Next Article in Journal
Phylogenetic Implications of Mitogenomic Sequences and Gene Rearrangements of Scale Insects (Hemiptera, Coccoidea)
Next Article in Special Issue
Five Surfaces Treated with d-Tetramethrin plus Acetamiprid for the Management of Tenebrio molitor and Alphitobius diaperinus: Which Is the Best?
Previous Article in Journal
Omics in the Red Palm Weevil Rhynchophorus ferrugineus (Olivier) (Coleoptera: Curculionidae): A Bridge to the Pest
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Uncovering the Male Presence in Parthenogenetic Marchalina hellenica (Hemiptera: Marchalinidae): Insights into Its mtDNA Divergence and Reproduction Strategy

by
Nikoleta Eleftheriadou
1,*,
Umar K. Lubanga
2,
Greg K. Lefoe
2,
M. Lukas Seehausen
3,
Marc Kenis
3,
Nickolas G. Kavallieratos
1,* and
Dimitrios N. Avtzis
4
1
Laboratory of Agricultural Zoology and Entomology, Faculty of Crop Science, Agricultural University of Athens, 75 Iera Odos str., 11855 Athens, Greece
2
Agriculture Victoria, Department of Energy, Environment and Climate Action, AgriBio Centre, Bundoora, VIC 3083, Australia
3
Centre for Agriculture and Bioscience International, Rue des Grillons 1, 2800 Delémont, Switzerland
4
Forest Research Institute—Hellenic Agricultural Organization Demeter (HAO Demeter), Vassilika, 57006 Thessaloniki, Greece
*
Authors to whom correspondence should be addressed.
Insects 2023, 14(3), 256; https://doi.org/10.3390/insects14030256
Submission received: 16 February 2023 / Revised: 24 February 2023 / Accepted: 2 March 2023 / Published: 4 March 2023

Simple Summary

Marchalina hellenica (Hemiptera: Marchalinidae) is a significant contributor to annual honey production in Greece and Turkey, where it is endemic. It was initially described as parthenogenetic, producing only females. The exact reproduction strategy of this species remains unknown. For this reason, we studied the emergence pattern of male individuals in Greece for two consecutive years (2021 and 2022). Furthermore, we examined the genetic variation among 15 geographically distant populations of M. hellenica in Greece using a mitochondrial DNA marker and compared the results with data from Turkey. This study documents the existence of an additional M. hellenica population in its native range that repeatedly produces males, suggesting a previously unknown role for males in the species’ reproduction. The Greek and Turkish populations exhibited a strong genetic affinity, while the genetic pattern in Greece seems to have been obscured by human-aided dispersal.

Abstract

Marchalina hellenica (Hemiptera: Marchalinidae), an endemic species in Greece and Turkey, is a major contributor to the annual honey production in its native range. However, in the areas that it invades, lacking natural enemies, it has detrimental effects on pine trees and potentially contributes to tree mortality. Although it was originally reported as thelytokous, males were later reported in Turkey and on several of the islands of Greece. To further disambiguate the exact parthenogenetic reproduction strategy of M. hellenica, we studied the emergence pattern of male individuals in Greece for two consecutive years (2021 and 2022). Furthermore, we examined the genetic variation among 15 geographically distant populations of M. hellenica in Greece using a mitochondrial DNA marker and compared the results with data from Turkey. The findings of this study document the existence of an additional M. hellenica population in its native range that repeatedly produces males, apart from the areas of Greece and Turkey in which they were initially reported, suggesting that males play a major, so far unknown role in the reproduction of this species. The populations in Greece and Turkey exhibited a strong genetic affinity, while human-aided dispersal seems to have obscured the genetic pattern acquired.

