators from the experimental design of RNAi studies for insect pest management. Pest Manag. Sci. 2022, 78, 3215–3225. [Google Scholar] [CrossRef]
- Si, H.R.; Sun, S.S.; Liu, Y.K.; Qiu, L.Y.; Tang, B.; Liu, F.; Fu, Q.; Xu, C.D.; Wan, P.J. Roles of GFAT and PFK genes in energy metabolism of brown planthopper, Nilaparvata lugens. Front. Physiol. 2023, 14, 1213654. [Google Scholar] [CrossRef]
- Lu, J.B.; Wang, S.N.; Ren, P.P.; He, F.; Li, Q.; Chen, J.P.; Li, J.M.; Zhang, C.X. RNAi-mediated silencing of an egg-specific gene Nllet1 results in hatch failure in the brown planthopper. Pest Manag. Sci. 2023, 79, 415–427. [Google Scholar] [CrossRef]
- Arora, A.K.; Chung, S.H.; Douglas, A.E. Non-target effects of dsRNA molecules in hemipteran insects. Genes 2021, 12, 407. [Google Scholar] [CrossRef] [PubMed]
- Jain, R.G.; Robinson, K.E.; Asgari, S.; Mitter, N. Current scenario of RNAi-based hemipteran control. Pest Manag. Sci. 2021, 77, 2188–2196. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Peng, Y.; Zhang, H.; Wang, K.; Zhao, C.; Zhu, G.; Reddy Palli, S.; Han, Z. Off-target effects of RNAi correlate with the mismatch rate between dsRNA and non-target mRNA. RNA Biol. 2021, 18, 1747–1759. [Google Scholar] [CrossRef] [PubMed]
- Palli, S.R. RNA interference in Colorado potato beetle: Steps toward development of dsRNA as a commercial insecticide. Curr. Opin. Insect Sci. 2014, 6, 1–8. [Google Scholar] [CrossRef]
- Khajuria, C.; Ivashuta, S.; Wiggins, E.; Flagel, L.; Moar, W.; Pleau, M.; Miller, K.; Zhang, Y.; Ramaseshadri, P.; Jiang, C.; et al. Development and characterization of the first dsRNA-resistant insect population from western corn rootworm, Diabrotica virgifera virgifera LeConte. PLoS ONE 2018, 13, e0197059. [Google Scholar] [CrossRef]
Primer Name | Sequence (5′–3′) | Purpose | Ta (°C) | Length (bp) |
---|---|---|---|---|
NlCPSF30-F | TTAGTCAAGATTCCAGGTT | gene cloning | 55 | 1614 |
NlCPSF30-R | CATCCCATTCATCAGTTT | |||
qNlCPSF30-F | TTACAAAGGGCACTACGC | qRT-PCR | 60 | 97 |
qNlCPSF30-R | CTGTTGCTGCTGCTGGTT | |||
q18S rRNA-F | CGCTACTACCGATTGAA | 60 | 131 | |
q18S rRNA-R | GGAAACCTTGTTACGACTT | |||
dsNlCPSF30-F | TAATACGACTCACTATAGGGCGTGGCGACAGGACAATA | dsRNA synthesis | 55 | 342 |
dsNlCPSF30-R | TAATACGACTCACTATAGGGAGTAGCAGGAAGTTCAAAA | |||
dsGFP-F | TAATACGACTCACTATAGGGAGAATGAGTAAAGGAGAAGAACTTTTC | 55 | 495 | |
dsGFP-R | TAATACGACTCACTATAGGGAGATTTGTATAGTTCATCCATGCCATGT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Jing, S.; Yang, J.; Liu, Y.; Wang, F.; Zheng, F.; Ren, A.; Yu, B.; Zhao, Y.; Jia, B.; Chen, R.; et al. Functional Analysis of CPSF30 in Nilaparvata lugens Using RNA Interference Reveals Its Essential Role in Development and Survival. Insects 2024, 15, 860. https://doi.org/10.3390/insects15110860
Jing S, Yang J, Liu Y, Wang F, Zheng F, Ren A, Yu B, Zhao Y, Jia B, Chen R, et al. Functional Analysis of CPSF30 in Nilaparvata lugens Using RNA Interference Reveals Its Essential Role in Development and Survival. Insects. 2024; 15(11):860. https://doi.org/10.3390/insects15110860
Chicago/Turabian StyleJing, Shengli, Jing Yang, Yali Liu, Feifei Wang, Fang Zheng, Aobo Ren, Bingbing Yu, Yue Zhao, Bing Jia, Ruixian Chen, and et al. 2024. "Functional Analysis of CPSF30 in Nilaparvata lugens Using RNA Interference Reveals Its Essential Role in Development and Survival" Insects 15, no. 11: 860. https://doi.org/10.3390/insects15110860
APA StyleJing, S., Yang, J., Liu, Y., Wang, F., Zheng, F., Ren, A., Yu, B., Zhao, Y., Jia, B., Chen, R., Yu, B., Liu, Q., & Xu, J. (2024). Functional Analysis of CPSF30 in Nilaparvata lugens Using RNA Interference Reveals Its Essential Role in Development and Survival. Insects, 15(11), 860. https://doi.org/10.3390/insects15110860