1. Introduction

Marchalina hellenica (Gennadius) (Hemiptera: Marchalinidae), a scale-insect species native to Greece and the coastline of Turkey [1,2,3], is the most significant honeydew-producing insect in Greece [1,4]. It feeds on the sap of pine trees (Pinus spp.), excreting a glutinous substance of slightly modified tree sap, called honeydew [1,2,5,6]. In its native range, M. hellenica is deemed a key insect for apiculture, since the honeydew produced by the scale is collected by bees, Apis mellifera Linnaeus (Hymenoptera: Apidae), and converted to pine honey, representing 60% of the honey production in Greece annually [5,6] and 50% in Turkey [6]. For this reason, there has been a significant concern among beekeepers in recent years, following the observation of a notable reduction in the amount of honeydew [2]. In Greece, M. hellenica primarily infests Pinus brutia and Pinus halepensis, but it has also been found on Pinus pinea, Pinus nigra, Pinus maritima, Pinus sylvestris [7,8], and Abies cephalonica [6]. Beyond its native range, M. hellenica has also been reported on Pinus leucodermis and P. maritima on the island of Ischia, in Italy [9], on P. halepensis and P. pinea, in Croatia [10], and on Pinus radiata, in Australia [11]. Although, in the past, M. hellenica was thought to infest Picea sp. in Russia, Armenia, and Georgia [12], it was later determined that the scale-insect species encountered in these countries was Marchalina caucasica Hadzibeyli (Hemiptera: Marchalinidae) [13]. In its native range, M. hellenica is not considered a serious pest and control measures are taken only sporadically, mainly for aesthetic reasons in urban areas [14]. Although M. hellenica is associated with detrimental effects on trees at high densities, such as branch and foliage desiccation, growth decline, and crown transparency [15,16], it only rarely causes tree mortality, and usually only in conjunction with other biotic and abiotic secondary stress factors [15,16]. In regions invaded by M. hellenica, similar or greater impacts on host trees have been observed [14]. The mild adverse effects of M. hellenica on pine trees in its native region have been attributed to the impact of its natural enemies [11]. In particular, Neoleucopis kartliana (Tanasijtshuk) (Diptera: Chamaemyiidae) is considered to be the most important natural enemy of M. hellenica, suppressing its populations in Greece [11], and it has been successfully used for the biological control of M. hellenica on the island of Ischia, Italy [17]. The recent invasion of M. hellenica in Australia triggered further studies on the biology of N. kartliana [18] and its prospects as a biological control agent against M. hellenica in that country [11].
Marchalina hellenica is univoltine and undergoes three female and four male nymphal instars [1,13]. Adult females, which bear 11-segmented antennae and lack mouthparts, usually appear on the branches of pine trees during April, where they oviposit a mean of 262 eggs in woolly ovisacs [1,2,5]. The 1st-instar nymphs, which bear 6-segmented antennae and have proportionately enlarged mouthparts, are encountered on trees between late April and early May, where they settle in groups inside bark crevices [1,2]. In early September, the 2nd-instar nymphs, which also bear 6-segment antennae and large mouthparts, appear on the trees [1,2]. In October, the nymphs molt into their 3rd instar, and overwinter until they molt again in April and give rise to adult females [1,2]. Third-instar female nymphs bear 9-segmented antennae and are significantly larger than 1st- and 2nd-instar nymphs. Although females are apterous [13], they can disperse to adjacent trees by walking and their ovisacs can be easily carried away by the wind [5].
There are three main insect genetic reproduction systems, diplodiploidy (with diploid males), haplodiploidy (with effective haploid males), and thelytoky (with no males) [19]. Based on the occurrence of parthenogenesis, parthenogenetic systems are categorized as either facultative, obligate, or cyclic [20]. Depending on the sexes produced by parthenogenesis, it is classified as arrhenotoky (producing only males), thelytoky (producing only females) and amphitoky or deuterotoky (producing both sexes) [20]. Mixed systems involving cyclic or facultative parthenogenesis can occur by switching between thelytoky and either diplodiploidy or haplodiploidy [19]. Most scale-insect families belong to a monophyletic clade that exhibits paternal genome elimination [21,22], and they exhibit a wide range of genetic systems [23], with parthenogenesis being either thelytokous, deuterotokous, or arrhenotokous [24]. Nur [25] described six parthenogenetic systems observed in scale insects based on (a) whether male individuals are absent or appear occasionally (obligate parthenogenesis and facultative parthenogenesis, respectively), (b) which sexes are produced by fertilized and non-fertilized eggs, and (c) how diploidy is restored in non-fertilized eggs [26]. There are only a few known obligatory thelytokous scale-insect species, e.g., Protopulvinaria pyriformis Cockerell (Hemiptera: Coccidae), and Pulvinaria peregrina (Borchsenius) (Hemiptera: Coccidae), which do not produce males in any geographic region [27]. Although many species were initially considered thelytokous [25], they were later observed to produce males amphimitically or parthenogenetically [24]. Marchalina hellenica was originally reported as obligatory thelytokous, since males were considered absent [25,28] and its females had no spermatheca [29]. Nikolopoulos [30] and Minachilis [31] first described males that were thought to belong to M. hellenica. However, it was later revealed that they belonged to a Palaeococcus (Hemiptera: Margarodidae) species [2,32]. In the early 2000s, Hodgson and Gounari [13] described apterous M. hellenica males, which have since been reported only on Greek Aegean islands (e.g., Rhodes, Crete, Samos, Ikaria) [2] and in Muğla province in Turkey [33]. Little is known about the exact role of males in the reproduction of M. hellenica and the circumstances under which they emerge.
Although studies have been conducted on the biology of M. hellenica in recent decades [1,4,5,13,33], the exact reproduction system of M. hellenica and its relation to genetic divergence remain largely unknown. Its population performance and reproduction system should be considered to estimate the evolution of a potential or ongoing invasion, since parthenogenetic species are commonly invasive [34]. Most of the genetic diversity seen in asexual arthropod populations could arise from multiple origins of clones from sexual ancestors rather than mutations within the asexual population [35,36]. Provided that M. hellenica is considered mainly parthenogenetic, an interesting question is whether different or geographically distant populations of M. hellenica are genetically divergent. This question has concerned the research community in the past. For instance, Bouga et al. [37] revealed a genetic population homogeneity of M. hellenica between Greece and Turkey, exhibiting only one haplotype in their mtDNA analysis. Thus, the objective of this research is to investigate the emergence pattern of male M. hellenica individuals and examine the genetic variation among geographically distant populations in Greece by using mtDNA markers, comparing them to already existing sequences deposited in GenBank. Through this approach, we intend to elucidate the intricate reproduction strategy of M. hellenica and gain a better understanding of its ecology in invaded areas.

2. Materials and Methods

2.1. Genetic Structure of Marchalina hellenica in Greece

To investigate the genetic variation among geographically distant populations of M. hellenica in Greece, samples of female individuals were collected from 13 populations of continental Greece (Katerini, Makriyalos, Alexandroupoli, Stratoni, Thessaloniki, Ioannina, Parga, Athens, Patra, Megalopoli, Korinthos, Larissa, and Kavala) and from two Greek islands (Samothraki and Lefkada). DNA was extracted from 113 M. hellenica individuals originating from the aforementioned populations using PureLink™ Genomic DNA Mini Kit (ThermoFisher Scientific, Life Sciences Solutions, Waltham, MA, USA) following the protocol suggested by the manufacturer. The DNA barcoding was then performed in volumes of 25 μL with HCO/LCO primers that amplify a fragment of mtDNA COI gene (654 bp) [38] and MyTaq™ Red Mix (BioLine GmbH, Luckenwalde, Germany). The PCR amplification consisted of an initial denaturation step of 5 min at 94 °C, followed by 5 cycles of 60 s at 94 °C (denaturation), 75 s at 47 °C (annealing), and 90 s at 72 °C (extension). This loop was then followed by 40 cycles of 60 s at 94 °C, 75 s at 52 °C (annealing), and 90 s at 72 °C (extension). The final extension period was performed at 72 °C for 7 min. Purification of PCR products was performed with PureLink™ PCR Purification Kit (ThermoFisher Scientific, Life Sciences Solutions, Waltham, MA, USA) following the protocol of the manufacturer. Sequencing was performed at CEMIA SA (Larissa, Greece) using a sequencer ABI 3730XL. Obtained sequences were examined manually using Chromas Lite software version 2.01 and then blasted in NCBI GenBank. To map the distribution of the obtained haplotypes, visualization was conducted using the QGIS 3.28.2 software based on the World Geodetic System 1984 (WGS 84) [39].

2.2. Biological Traits of Marchalina hellenica Males

For the study on the occurrence of male individuals of M. hellenica, branch samples of P. brutia infested by the scale were collected every 15 days for two consecutive years from the suburban forest of Thessaloniki (Kedrinos Lofos), in northern Greece. Branches with perimeters ranging from 2 cm to 13 cm and lengths ranging from 5.5 cm to 62.5 cm were selected using a measuring tape (DSOMHZ, length 150 cm, accuracy 1 mm), collected using extended pruners (Stanley Garden BDS6311), and individually placed in labeled plastic bags. Samples were transferred to the Laboratory of Forest Entomology (Forest Research Institute, HAO Demeter) at Thessaloniki (Greece), where they were studied under a stereomicroscope (Zeiss Stemi 508, Germany, 6.3–50× magnification range) to detect and isolate male M. hellenica adults. Marchalina hellenica individuals (min = 100) were also isolated on every collection day to estimate their developmental stage according to the descriptions of Hodgson and Gounari [13]. Since sex determination is not yet feasible in 1st and 2nd M. hellenica instar nymphs [13], the developmental stage of the early instars of the scale insect was estimated regardless of sex. The 3rd-instar female nymphs and adults of M. hellenica females, as well as the 4th instar and adults of M. hellenica males were recorded. The developmental-stage determination of females is considered crucial to estimate the emergence of male individuals in relation to females. Finally, the samples were transferred in ventilated cages (60 × 60 × 60 cm) in field conditions to record and collect any male adults that might have emerged. The cages were examined daily. The date and number of any emerging male M. hellenica individuals were recorded. Male adults were initially detected visually, since they have elongated bodies and dark legs and antennae [13], and then collected and kept in 98% ethanol. Subsequently, the identification of males was conducted based on the descriptions of Hodgson and Gounari [13] using a stereomicroscope.

Statistical Analysis

The association between the developmental stage of M. hellenica and the emergence of male adults was analyzed with a quasi-Poisson generalized linear model using the glm function in R [40]. A quasi-Poisson distribution was assumed because the Poisson distribution returned overdispersed residuals. The developmental stage of M. hellenica was considered as the independent variable and the count of emerging adults as the dependent variable. To determine which M. hellenica female instars are significantly associated with the male counts, a post hoc test with Tukey adjustments was performed.

3. Results

3.1. Genetic Structure of Marchalina hellenica in Greece

Out of the 113 M. hellenica sequences obtained, only two haplotypes were retrieved. These haplotypes differed only by a single nucleotide polymorphism (SNP), between cytosine (C) and thymine (T). The haplotype bearing cytosine (GPS-HT1, GenBank accession OQ506006) was identical to the GenBank accession HQ225738 that was identified by Bouga et al. [37] in four Turkish populations. Most of the individuals from the 15 Greek populations (94/113) exhibited the haplotype GPS-HT1, with only 19 out of the 113 individuals having the mutation that ranked them to the second haplotype (GPS-HT2, GenBank accession OQ506007). All the analyzed individuals from Thessaloniki, Makriyalos, and the island of Lefkada belonged to the rarer haplotype, GPS-HT2 (Table 1 and Figure 1), whereas all the remaining individuals from the other locations in Greece belonged to GPS-HT1 (Figure 1). The two haplotypes obtained in this study were not found simultaneously in any of the 15 sites studied. At each site, all the specimens exhibited a single haplotype (GPS-HT1 or GPS-HT2).

3.2. Biological Traits of Marchalina hellenica Males

Male M. hellenica individuals matching the descriptions of Hodgson and Gounari [13] were encountered in the samples from Thessaloniki both in 2021 and 2022. In 2021, a total of 70 M. hellenica males were found roaming inside the cages, while 2 additional adult males were found directly on the regularly collected M. hellenica-infested branches during the examination. Adult males were detected from early January to mid-April, when 3rd-instar female nymphs and adult females were present (Figure 2). In 2022, male M. hellenica adults were again detected inside the cages in which the M. hellenica-infested branches were kept, in identical conditions to those in 2021, although in much lower numbers and with a shorter emergence duration. A total of 5 M. hellenica males were detected from late January to late March 2022 (Figure 2). It is worth noting that all the males encountered during this study were highly mobile inside the cages compared to the roaming females.
The emergence of males was significantly related to the female developmental stages (χ2 = 16.251; df = 4,63; p =0.0027). In that, males only emerged concurrent with the 3rd-instar nymphs (mean = 1.7 males per week) and adult females (mean = 3.7 males per week) and not during any of the other developmental stages (Figure 2).

4. Discussion

4.1. Genetic Structure of Marchalina hellenica in Greece

It is generally believed that parthenogenetic lineages are likely to suffer early extinction [41,42] because of the genetic bottlenecks that occur during the onset of parthenogenesis [43]. However, the ability to reproduce asexually facilitates the settlement of a species in a new area, because a single female individual can establish a new population [44,45,46,47]. Parthenogenesis is one of the most effective processes to overcome low population levels and low genetic diversity through uniparental propagation. This assists the expansion of a given species and the exploitation of resources [48]. Indeed, founder populations are typically restricted in size; in addition, parthenogenetic species do not need to find mates and, therefore, do not suffer from inbreeding in the manner of sexually reproducing species [49]. Additionally, parthenogenesis is likely to weaken the Allee effect and favor invasiveness [50]. The low migratory ability and the reproduction strategy of M. hellenica are the main characteristics that should be considered in population genetic studies. Both male and female M. hellenica adults are apterous [13]; therefore, their natural dispersal ability is considered low, and the main reproduction strategy of the species is parthenogenesis [5]. Due to these features, M. hellenica is not expected to exhibit high genetic variation [37]. Intraspecific variation in parthenogenetic organisms is attributed to different sources of parthenogenesis [51], through repeated hybridization and/or polyploidy [52,53], while many parthenogenetic species exhibit high genetic diversity, which can potentially compensate for the absence of DNA recombination [54]. Considering that the mitochondrial DNA (mtDNA) of eukaryote cells has a fast mutation rate, estimated to be 10–20× higher than that of nuclear DNA [55,56,57], leading to significant variation in mtDNA sequences, mtDNA markers have been extensively used to address evolutionary and population questions [37]. In asexual species, DNA recombination is usually insignificant, and such species are expected to have a low mutation rate due to the cost of replication fidelity and deleterious mutations [58]. Furthermore, it has been reported that asexual organisms accumulate deleterious mutations quicker than sexual organisms [59]. By contrast, the asexual and polyploid lineages of some tetrapods exhibit heteroplasmy and mtCOI changes more frequently than the sexual lineages [60,61]. Heteroplasmy (the occurrence of two or more mtDNA variants within a cell) is considered to rise through paternal leakage, implying that the paternal mitochondria are not always extinguished during egg fertilization [62]. For instance, in Drosophila melanogaster Meigen (Diptera: Drosophilidae), heteroplasmy due to paternal leakage reaches up to 14% in its sexually reproducing populations [63]. Variation in the mtDNA of a parthenogenetic species could indicate multiple sources of parthenogenesis [64]. For evolutionary studies, cytochrome oxidase subunit I (COI) is considered the most appropriate molecular marker among mitochondrial protein-coding genes [65], and has been widely used in Hemiptera [66,67,68].
It is speculated that M. hellenica was introduced into northern Greece from Turkey by the Romans and Byzantines [69], who are considered responsible for the artificial geographical range of the two primary hosts of M. hellenica, P. halepensis and P. brutia [70], since there are no references to the presence of M. hellenica in Greece during the prehistoric and classical eras [69]. Bouga et al. [37], who performed a COI mtDNA screening of individuals from four populations in Turkey, revealed a single haplotype. All the Turkish populations exhibited the same haplotype as that which is the most abundant in Greece, while one other, more geographically confined haplotype occurred in Greece. This vividly demonstrates the need for a multi-marker approach in future research efforts, including both nDNA and mtDNA markers, to accurately depict the pattern of intraspecific divergence. The results of the current research exhibit a high genetic affinity level between the populations of Greece and Turkey. If M. hellenica had invaded Greece from Turkey through multiple introductions, the genetic diversity in Greece would have reached the levels of its region of origin [44,71]. Given the presence of mainly one COI mtDNA haplotype throughout the sampling sites in both Greece and Turkey, it is most probable that the M. hellenica populations in the two countries share a common genetic origin. This has been suggested for other species, such as the parthenogenetic species Dryocosmus kuriphilus Yasumatsu (Hymenoptera: Cynipidae), which exhibited a single COI mtDNA haplotype, attributed to a single introduction from China to Europe [72].
The 15 Greek populations of M. hellenica analyzed in this study belonged to two COI mtDNA haplotypes. The predominant haplotype in Greece is identical to the single haplotype from four sites in Turkey exhibited by Bouga et al. [37], while the second haplotype found in this study was only present in three sites of northern Greece (Thessaloniki, Makriyalos, and Lefkada). The sites where the second haplotype was present, although they all belonged to northern Greece, did not exhibit geographic continuity, failing to explain a natural spread of the species. This can be attributed to dispersal through human activities, considering that M. hellenica is a principal contributor to the annual honey production in both Greece and Turkey [1,4] and, for this reason, it has been deliberately introduced into new regions of Greece [16]. Unfortunately, the human dispersal of M. hellenica impedes the interpretation of our results, further complicating the search for its origin.

4.2. Biological Traits of Marchalina hellenica Males

The exact reproduction strategy of M. hellenica remains unknown. Parthenogenesis is frequently observed in Hemiptera; however, scales demonstrate the most abundant variety of reproduction strategies [73], and the identification of the reproduction system of parthenogenetic species is considered a challenging task [74], with reproductive parasites and endosymbiotic bacteria further complicating the reproduction system’s identification [26]. For the first time in Greece, males, females, and 3rd-instar nymphs of M. hellenica were encountered at the same time of the year (January to late March) for two consecutive years (2021 and 2022), although males were found in low numbers compared to females, similarly to other coccids, which produce a sex ratio of 5%:95% (males:females) [75]. Male M. hellenica adults were encountered in Thessaloniki, where the second M. hellenica haplotype was present (GPS-HT2), indicating that males have a genetic effect on this population. The functionality of the male M. hellenica adults was not examined in this study through the inspection of mated females; however, the simultaneous emergence of 3rd-instar female nymphs, female adults, and male adults of M. hellenica is biologically sound, supporting the hypothesis of mating occurrence. The relatively high number of males during the two years indicates that some of the populations in northern Greece are facultatively parthenogenetic, whereas asexual lineages occur in southern Greece. Geographical parthenogenesis is observed in other insect species, such as Clitarchus hookeri (White) (Phasmatodea: Phasmatidae), in New Zealand [76], and Coccus hesperidum L. (Hemiptera: Coccidae), which all present one facultative parthenogenetic and one obligatory parthenogenetic lineage [77]. However, it is probable that M. hellenica reproduces sexually throughout its natural range, but has a low number of male individuals, as speculated recently [78].
In this regard, the Red Queen hypothesis, which has been applied to a wide range of organisms within Animalia [79,80,81,82], suggests that in coevolutionary struggles with natural enemies, the disproportionate attack of natural enemies on the most common phenotype could lead to the short-term coexistence of asexual and sexual populations [82,83,84]. Asexual reproduction would lead sexually reproduced natural enemies to become proficient at handling the defense mechanisms of a single clone, while their beneficiaries’ own capabilities would be continuously improved [85]. Furthermore, some species exhibit both sexual and parthenogenetic lineages on different hosts or in different geographical regions [24,74,86], with parthenogenetic populations often living within distinct ranges, such as marginal habitats, or at a higher latitude or altitude than sexual lineages [87,88,89]. Jensen et al. [90] suggested that sexual populations, usually found at the central part of the range of the infestation, act as sources of populations choosing asexual reproduction, which are found in the marginal regions of infestations. Consequently, mainland populations can be considered more biologically adapted than marginal populations, since they face the stress of a more complex set of natural enemies [85]. In the case of M. hellenica, several studies have examined the effect of the stress of N. kartliana on the scale’s populations, since it is the most abundant predator of M. hellenica [11,18]. Considering that N. kartliana has already been successfully used as a biocontrol agent against M. hellenica [17], it is most probable that it constitutes a major stress factor in the survival of M. hellenica. The sexual reproduction of M. hellenica and the abundance of N. kartliana in the same area [11] indicate that the reproductive strategy of M. hellenica can be explained by the Red Queen hypothesis, with mainland populations implementing sexual reproduction to counter the threat of N. kartliana to the survival of the population.
Asexual reproduction is a common feature among Hemipteran invaders, determining the success of invasions [91,92,93,94]. Considering that M. hellenica males exhibit a pattern of emergence, as suggested by this study, it is probable that an ongoing, or novel invasion of the species will be aided by the benefits of parthenogenesis, while the scale insect will also avoid the phenomenon of a genetic bottleneck due to facultative sexual reproduction, leading to DNA recombination. This emphasizes that M. hellenica constitutes a dangerous pest in the regions it has recently invaded.

5. Conclusions

In conclusion, the findings of this research provide new insights into the reproduction strategy of M. hellenica and its genetic affinity in Greece and Turkey. This contributes to the understanding of the establishment and ecology of this invasive species. However, this study also stresses the necessity for consistent investigation of the emergence of male M. hellenica individuals throughout not only its native habitat, but also the areas it has invaded, as described here, to better define the reproduction system of the species. Furthermore, additional research on the genetic variation throughout both Greece and Turkey, implementing a multi-marker approach, is needed to depict the pattern of intraspecific divergence of M. hellenica and determine its origin and genetic path.

Author Contributions

Conceptualization, N.E., N.G.K. and D.N.A.; methodology, N.E. and D.N.A.; software, N.E. and D.N.A.; validation, N.E., U.K.L., G.K.L., M.L.S., M.K., N.G.K. and D.N.A.; formal analysis, N.E. and D.N.A.; investigation, N.E., M.L.S., M.K. and D.N.A.; resources, N.E. and D.N.A.; data curation, N.E.; writing—original draft preparation, N.E., U.K.L., G.K.L., M.L.S., M.K. and N.G.K.; writing—review and editing, N.E., U.K.L., G.K.L., M.L.S., M.K. and N.G.K.; visualization, N.E., U.K.L., G.K.L., M.L.S., M.K. and N.G.K.; supervision, D.N.A. and N.G.K.; project administration, N.E. and D.N.A.; funding acquisition, N.E. and D.N.A. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by a scholarship provided by the Hellenic Entomological Society and by Agriculture Victoria, Forest and Wood Products Australia, and Australian pine plantation growers, agreement number PNC489-1819.

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Gounari, S. Studies on the phenology of Marchalina hellenica (Gen.) (Hemiptera: Coccoidea: Margarodidae) in relation to honeydew flow. J. Apic. Res. 2006, 45, 8–12. [Google Scholar] [CrossRef] [Scilit]
  2. Gounari, S.; Zotos, C.E.; Dafnis, S.D.; Moschidis, G.; Papadopoulos, G.K. On the impact of critical factors to honeydew honey production: The case of Marchalina hellenica and pine honey. J. Apic. Res. 2021, 62, 383–393. [Google Scholar] [CrossRef] [Scilit]
  3. Ülgentürk, S.; Szentkirályi, F.; Uygun, N.; Fent, M.; Gaimari, S.D.; Civelek, H.; Ayhan, B. Predators of Marchalina hellenica (Hemiptera: Marchalinidae) on pine forests in Turkey. Phytoparasitica 2013, 41, 529–537. [Google Scholar] [CrossRef] [Scilit]
  4. Dafnis, S.D.; Gounari, S.; Zotos, C.E.; Papadopoulos, G.K. The effect of cold periods on the biological cycle of Marchalina hellenica. Insects 2022, 13, 375. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Gounari, S. Seasonal development and ovipositing behavior of Marchalina hellenica (Hemiptera: Margarodidae). Entomol. Hell. 2004, 15, 27–38. [Google Scholar] [CrossRef] [Scilit]
  6. Bacandritsos, N.; Saitanis, C.; Papanastasiou, I. Morphology and life cycle of Marchalina hellenica (Gennadius) (Hemiptera: Margarodidae) on pine (Parnis Mt.) and fir (Helmos Mt.) forests of Greece. Ann. Soc. Entomol. Fr. 2004, 40, 169–176. [Google Scholar] [CrossRef] [Scilit]
  7. Avtzis, N. Marchalina hellenica (Monophlebus hellenicus) Gen. An important honey producing insect of Greece. Das. Erevna 1985, 6, 51–63. [Google Scholar]
  8. Kailidis, S.D. Monophlebus hellenicus (Marchalina hellenica) Genn. The honeydew producing insect of pine trees. Das. Chron. 1965, 81, 1–16. [Google Scholar]
  9. Fimiani, P.; Solino, G. An exotic insect dangerous to the native plants of the island of Ischia. Inf. Agrar. 1994, 50, 65–68. [Google Scholar]
  10. Masten Milek, T.; Simala, M.; Pintar, M. First record of Marchalina hellenica (Gennadius) (Hemiptera: Marchalinidae) in Croatia. In Proceedings of the XVth International Symposium on Scale Insect Studies, Zagreb, Croatia, 17–20 June 2019. [Google Scholar]
  11. Avtzis, D.N.; Lubanga, U.K.; Lefoe, G.K.; Kwong, R.M.; Eleftheriadou, N.; Andreadi, A.; Elms, S.; Shaw, R.; Kenis, M. Prospects for classical biological control of Marchalina hellenica in Australia. BioControl 2020, 65, 413–423. [Google Scholar] [CrossRef] [Scilit]
  12. Jashenko, R.V. Fauna, natural enemies, agricultural harm and possibility of industrial use of margarodids (Coccinea, Margarodidae) in East Europe and North Asia. Selevinia 1999, 10, 43–50. [Google Scholar]
  13. Hodgson, C.; Gounari, S. Morphology of Marchalina hellenica (Gennadius) (Hemiptera: Coccoidea: Marchalinidae) from Greece, with a discussion on the identity of M. caucasica Hadzibeyli from the Caucasus. Zootaxa 2006, 1196, 1–32. [Google Scholar] [CrossRef] [Scilit]
  14. Fotelli, M.N.; Lyrou, F.G.; Avtzis, D.N.; Maurer, D.; Rennenberg, H.; Spyroglou, G.; Polle, A.; Radoglou, K. Effective defense of aleppo pine against the giant scale Marchalina hellenica through ecophysiological and metabolic changes. Front. Plant Sci. 2020, 11, 581693. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Gallis, A.T. Evaluation of the damage by insect Marchalina hellenica (Genn.) in eastern Attica, Greece. Conclusions for sustainable management of forest ecosystems. In Proceedings of the 10th International Conference on Environmental Science and Technology, G-NEST and University of Aegean, Athens, Greece, 5–7 September 2007. [Google Scholar]
  16. Mendel, Z.; Branco, M.; Battisti, A. Invasive sap–sucker insects in the Mediterranean basin. In Insects and Diseases of Mediterranean Forest Systems; Paine, T.D., Lieutier, F., Eds.; Springer International Publishing: Cham, Switzerland, 2016; pp. 261–291. [Google Scholar]
  17. Garonna, A.P.; Viggiani, G. The establishment in Italy of Neoleucopis kartliana (Tanasjtshuk) (Diptera: Chamaemyiidae), predator of Marchalina hellenica (Gennadius) (Hemiptera: Margarodidae). In Proceedings of the XXIII Italian National Congress of Entomology, Genoa, Italy, 13–16 June 2011. [Google Scholar]
  18. Eleftheriadou, N.; Lubanga, U.; Lefoe, G.; Seehausen, M.L.; Kenis, M.; Kavallieratos, N.G.; Avtzis, D.N. Phenology and potential fecundity of Neoleucopis kartliana in Greece. Insects 2022, 13, 143. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Normark, B.B. The evolution of alternative genetic systems in insects. Annu. Rev. Entomol. 2003, 48, 397–423. [Google Scholar] [CrossRef] [Scilit]
  20. Rodriguero, M.S. Parthenogenesis. In Reproductive Strategies in Insects, 1st ed; Omkar, Mishra, G., Eds.; CRC Press: Boca Raton, FL, USA, 2022; pp. 35–71. [Google Scholar]
  21. Cook, L.G.; Gullan, P.J.; Trueman, H.E. A preliminary phylogeny of the scale insects (Hemiptera: Sternorrhyncha: Coccoidea) based on nuclear small-subunit ribosomal DNA. Mol. Phylogenet. Evol. 2002, 25, 43–52. [Google Scholar] [CrossRef] [Scilit]
  22. Danzig, E.M. Coccids of the Far Eastern USSR (Homoptera: Coccinea) with Phylogenetic Analysis of Coccids in the World Fauna; Nauka Publisher: Leningrad, Russia, 1980. [Google Scholar]
  23. Vershinina, A.O.; Kuznetsova, V.G. Parthenogenesis in Hexapoda: Entognatha and non-holometabolous insects. J. Zoolog. Syst. Evol. 2016, 54, 257–268. [Google Scholar] [CrossRef] [Scilit]
  24. Gavrilov-Zimin, I.A.; Stekolshchikov, A.V.; Gautam, D.C. General trends of chromosomal evolution in Aphidococca (Insecta: Homoptera: Aphidinea + Coccinea). Comp. Cytogenet. 2015, 9, 335. [Google Scholar] [CrossRef] [Scilit]
  25. Nur, U. Parthenogenesis in coccids (Homoptera). Am. Zool. 1971, 11, 301–308. [Google Scholar] [CrossRef] [Scilit]
  26. Ross, L.; Pen, I.; Shuker, D.M. Genomic conflict in scale insects: The causes and consequences of bizarre genetic systems. Biol. Rev. 2010, 85, 807–828. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Gavrilov, I.A.; Trapeznikova, I.V. Cytogenetic studies of European Pulvinariini (Homoptera: Coccidae). Comp. Cytogenet. 2008, 2, 131–138. [Google Scholar]
  28. Hovasse, R. Quelquel données nouvelles sur la Cochenille Marchalina hellenica (Genn.). Compt. Rend. Séances Acad. Sci. 1930, 190, 1025–1026. [Google Scholar]
  29. De Marzo, L.; Romano, V.; Tranfaglia, A. Types of the reproductive system in some scale insects (Homoptera: Coccoidea). In Proceedings of the VI International Symposium of Scale Insect Studies; Part II., Krakow, Poland, 6–12 August 1990. [Google Scholar]
  30. Nikolopoulos, C. On Discovering the Until Now Unknown Male Insect of the Species Marchalina hellenica (Gennadius); Agricultural University of Athens: Athens, Greece, 1964; p. 16. [Google Scholar]
  31. Minachilis, K. Study of the Morphology and Bioecology of the Male Individual of the Insect Marchalina hellenica Genn. PhD. Thesis, Agricultural University, Athens, Greece, 2002. [Google Scholar]
  32. Hodgson, C.; Foldi, I. A review of the Margarodidae sensu Morrison (Hemiptera: Coccoidea) and some related taxa based on the morphology of adult males. Zootaxa 2006, 1263, 1–250. [Google Scholar] [CrossRef] [Scilit]
  33. Ülgentürk, S.; Civelek, H.; Dostbil, Ö. Researches on bioecology of the giant pine scale, Marchalina hellenica Gennadius (Hemiptera: Marchalinidae) and relation with its predator Neoleucopis kartliana (Tanasijtshuk) (Diptera: Chamaemyiidae). Mun. Ent. Zool. 2021, 16, 1056–1069. [Google Scholar]
  34. Peacock, L.; Worner, S.P. Biological and ecological traits that assist establishment of alien invasive insects. N. Z. Plant Prot. 2008, 61, 1–7. [Google Scholar] [CrossRef] [Scilit]
  35. Vrijenhoek, R.C. Animal clones and diversity. Bioscience 1998, 48, 617–628. [Google Scholar] [CrossRef] [Scilit]
  36. Crease, T.J.; Stanton, D.J.; Hebert, P.D. Polyphyletic origins of asexuality in Daphnia pulex. II. Mitochondrial-DNA variation. Evolution 1989, 43, 1016–1026. [Google Scholar]
  37. Bouga, M.; Evangelou, V.; Lykoudis, D.; Cakmak, I.; Hatjina, F. Genetic structure of Marchalina hellenica (Hemiptera: Margarodidae) populations from Turkey: Preliminary mtDNA sequencing data. Biochem. Genet. 2011, 49, 683–694. [Google Scholar] [CrossRef] [Scilit]
  38. Vrijenhoek, R. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol. Marine Biol. Biotechnol. 1994, 3, 294–299. [Google Scholar]
  39. QGIS Development Team. QGIS Geographic Information System. Open Source Geospatial Foundation Project. 2023. Available online: http://qgis.osgeo.org (accessed on 3 February 2023).
  40. R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing, R Core Team: Vienna, Austria, 2021. [Google Scholar]
  41. White, M.J.D. Animal Cytology and Evolution, 3rd ed.; Cambridge University Press: London, UK; New York, NY, USA, 1973. [Google Scholar]
  42. Bell, G. The Masterpiece of Nature. The Evolution and Genetics of Sexuality, 1st ed.; University of California Press: Berkley, LA, USA, 1982. [Google Scholar]
  43. Jaron, K.S.; Parker, D.J.; Anselmetti, Y.; Tran Van, P.; Bast, J.; Dumas, Z.; Figuet, E.; François, C.M.; Hayward, K.; Rossier, V.; et al. Convergent consequences of parthenogenesis on stick insect genomes. Sci. Adv. 2022, 8, 3842. [Google Scholar] [CrossRef] [Scilit]
  44. Avtzis, D.N.; Matošević, D. Taking Europe by storm: A first insight in the introduction and expansion of Dryocosmus kuriphilus in central Europe by mtDNA. Šumar. List 2013, 137, 387–394. [Google Scholar]
  45. Askew, R.R. The biology of gall wasps. In Biology of Gall Insects; Anantakrishnan, T.N., Ed.; Edward Arnold: London, UK, 1984; pp. 223–271. [Google Scholar]
  46. Turner, B.D.; Ali, N. Population variability in a domestic stored product pest, the parthenogenetic psocid Liposcelis bostrychophila: Implications for control. In Proceedings of the 1st International Conference Insect Pest in Urban Environment; St. John’s College, University of Cambridge: Cambridge, UK, 1993. [Google Scholar]
  47. Norton, R.A.; Kethley, J.B.; Johnston, D.E.; O’Connor, B.M. Phylogenetic perspectives on genetic systems and reproductive modes of mites. In Evolution and Diversity of Sex Ratio in Insects and Mites; Wrensch, D.L., Ebbert, M.A., Eds.; Chapman and Hall: New York, NY, USA, 1993; pp. 8–99. [Google Scholar]
  48. Davis, M.A. Invasion Biology; Oxford University Press: Oxford, UK, 2009. [Google Scholar]
  49. Liebhold, A.M.; Tobin, P.C. Population ecology of insect invasions and their management. Annu. Rev. Entomol. 2008, 53, 387–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  50. Brockerhoff, E.G.; Liebhold, A.M. Ecology of forest insect invasions. Biol. Invasions 2017, 19, 3141–3159. [Google Scholar] [CrossRef] [Scilit]
  51. Shreve, S.M.; Mockford, E.L.; Johnson, K.P. Elevated genetic diversity of mitochondrial genes in asexual populations of Bark Lice (‘Psocoptera’: Echmepteryx hageni). Mol. Ecol. 2011, 20, 4433–4451. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. Kearney, M. Hybridization, glaciation and geographical parthenogenesis. Trends Ecol. Evol. 2005, 20, 495–502. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  53. Lundmark, M.; Saura, A. Asexuality alone does not explain the success of clonal forms in insects with geographical parthenogenesis. Hereditas 2006, 143, 23–32. [Google Scholar] [CrossRef] [Scilit]
  54. Schön, I.; Martens, K.; van Dijk, P. Lost Sex. The Evolutionary Biology of Parthenogenesis; Springer: Dordrecht, The Netherlands, 2009; pp. 1–615. [Google Scholar]
  55. Merriwether, D.A.; Clark, A.G.; Ballinger, S.W.; Schurr, T.G.; Soodyall, H.; Jenkins, T.; Sherry, S.T.; Wallace, D.C. The structure of human mitochondrial DNA variation. J. Mol. Evol. 1991, 33, 33543–33555. [Google Scholar] [CrossRef] [Scilit]
  56. Richter, C.; Park, J.W.; Ames, B.N. Normal oxidative damage to mitochondrial and nuclear DNA is extensive. Proc. Natl. Acad. Sci. USA 1988, 85, 6465–6467. [Google Scholar] [CrossRef] [Scilit]
  57. Wallace, D.C. Mitochondrial DNA sequence variation in human evolution and disease. Proc. Natl. Acad. Sci. USA. 1994, 91, 8739–8746. [Google Scholar] [CrossRef] [Scilit]
  58. Dawson, K.J. Evolutionarily stable mutation rates. J. Theor. Biol. 1998, 194, 143–157. [Google Scholar] [CrossRef] [Scilit]
  59. Kondrashov, A.S. Deleterious mutations and the evolution of sexual reproduction. Nature 1988, 336, 435–441. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  60. Moritz, C. Evolutionary dynamics of mitochondrial DNA duplications in parthenogenetic geckos, Heteronotia binoei. Genetics 1991, 129, 221–230. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  61. Zevering, C.E.; Moritz, C.; Heideman, A.; Sturm, R.A. Parallel origins of duplications and the formation of pseudogenes in mitochondrial DNA from parthenogenetic lizards (Heteronotia binoei; Gekkonidae). J. Mol. Evol. 1991, 33, 431–441. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  62. Kvist, L.; Martens, J.; Nazarenko, A.A.; Orell, M. Paternal leakage of mitochondrial DNA in the great tit (Parus major). Mol. Biol. Evol. 2003, 20, 243–247. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  63. Nunes, M.D.; Dolezal, M.; Schlötterer, C. Extensive paternal mt DNA leakage in natural populations of Drosophila melanogaster. Mol. Ecol. 2013, 22, 2106–2117. [Google Scholar] [CrossRef] [Scilit]
  64. Elzinga, J.A.; Jokela, J.; Shama, L.N. Large variation in mitochondrial DNA of sexual and parthenogenetic Dahlica triquetrella (Lepidoptera: Psychidae) shows multiple origins of parthenogenesis. BMC Evol. Biol. 2013, 13, 1–9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  65. De Mandal, S.; Chhakchhuak, L.; Gurusubramanian, G.; Kumar, N.S. Mitochondrial markers for identification and phylogenetic studies in insects—A Review. DNA Barcodes 2014, 2, 1–9. [Google Scholar] [CrossRef] [Scilit]
  66. Meng, L.; Wang, Y.; Wei, W.H.; Zhang, H. Population genetic structure of Diaphorina citri Kuwayama (Hemiptera: Liviidae): Host-driven genetic differentiation in China. Sci. Rep. 2018, 8, 1473. [Google Scholar] [CrossRef] [Scilit]
  67. Rattanawannee, A.; Chongrattanameteekul, W. Genetic variation of cassava mealybug, Phenacoccus manihoti (Hemiptera: Pseudococcidae), based on DNA sequences from mitochondrial and nuclear genes. Walailak J. Sci Technol. 2016, 13, 123–132. [Google Scholar]
  68. Wosula, E.N.; Chen, W.; Amour, M.; Fei, Z.; Legg, J.P. KASP genotyping as a molecular tool for diagnosis of cassava-colonizing Bemisia tabaci. Insects 2020, 11, 305. [Google Scholar] [CrossRef] [Scilit]
  69. Petrakis, P.V.; Spanos, K.; Feest, A. Insect biodiversity reduction of pine woods in southern Greece caused by the pine scale (Marchalina hellenica). For. Syst. 2011, 20, 27–41. [Google Scholar]
  70. Schiller, G.; Mendel, Z. Is the overlap of ranges of aleppo pine and brutia pine in the east Mediterranean natural or due to human activity? In Population Genetics and Genetic Conservation of Forest Trees; Baradat, P., Adams, W.T., Miiller-Starck, G., Eds.; SPB Academic Publishing: Amsterdam, The Netherlands, 1995; pp. 159–163. [Google Scholar]
  71. Zalewski, A.; Michalska-Parda, A.; Ratkiewicz, M.; Kozakiewicz, M.; Bartoszewicz, M.; Brzeziński, M. High mitochondrial DNA diversity of an introduced alien carnivore: Comparison of feral and ranch American mink Neovison vison in Poland. Divers. Distrib. 2011, 17, 757–768. [Google Scholar] [CrossRef] [Scilit]
  72. Martinez-Sañudo, I.; Mazzon, L.; Simonato, M.; Avtzis, D.; Pujade-Villar, J.; Faccoli, M. Tracking the origin and dispersal of the Asian chestnut gall wasp Dryocosmus kuriphilus Yasumatsu (Hymenoptera: Cynipidae) in Europe with molecular markers. Bull. Entomol. Res. 2019, 109, 300–308. [Google Scholar] [CrossRef] [Scilit]
  73. Gullan, P.J.; Kosztarab, M. Adaptations in scale insects. Annu. Rev. Entomol. 1997, 42, 23–50. [Google Scholar] [CrossRef] [Scilit]
  74. Gavrilov, I.A.; Kuznetsova, V.G. On some terms used in the cytogenetics and reproductive biology of scale insects (Homoptera: Coccinea). Comp. Cytogenet. 2007, 1, 169–174. [Google Scholar]
  75. Sánchez, L. Sex-determining mechanisms in insects. Int. J. Dev. Biol. 2004, 52, 837–856. [Google Scholar] [CrossRef] [Scilit]
  76. Morgan-Richards, M.A.R.Y.; Trewick, S.A.; Stringer, I.A. Geographic parthenogenesis and the common tea-tree stick insect of New Zealand. Mol. Ecol. 2010, 19, 1227–1238. [Google Scholar] [CrossRef] [Scilit]
  77. Suomalainen, E. Parthenogenesis in animals. Adv. Genet. 1950, 3, 193–253. [Google Scholar]
  78. Kondo, T.; Kondo, T.; Gullan, P.J. Family: Marchalinidae. In Encyclopedia of Scale Insect Pests; Kondo, T., Watson, G.W., Eds.; CABI: Wallingford, UK, 2022; pp. 82–85. [Google Scholar]
  79. Martín-Peciña, M.; Osuna-Mascaró, C. Digest: The Red Queen hypothesis demonstrated by the Daphnia-Caullerya host-parasite system. Evolution 2018, 72, 715–716. [Google Scholar] [CrossRef] [Scilit]
  80. Lively, C.M.; Craddock, C.; Vrijenhoek, R.C. Red Queen hypothesis supported by parasitism in sexual and clonal fish. Nature 1990, 344, 864–866. [Google Scholar] [CrossRef] [Scilit]
  81. Jokela, J.; Dybdahl, M.F.; Lively, C.M. The maintenance of sex, clonal dynamics, and host-parasite coevolution in a mixed population of sexual and asexual snails. Am. Nat. 2009, 174, S43–S53. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  82. Hamilton, W.D.; Axelrod, R.; Tanese, R. Sexual reproduction as an adaptation to resist parasites (a review). Proc. Natl. Acad. Sci. USA 1990, 87, 3566–3573. [Google Scholar] [CrossRef] [Scilit]
  83. Howard, R.S.; Lively, C.M. Parasitism, mutation accumulation and the maintenance of sex. Nature 1994, 367, 554–557. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  84. Jaenike, J. A hypothesis to account for the maintenance of sex within populations. Evol. Theory 1978, 3, 191–194. [Google Scholar]
  85. Glesener, R.R.; Tilman, D. Sexuality and the components of environmental uncertainty: Clues from geographic parthenogenesis in terrestrial animals. Am. Nat. 1978, 112, 659–673. [Google Scholar] [CrossRef] [Scilit]
  86. Nur, U. Parthenogenesis. In Armored Scale Insects: Their Biology, Natural Enemies and Control; Rosen, D., Ed.; Elsevier: Amsterdam, The Netherlands, 1990; Volume 2, pp. 191–197. [Google Scholar]
  87. Vandel, A.P.M. La parthéogenèse géographique: Contribution á l’étude biologique et cytologique de la parthéogenèse naturelle. Lab. D’évolution Des Êtres Organisés 1928, 37, 255–256. [Google Scholar]
  88. Lynch, M. Destabilizing hybridization, general-purpose genotypes and geographic parthenogenesis. Q. Rev. Biol. 1984, 59, 257–290. [Google Scholar] [CrossRef] [Scilit]
  89. Hoshino, M.; Hiruta, S.F.; Croce, M.E.; Kamiya, M.; Jomori, T.; Wakimoto, T.; Kogame, K. Geographical parthenogenesis in the brown alga Scytosiphon lomentaria (Scytosiphonaceae): Sexuals in warm waters and parthenogens in cold waters. Mol. Ecol. 2021, 30, 5814–5830. [Google Scholar] [CrossRef] [Scilit]
  90. Hoy Jensen, L.; Enghoff, H.; Frydenberg, J.; Parker Jr, E.D. Genetic diversity and the phylogeography of parthenogenesis: Comparing bisexual and thelytokous populations of Nemasoma varicorne (Diplopoda: Nemasomatidae) in Denmark. Hereditas 2002, 136, 184–194. [Google Scholar] [CrossRef] [Scilit]
  91. Liebhold, A.M.; Yamanaka, T.; Roques, A.; Augustin, S.; Chown, S.L.; Brockerhoff, E.G.; Pyšek, P. Global compositional variation among native and non-native regional insect assemblages emphasizes the importance of pathways. Biol. Invasions 2016, 18, 893–905. [Google Scholar] [CrossRef] [Scilit]
  92. Macfarlane, R.P.; Maddison, P.A.; Andrew, I.G.; Berry, J.A.; Johns, P.M.; Hoare, R.J.B.; Greenslade, P.; Henderson, R.C.; Smithers, C.N. Trewick, S.A.; et al. Phylum Arthropoda subphylum Hexapoda: Protura, springtails, diplura, and insects. N. Zealand Inv. Biodiver. 2010, 2, 233–467. [Google Scholar]
  93. Aukema, J.E.; McCullough, D.G.; Von Holle, B.; Liebhold, A.M.; Britton, K.; Frankel, S.J. Historical accumulation of nonindigenous forest pests in the continental United States. BioScience 2010, 60, 886–897. [Google Scholar] [CrossRef] [Scilit]
  94. Mondor, E.B.; Tremblay, M.N.; Messing, R.H. Morphological and ecological traits promoting aphid colonization of the Hawaiian Islands. Biol. Invasions 2007, 9, 87–100. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Haplotypes revealed by the mtDNA analysis in Greece (this study) and Turkey [37]. Haplotype 1 (GPS-HT1, yellow points) dominates Greece and four sites in Turkey, while haplotype 2 (GPS-HT2, red points) is exhibited only in three sites in Greece (Thessaloniki, Makriyalos, and Lefkada).
Figure 1. Haplotypes revealed by the mtDNA analysis in Greece (this study) and Turkey [37]. Haplotype 1 (GPS-HT1, yellow points) dominates Greece and four sites in Turkey, while haplotype 2 (GPS-HT2, red points) is exhibited only in three sites in Greece (Thessaloniki, Makriyalos, and Lefkada).
Insects 14 00256 g001
Figure 2. Percentage of the developmental stages of M. hellenica females (colored areas) and emergence of M. hellenica males (columns) in Kedrinos Lofos (Thessaloniki) between January 2021 and April 2022.
Figure 2. Percentage of the developmental stages of M. hellenica females (colored areas) and emergence of M. hellenica males (columns) in Kedrinos Lofos (Thessaloniki) between January 2021 and April 2022.
Insects 14 00256 g002
Table 1. COI mtDNA sequence of two haplotypes revealed in M. hellenica (Giant Pine Scale (GPS)) populations from Greece and Turkey.
Table 1. COI mtDNA sequence of two haplotypes revealed in M. hellenica (Giant Pine Scale (GPS)) populations from Greece and Turkey.
SourceCOI mtDNA Sequence
Turkey (GenBank HQ225738)ATTAATACATCATTTTTCAATCCAAGAAGAAATGGAAGTCCA
Greece (GPS-HT1 GenBank OQ506006)ATTAATACATCATTTTTCAATCCAAGAAGAAATGGAAGTCCA
Greece (GPS-HT2 GenBank OQ506007)ATTAATACATCATTTTTTAATCCAAGAAGAAATGGAAGTCCA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Eleftheriadou, N.; Lubanga, U.K.; Lefoe, G.K.; Seehausen, M.L.; Kenis, M.; Kavallieratos, N.G.; Avtzis, D.N. Uncovering the Male Presence in Parthenogenetic Marchalina hellenica (Hemiptera: Marchalinidae): Insights into Its mtDNA Divergence and Reproduction Strategy. Insects 2023, 14, 256. https://doi.org/10.3390/insects14030256

AMA Style

Eleftheriadou N, Lubanga UK, Lefoe GK, Seehausen ML, Kenis M, Kavallieratos NG, Avtzis DN. Uncovering the Male Presence in Parthenogenetic Marchalina hellenica (Hemiptera: Marchalinidae): Insights into Its mtDNA Divergence and Reproduction Strategy. Insects. 2023; 14(3):256. https://doi.org/10.3390/insects14030256

Chicago/Turabian Style

Eleftheriadou, Nikoleta, Umar K. Lubanga, Greg K. Lefoe, M. Lukas Seehausen, Marc Kenis, Nickolas G. Kavallieratos, and Dimitrios N. Avtzis. 2023. "Uncovering the Male Presence in Parthenogenetic Marchalina hellenica (Hemiptera: Marchalinidae): Insights into Its mtDNA Divergence and Reproduction Strategy" Insects 14, no. 3: 256. https://doi.org/10.3390/insects14030256

APA Style

Eleftheriadou, N., Lubanga, U. K., Lefoe, G. K., Seehausen, M. L., Kenis, M., Kavallieratos, N. G., & Avtzis, D. N. (2023). Uncovering the Male Presence in Parthenogenetic Marchalina hellenica (Hemiptera: Marchalinidae): Insights into Its mtDNA Divergence and Reproduction Strategy. Insects, 14(3), 256. https://doi.org/10.3390/insects14030256

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop