Next Article in Journal
Evaluation of Insecticidal Potentials of Five Plant Extracts against the Stored Grain Pest, Callosobruchus maculatus (Coleoptera: Bruchidae)
Previous Article in Journal
Tephritid Fruit Fly Species Composition, Seasonality, and Fruit Infestations in Two Central African Agro-Ecological Zones
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Reference Genes for Expression Analysis Using RT-qPCR in Cnaphalocrocis medinalis (Lepidoptera: Pyralidae)

1
College of Life Sciences, China Jiliang University, Hangzhou 310018, China
2
State Key Laboratory for Managing Biotic and Chemical Threats to the Quality and Safety of Agro-Products, Institute of Plant Protection and Microbiology, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, China
3
College of Plant Protection, Nanjing Agricultural University, Nanjing 210095, China
4
College of Agriculture and Forestry, Hebei North University, Zhangjiakou 075000, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Insects 2022, 13(11), 1046; https://doi.org/10.3390/insects13111046
Submission received: 17 October 2022 / Revised: 9 November 2022 / Accepted: 11 November 2022 / Published: 13 November 2022
(This article belongs to the Section Insect Molecular Biology and Genomics)

Abstract

Simple Summary

The reference gene is the key to verifying the relative expression of target genes. However, the expression of common housekeeping genes is not stable under different experimental conditions, which may lead to misleading gene expression results. In this study, the stability of thirteen housekeeping genes of the rice pest Cnaphalocrocis medinalis at different developmental stages, larvae tissues, rice feedings, temperature treatments, and adult ages, nutritional conditions, mating statuses and different take-off characteristics was identified. Finally, the relative expression of Trypsin-3 in different rice varieties was evaluated to verify the reliability of the results. Our results will help to improve the accuracy of RT-qPCR analysis and lay a foundation for the analysis of target gene expression for C. medinalis in the future.

Abstract

Cnaphalocrocis medinalis is a destructive migratory rice pest. Although many studies have investigated its behavioral and physiological responses to environmental changes and migration-inducing factors, little is known about its molecular mechanisms. This study was conducted to select suitable RT-qPCR reference genes to facilitate future gene expression studies. Here, thirteen candidate housekeeping genes (EF1α, AK, EF1β, GAPDH, PGK, RPL13, RPL18, RPS3, 18S rRNA, TBP1, TBP2, ACT, and UCCR) were selected to evaluate their stabilities under different conditions using the ∆CT method; the geNorm, NormFinder, BestKeeper algorithms; and the online tool RefFinder. The results showed that the most stable reference genes were EF1β, PGK, and RPL18, related to developmental stages; RPS3 and RPL18 in larval tissues; EF1β and PGK in larvae feeding on different rice varieties; EF1α, EF1β, and PGK in larvae temperature treatments; PGK and RPL13, related to different adult ages; PGK, EF1α, and ACT, related to adult nutritional conditions; RPL18 and PGK, related to adult mating status; and, RPS3 and PGK, related to different adult take-off characteristics. Our results reveal reference genes that apply to various experimental conditions and will greatly improve the reliability of RT-qPCR analysis for the further study of gene function in this pest.

1. Introduction

Real-time quantitative polymerase chain reaction (RT-qPCR) is a method for analyzing specific gene expression that is widely used because of its high sensitivity, high accuracy, specificity, and rapid response [1,2]. When RT-qPCR relatively quantifies the change in the gene expression level, the stably expressed reference gene is most commonly used as the internal control for data normalization [3]. Therefore, finding the appropriate reference gene is an important step of RT-qPCR detection [4,5]. Some housekeeping genes are often used as reference genes of RT- qPCR, such as β-actin (ACT), Glyceraldehyde-3-Phosphate dehydrogenase (GAPDH), 18S ribosomal RNA (18S rRNA), and β-Tubulin (β-TUB) [6,7,8,9,10]. However, studies on the expression of reference genes in different species and under different experimental conditions have shown that most housekeeping genes do not keep stability [4,6,9]. The unstable expression of the reference genes may lead to misleading gene expression results [11]. Moreover, a single reference gene cannot fully satisfy all experimental requirements [12]. Therefore, it is necessary to screen and validate the reference genes for different species under specific experimental conditions [13].
The rice leaf folder, Cnaphalocrocis medinalis (Lepidoptera: Pyralidae), is prominent in the Asian rice region [14]. Its strong adaptability to hosts and adverse stresses makes it one of the most destructive pests on rice [15]. Furthermore, the strong migratory ability of the C. medinalis moths has facilitated the expansion of their geographical distribution, with outbreaks in many rice-growing areas in Asia [16,17,18]. The population outbreaks are sudden and dependent on immigrating population characteristics, which makes their accurate prediction and control more difficult [19]. Therefore, the environmental adaptations and migratory mechanisms of this pest need to be studied in depth. Although many studies have been performed on behavioral responses to changes in abiotic conditions such as temperature and light and the factors including migration [20,21], little is known about the molecular mechanisms that regulate these behavioral and physiological changes in this species. Studies on gene expression and its regulation may help to further understand the environmental adaptations and migration mechanisms of the C. medinalis. It is important to screen the reference genes of C. medinalis suitable for different experimental conditions as the data normalization standard to analyze the relative expression of related genes. In the current study, β-actin was mostly chosen as the reference gene for C. medinalis [22,23,24,25,26]. However, the expression of β-actin has been found to be unstable in different tissues and developmental stages in other insects, such as Chlorops oryzae [27] and Galeruca daurica (Joannis) [28]. Therefore, it is important to determine the best reference gene for C. medinalis under specific conditions.
In this study, the expression stability of thirteen candidate reference genes was assessed in C. medinalis, including Elongation factor 1 α (EF1α), Arginine kinase (AK), Elongation factor 1 β (EF1β), Glyceraldehyde-3-Phosphate dehydrogenase (GAPDH), Phosphoglycerate kinase (PGK), Ribosomal protein L 13 (RPL13), Ribosomal protein L 18 (RPL18), Ribosomal protein S 3 (RPS3), 18S ribosomal RNA (18S rRNA), TATA-box binding protein 1 (TBP1), TATA-box binding protein 2 (TBP2), β-actin (ACT), and Ubiquinol-cytochrome c reductase (UCCR). The expression levels of the genes at different development stages, larval tissues, larvae feeding on rice varieties, larvae temperature treatments, adult ages, adult nutritional conditions, adult mating statuses and adult take-off characteristics were analyzed using ΔCt, geNorm, NormFinder, and BestKeeper [29,30,31]. Then, a comprehensive ranking for each experimental condition was generated using RefFinder based on the rankings created by the four statistical algorithms [32]. Our results will provide valuable information for quantitatively detecting gene expression using RT-qPCR for further research on the molecular mechanisms of the environmental adaptation and migration of C. medinalis.

2. Materials and Methods

2.1. Rice Plant Preparing and Insect Rearing

Four rice varieties, namely TN1 (TN1, seeds provided by the China National Rice Research Institute), Yongyou 1540 (Ningbo Seed Co., Ltd., Ningbo, China), Xiushui 134 and Zhongzao 39 (Zhejiang Wuwangnong Seeds Shareholding Co., Ltd., Hangzhou, China), were grown in a greenhouse at the Zhejiang Academy of Agricultural Sciences in Hangzhou, China (30.31° N, 120.20° E), without any insect pests or pesticide treatments and were used for feeding insects 45 days after germination. All the insects were reared in RXZ intelligent artificial climate chambers (Ningbo Jiangnan Instrument Factory, Ningbo, Zhejiang, China) at 26 ± 1 °C, 80 ± 5% relative humidity, and a photoperiod of 14:10 L:D [33]. Unless otherwise stated, the temperature, humidity, and light conditions of the experiments below were the same as the rearing conditions.
C. medinalis larvae were collected from Nanjing, Jiangsu Province, in 2019 (118.78° E, 32.06° N) and were reared on wheat seedlings until pupation [34]. Pupae were removed and transferred into a plastic box (16 cm × 24 cm × 22 cm in length, width, and height, respectively), and the bottom of the box was filled with moist cotton to maintain high relative humidity. After emergence, 10 adults (female: male = 1:1) were transferred to a 500 mL plastic cup with absorbent cotton wool soaked in 5% honey solution as a supplemental nutrient for adults. The top of the cup was covered with plastic film for adults to oviposit on. TN1 rice was used for larval rearing, a C. medinalis-susceptible variety [35].

2.2. Experimental Treatments

2.2.1. Developmental Stages

C. medinalis individuals at different development stages (first to fifth instar larvae, 4-day-old female/male pupae, and 2-day-old female/male adults) were randomly collected. The sample sizes were 50, 20, 10, 5, and 3 per replications for the 1st to 4th instar larvae and other developmental stages, respectively. Three times were replicated for each treatment. Samples were immediately frozen in liquid nitrogen and stored at −80 °C until use. Samples were collected and stored using this method where not specifically described below. Three biological replicates were set for all the following experimental treatments.

2.2.2. Larval Tissues

Different larval tissues were collected by dissecting 5th instar larvae with reference to the method of Zhang et al. [11]. The larvae were first placed on ice, and the head and tail of the larvae were cut off with dissecting scissors. Afterward, the larval gut was pulled out, and the contents were gently scraped out with dissecting forceps. One end of the larval body was then held in place with forceps, and the fat body was scraped out with another forceps. The head, gut, fat body, and epidermis of the larvae were collected separately. A total of 90 larvae were dissected.

2.2.3. Larvae Feeding on Different Rice Varieties

Four rice varieties, namely, TN1, Yongyou 1540 (Ningbo Seed Co., Ltd., Ningbo, China), Xiushui 134, and Zhongzao 39 (Zhejiang Wuwangnong Seeds Shareholding Co., Ltd., Hangzhou, China), were used for this experiment. Larvae were reared on these four rice varieties after hatching and were used for the experiment when they reached the third instar. Ten larvae were collected as biological replicates.

2.2.4. Larvae Temperature Treatments

A total of seventy-five fourth instar larvae, which were subjected to temperatures of 16, 21, 26, 31, and 36 °C for 1 h in a GXZ intelligent light incubator (Ningbo Jiangnan Instrument Factory, Ningbo, Zhejiang, China), were collected. For each treatment, 5 individuals were used as one replicate.

2.2.5. Adult Ages

Five pairs of newly emerged adults were placed in a 500 mL plastic cup with cotton soaked in a 5% honey solution placed in the bottom and the top of the cup sealed with plastic film. Since most studies focus more on the reproduction and migration of C. medinalis, and their peak periods of reproduction and migration are from the first to five days after emergency [36,37], male and female moths from 1 to 5 days of age were collected for this experiment. There were three replicates at each age and three moths per replicate.

2.2.6. Adult Nutritional Conditions

C. medinalis adults on the day of emergence were divided into two treatment groups: (i) feeding group: one male moth and one female moth were fed with 5% honey solution from the first day after emergence; (ii) starvation group: one pair of moths were fed with water from the first day after emergence; no other food was provided [17]. Two-day-old moths after different nutrient treatments were collected in triplicate (3 moths per replicate).

2.2.7. Adult Mating Statuses

C. medinalis adults were divided into two treatment groups after emergence: (i) mating group: a female moth and a male moth were paired for mating; and (ii) virgin group: female moths and male moths that were not mated were raised separately [17]. Samples (3 adults per replicate) were collected after 3 days.

2.2.8. Different Adult Take-Off Characteristics

Two-day-old female adults were collected and placed in the take-off behavior observation device. The take-off behavior observation device adopted a cylindrical take-off cage made of highly transparent PVC film (a diameter of 50 cm and a height of 120 cm). The bottom of the take-off cage was a white plastic plate, and a 500 mL transparent plastic cup was placed in the middle as the take-off platform. A distinction was made between migratory and resident moths according to different adult take-off characteristics. Moths that took off at a vertical distance greater than 100 cm were considered migratory moths, and those that remained stationary or hovered at an altitude of less than 100 cm were considered resident moths [18]. For each type, 3 female individuals were used as one replicate.

2.3. Total RNA Isolation and cDNA Synthesis

Total RNA was isolated from each sample using TRIzol reagent (Tiosbio, Beijing, China), and the purity and concentration of RNA were determined on a NanoDrop2000 (Thermo Fisher Scientific, Waltham, MA, USA). The RNA samples with absorbance ratios of A260/A280 around 2.0 were selected for further analysis. The extracted RNA was digested by DNase I (TaKaRa, Beijing, China) to remove genomic DNA contamination [38]. Finally, 1 μg of total RNA was used to synthesize cDNA using a 1st cDNA Synthesis Kit (gDNA removal) (Tiosbio, Beijing, China). The cDNA was applied to both PCR and RT-qPCR.

2.4. Selection of Candidate Reference Genes and Primer Design

Thirteen candidate genes, namely EF1α, AK, EF1β, GAPDH, PGK, RPL13, RPL18, RPS3, 18S rRNA, TBP1, TBP2, UCCR, and ACT, were selected from the literature. The primers of EF1α, AK, EF1β, GAPDH, PGK, RPL13, RPL18, RPS3, 18S rRNA, TBP1, TBP2, and UCCR were designed based on the genome data of C. medinalis (http://v2.insect-genome.com/Organism/192, accessed on 6 June 2021). The Gene ID of these genes in the genome is Cmed07334, Cmed10701, Cmed08616, Cmed11239, Cmed22532, Cmed14502, Cmed03810, Cmed05991, Cmed07228, Cmed19702, Cmed03377, and Cmed15494 [39]. Except for genes from genome data, ACT (GenBank accession number: JN029806.1) was also added as a potential candidate reference gene. The design and quality evaluation of all primers were performed using Oligo 7, and primer sequences are listed in Table 1.

2.5. RT-qPCR

RT-qPCR reactions were carried out on a CFX-96 real-time PCR system (BioRad, Hercules, CA, USA). Reactions were conducted in a 20 μL mixture containing 10 μL of 2 × Kappa SYBR Green I qPCR Mix (with ROX) (Tiosbio, Beijing, China), 1 μL of cDNA, 1 μL of each primer, and 7 μL of RNase-free water. The reaction conditions were as follows: initial denaturation at 95 °C for 30 s, followed by 40 cycles at 95 °C for 5 s, 60 °C for 34 s, and 72 °C for 15 s. A melting curve analysis was conducted in the 60–95 °C temperature range to ensure the specificity of the primers. Three technical replicates were set up for each biological replicate. A standard curve was generated from the five-fold dilution series of cDNA, the slopes were analyzed, and the corresponding amplification efficiencies were calculated by Formula (1) [40].
E = ( 10 1 s l o p e 1 ) 100 %  

2.6. Expression Stability of Candidate Reference Genes under Different Treatments

The stability of each candidate reference gene was calculated by the geNorm, NormFinder, BestKeeper, and ∆Ct methods and comprehensively ranked by RefFinder (http://blooge.cn/RefFinder/, accessed on 22 July 2022). The optimal number of reference genes used for normalizing the target gene was determined by the variation value (Vn/Vn+1) calculated by geNorm. Vn/Vn+1 ≤ 0.15 indicated that the number of optimal reference genes for normalization was n [41,42].

2.7. Verification of Reference Gene

The Trypsin-3 (Try3) of C. medinalis was selected as the target gene to verify the stability of candidate reference genes. The primer sequence of the target gene was as follows: forward (5′-AACTTCAAGAAGCCGTCGAA-3′) and reverse (5′-ATGATAAACCCGCCACAGAA-3′). The average relative expressions of Try3 in different rice feeding were computed based on the 2−ΔΔCt method and from three replicates [43]. TN1 was selected as control because it was susceptible to C. medinalis infestation [35]. The gene expression levels under different treatments were analyzed by one-way ANOVA and compared using Tukey’s honestly significant difference test (Tukey’s HSD). All statistical analyses were performed using SPSS 20.0 software (IBM, Armonk, NY, USA).

3. Results

3.1. Total RNA Quality and Amplification Efficiencies

The A260/A280 ratios ranged from 1.80 to 2.11, showing that the RNA samples were of good quality. Agarose gel electrophoresis (Figure S1) showed that the amplified fragments of all the primers were 122–163 bp in length, and melting curve analysis (Figure S2) using the RT-qPCR of the thirteen candidate reference genes had a single peak, indicating the good specificity of the primers. The PCR efficiency (E) and the regression coefficient (R2) were calculated using the slope of the standard curve established for each primer pair. The E-values ranged from 102% (ACT) to 119% (UCCR), which was within the required range of 80.0–120.0% (Table 1). The regression coefficient ranged from 0.982 (TBP1) to 0.999 (PGK and UCCR) (Table 1). These results indicated that the selected quantitative primer pairs were well designed and had good amplification efficiency and specificity. All primers met the requirements of quantitative fluorescence analysis and were suitable for quantifying the candidate reference genes.

3.2. Expression Profiles of Candidate Reference Genes

The expression of the thirteen candidate reference genes under the different experimental conditions was evaluated according to the threshold cycle (Ct) values. The gene expression analysis of the thirteen candidate reference genes in all samples under eight conditions showed a range of Ct means of 15.54–38.75 (Figure 1), indicating significant differences in expression profiles (developmental stages: F12, 390 = 139.228, p < 0.001; larval tissues: F12, 143 = 37.683, p < 0.001; larvae feeding on different rice varieties: F12, 247 = 554.828, p < 0.001; larvae temperature treatments: F12, 182 = 171.332, p < 0.001; adult ages: F12, 260 = 65.584, p < 0.001; adult nutritional conditions: F12, 143 = 73.934, p < 0.001; adult mating statuses: F12, 143 = 25.351, p < 0.001; different adult take-off characteristics: F12, 65 = 143.929, p < 0.001). At developmental stages, EF1α and RPS3 had smaller gene expression variations. Across larvae feeding on different rice varieties and larval tissues, EF1α and PGK had the smallest gene expression variation. Among larvae temperature treatments, the fluctuation of EF1α expression was the smallest (Figure 1A–D). In the four treatments of adults, the expression of 18S rRNA fluctuated significantly (Figure 1E–G). Overall, EF1α was the most abundant gene, and 18S rRNA was the least expressed gene.

3.3. Stability of Candidate Reference Genes in C. medinalis under Different Experimental Conditions

3.3.1. Developmental Stages

The least stable gene evaluated by four algorithms was 18S rRNA. EF1β was the most stable gene in ∆Ct and geNorm, GAPDH was the most stable in BestKeeper, and RPL18 was the most stable in NormFinder (Table 2). The stability of the thirteen reference genes was ranked by RefFinder, from high to low: EF1β > PGK > RPL18 > EF1α > GAPDH > ACT > RPS3 > TBP2 > TBP1 > RPL13 > AK > UCCR > 18S rRNA (Figure 2). Pair-wise variation analysis of reference genes showed that V6/7 was less than 0.15 (Figure 3), indicating that gene expression analysis required six different reference genes in the developmental stage. Based on the above comprehensive ranking, we recommended the following six genes as reference genes in developmental stages: EF1β, PGK, RPL18, EF1α, GAPDH, and ACT.

3.3.2. Larval Tissues

For different larval tissues, the evaluation of the most stable gene was different: RPL18 was the most stable gene in ∆Ct, EF1α was the most stable gene in BestKeeper, RPS3 was the most stable gene in NormFinder, and 18S rRNA and TBP1 were the most stable genes in geNorm, but the least stable gene in the four algorithms was UCCR (Table 2). Combining the four algorithms, the comprehensive ranking by RefFinder was as follows: RPS3 > RPL18 > TBP1 > EF1α > 18S rRNA > PGK > EF1β > TBP2 > RPL13 > GAPDH > AK > ACT > UCCR (Figure 2). V2/3 was around 0.15 in geNorm (Figure 3); this suggested that two genes should be selected as reference genes in subsequent studies on other genes in larval tissues. Here, we recommended RPS3 and RPL18 as reference genes.

3.3.3. Larvae Feeding on Different Rice Varieties

All analyses except for Bestkeeper indicated that EF1β was the most stable gene, while BestKeeper considered PGK as the most stable gene (Table 2). The stability of the RefFinder comprehensive evaluation was from high to low: EF1β > PGK > EF1α > ACT > TBP1 > 18S rRNA > RPL18 > GAPDH > RPS3 > TBP2 > RPL13 > AK > UCCR (Figure 2). The analysis of pair-wise variation showed that V2/3 was less than 0.15 (Figure 3), and the calculation of two genes as reference genes (EF1β and PGK) was accurate enough.

3.3.4. Larvae Temperature Treatments

Under temperature–stress conditions, ∆Ct and NormFinder suggested that EF1β was the most stable gene, and BestKeeper and geNorm indicated that EF1α was one of the most stable genes in larvae, whereas the least stable gene was UCCR (Table 2). The stability order of the thirteen reference genes was ranked as follows: EF1α > EF1β > PGK > RPS3 > TBP1 > TBP2 > RPL18 > GAPDH > RPL13 > AK > ACT > 18S rRNA > UCCR (Figure 2). The variation in V3/4 was less than 0.15 (Figure 3), indicating that gene expression analysis required three different reference genes under different temperature treatments: EF1α, EF1β, and PGK.

3.3.5. Adult Ages

Besides BestKeeper suggesting that UCCR was the most stable gene, the other three algorithms revealed that PGK was the most stable gene at different adult ages (Table 2). The RefFinder evaluation found that PGK ranked the highest in terms of stability, followed by RPL13, and 18S rRNA was the lowest in terms of stability (Figure 2). The variation value V2/3 was less than 0.15 (Figure 3). Therefore, it was recommended to use two reference genes (PGK and RPL13) to detect the expression level of target genes at different adult ages.

3.3.6. Adult Nutritional Conditions

Based on the results of the three algorithms (∆Ct, NormFinder, and geNorm), PGK was identified as the most stable gene in nutritional status, but the BestKeeper analysis showed that ACT had the highest expression stability (Table 2). RefFinder ranked the selected housekeeping genes in the following order from the most to the least stable: PGK > EF1α > ACT > RPL18 > RPL13 > EF1β > RPS3 > GAPDH > TBP1 > AK > UCCR > TBP2 > 18S rRNA (Figure 2). In addition, the pair-wise variance value V3/4 was less than 0.15 in geNorm analysis (Figure 3). We thus suggest that, under the same experimental conditions, using three different reference genes (PGK, EF1α, and ACT) to calculate the relative expression of target genes is more accurate.

3.3.7. Adult Mating Statuses

RPL18 was the most stable gene evaluated by ∆Ct and NormFinder, and UCCR was the most stable gene in BestKeeper, EF1α, and PGK in geNorm in adults at different mating statuses. Additionally, all algorithms suggested that 18S rRNA was the least stable gene (Table 2). High stability to low stability in RefFinder is ranked as follows: RPL18 > PGK > ACT > EF1α > EF1β > RPL13 > RPS3 > UCCR > AK > GAPDH > TBP2 > TBP1 > 18S rRNA (Figure 2). Comparing two pairs of variation values found that V2/3 was less than 0.15 (Figure 3). Therefore, two different genes should be used as reference genes. Combined with the order of RefFinder, RPL18 and PGK were the best choices to detect the expression level of the target gene in adults with different mating statuses.

3.3.8. Different Adult Take-Off Characteristics

The evaluation results of ∆Ct, NormFinder, and geNorm showed that RPS3 was one of the most stable genes, while Best Keeper considered ACT as the most stable gene (Table 2). According to the results of RefFinder, the stability was ranked as RPS3 > PGK > ACT > EF1α > RPL18 > RPL13 > UCCR > AK > TBP1 > TBP2 > 18S rRNA >EF1β > GAPDH (Figure 2). The variation in V2/3 was less than 0.15 (Figure 3). This showed that, under the same experimental conditions, at least two different genes were required as reference genes to verify the relative expression of target genes. Based on the ordering of RefFinder, we considered RPS3 and PGK as the most appropriate reference gene combinations.

3.4. Validation of Reference Genes with Try3

To evaluate the stability of the selected reference genes, we analyzed the expression level of Try3 in the third instar C. medinalis larvae fed on different rice varieties. The following reference genes were used to normalize: PGK, PGK + EF1β (the most stable reference gene), and UCCR, UCCR + AK (the least stable reference gene). The highest accumulated level of Try3 was found in larvae fed on Zhongzao 39. The expression of Try3 in larvae fed by Xiushui 134 was significantly up-regulated as analyzed by PGK and PGK + EF1β. However, there was no significant difference among the larvae feeding on Xiushui 134, Yongyou 1540, and TN1 after analysis with UCCR and UCCR + AK (PGK: F3, 16 = 69.372, p < 0.001; PGK + EF1β: F3, 16 = 103.448, p < 0.001; UCCR: F3, 16 = 24.709, p < 0.001; UCCR + AK: F3, 16 = 42.219, p < 0.001). Except for TN1, the Try3 expression levels of the larvae fed by the other three varieties of rice showed significant differences with different reference gene combinations (Xiushui 134: F3, 16 = 9.298, p = 0.001; Yongyou 1540: F3, 16 = 4.090, p = 0.025; Zhongzao 39: F3, 16 = 6.018, p = 0.006; TN1: F3, 16 = 0.004, p = 1.000) (Figure 4). This shows that the stability and reliability of the results are reduced when using unstable reference genes or combinations.

4. Discussion

RT-qPCR is the most widely used gene expression detection method, but its accuracy and reliability depend on the normalization of data by stable reference genes [44]. To avoid data fuzziness, each candidate housekeeping gene needs to be verified under certain experimental conditions [28]. In our study, the expression stability of thirteen candidate reference genes in C. medinalis was assessed at different developmental stages, larvae tissues, larvae feeding on rice varieties, larvae temperature treatments, adult ages, take-off characteristics, mating statuses, and nutritional conditions. Our data showed that there was no single reference gene suitable for all the conditions. The results obtained by screening appropriate reference genes for specific conditions were more reliable than using common housekeeping genes directly.
The comprehensive orders with the online tool RefFinder showed significant differences among different experimental conditions. This phenomenon was also found in other insects, such as Miscanthus sacchariflorus [1], Apis mellifera [3], and Luffa cylindrica [4]. Our results showed EF1β was the most suitable reference gene under different varieties of rice feeding, which was the same as Chrysomya megacephala [45]. Additionally, in larval tissues, RPS3 was a stable reference gene. This result was confirmed in Sesamia inferens [46], Ips typographus [47], and Tribolium castaneum [48], suggesting that RPS3 may be used as the reference gene for most insects in different tissues. Nevertheless, not all reference genes applicable to one insect could be used as reference genes for other insects. For example, 18S rRNA and GAPDH are often used as reference genes in many insects [13]. However, in our experiments, 18S rRNA was the least stable gene at different developmental stages and in adults in the other three conditions, except for different adult take-off characteristics, which may be due to the fact that the C. medinalis moth is a migratory insect and its cellular rRNA levels may be more susceptible to external environments, such as nutrient deficiencies [49]. In addition, we found that GAPDH had the lowest stability with different take-off characteristics, probably because the process of migration or take-off requires energy [50], and GAPDH is closely related to energy metabolism [51]. These results indicated that “classic” genes were variable and needed to be assessed before further use as reference genes. Therefore, it is necessary to screen and verify the reference genes of C. medinalis under other different conditions more comprehensively.
Previous studies have found that some genes could be used as universal reference genes under multiple conditions. ACT was a stable gene in Diaphania caesalis [41], and Aphis gossypii [52] and α-Tublin could be used as a reference gene in Empoasca onukii Matsuda [53] and Anthonomus eugenii Cano [54] under diverse conditions. We found that the expression of EF1α and EF1β was relatively stable in the other three conditions of C. medinalis larvae, except for feeding on different rice varieties, which means that they were used as references for the larval stage of C. medinalis. The stability of the two genes was also confirmed under diverse conditions in Cydia pomonella [5] and Phthorimaea operculella [9] larvae. They may be used as reference genes for studying Lepidoptera larval-stage-related physiology. More interestingly, PGK showed relatively stable expression under seven experimental conditions, except for larval tissues (comprehensively ranking in the top three under these seven conditions). PGK is the key enzyme of glycolysis, which plays a major role in organism survival, and its sequence is highly conservative [55]. The amount of PGK mRNA expression is high, and the mRNA content in the larval and adult stages follows the classical transcription pattern of enzymes related to general metabolic pathways [56]. Furthermore, PGK was one of the reference genes in Aedes albopictus early embryos [57]. Therefore, we believe that PGK can be used as a reference gene to determine the expression of the target gene in C. medinalis under most physiological conditions.
To validate our findings, we analyzed the expression of Try3 in response to different varieties of rice feeding. Try3 is an important enzyme for digesting protein in insect guts [58]. After normalization with EF1β + PGK and UCCR, the results of Try3 expression were different. This result suggests that it is important to select appropriate reference genes to standardize the expression of target genes. Notably, two or more reference genes are often used for more accurate quantitative analysis [59]. The number of reference genes used to verify the expression of the target gene was one, two, three, or more in insects [60,61,62]. Many studies suggested that more than one stably expressed reference gene should be used, as the selection of multiple reference genes helps to reduce the deviation of data normalization [63]. Our study also found that the number of recommended reference genes under different experimental conditions ranged from two to six. Nevertheless, in past studies, most research on C. medinalis used a single reference gene [64,65]. As a result, we suggest using more than two different reference genes for standardization in future molecular experiments on C. medinalis. Moreover, some studies suggest that errors may be caused when more than three reference genes are used to normalize data [59]. Thus, the selection of reference genes for C. medinalis should be based on the appropriate number of reference genes in addition to stability.

5. Conclusions

In conclusion, the stability of thirteen candidate reference genes was analyzed by five reliable algorithms under different experimental conditions. The optimal combination of most stable reference genes was PGK, RPL18, and EF1β for developmental stages; RPS3 and RPL18 for larvae tissues; EF1β and PGK for larvae feeding on different rice varieties; EF1α, EF1β, and PGK for larvae temperature treatments; PGK and RPL13 for adult ages; PGK, EF1α, and ACT for adult nutritional conditions; RPL18 and PGK for adult mating statuses; RPS3 and PGK for different adult take-off characteristics. PGK could be used as a reference gene of C. medinalis in most physiological conditions. Our results provide a basis for further studies on the expression of target genes in C. medinalis under these different experimental conditions. However, there was no single universal reference gene that could be used under all experimental conditions. The applicability of the reference genes recommended in this study under other experimental conditions remains to be determined.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/insects13111046/s1, Figure S1: Amplification specificity of primers in PCR. Figure S2: Melting curves from RT-qPCR of the candidate genes.

Author Contributions

Conceptualization, J.G., J.H., Y.L. and J.T.; formal analysis, X.Z., T.S. and J.G.; investigation, X.Z. and T.S.; data curation, X.Z., J.H. and J.T.; writing—original draft preparation, J.G., X.Z., H.X. and Z.W.; writing—review and editing, J.G., Y.L., Z.W. and Z.L.; visualization, J.G. and X.Z.; supervision, Z.W. and H.X.; funding acquisition, J.G. and Z.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation of China (32202280), Zhejiang Provincial Natural Science Foundation of China (LQ22C140006) and the earmarked fund for China Agriculture Research System (CARS-01).

Institutional Review Board Statement

Not applicable.

Data Availability Statement

The data presented in this study are available in the article.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Zong, J.; Chen, J.; Li, L.; Li, J.; Li, D.; Wang, J.; Liu, J.; Liu, J. Reference gene selection for quantitative RT-PCR in Miscanthus sacchariflorus under abiotic stress conditions. Mol. Biol. Rep. 2022, 49, 907–915. [Google Scholar] [CrossRef] [PubMed]
  2. Yang, Q.; Li, Z.; Cao, J.; Zhang, S.; Zhang, H.; Wu, X.; Zhang, Q.; Liu, X. Selection and assessment of reference genes for quantitative PCR normalization in migratory locust Locusta migratoria (Orthoptera: Acrididae). PLoS ONE 2014, 9, e98164. [Google Scholar] [CrossRef] [PubMed]
  3. Jeon, J.H.; Moon, K.; Kim, Y.; Kim, Y.H. Reference gene selection for qRT-PCR analysis of season- and tissue-specific gene expression profiles in the honey bee Apis mellifera. Sci. Rep. 2020, 10, 13935. [Google Scholar] [CrossRef] [PubMed]
  4. Chen, M.D.; Wang, B.; Li, Y.P.; Zeng, M.J.; Liu, J.T.; Ye, X.R.; Zhu, H.S.; Wen, Q.F. Reference gene selection for qRT-PCR analyses of luffa (Luffa cylindrica) plants under abiotic stress conditions. Sci. Rep. 2021, 11, 3161. [Google Scholar] [CrossRef]
  5. Wei, Z.H.; Liu, M.; Hu, C.; Yang, X.Q. Overexpression of glutathione s-transferase genes in field lambda-cyhalothrin-resistant population of Cydia pomonella: Reference gene selection and expression analysis. J. Agric. Food Chem. 2020, 68, 5825–5834. [Google Scholar] [CrossRef]
  6. Zhao, X.; Geng, Y.; Hu, T.; Zhao, Y.; Yang, S.; Hao, D. Evaluation of optimal reference genes for qRT-PCR analysis in Hyphantria cunea (Drury). Insects 2022, 13, 97. [Google Scholar] [CrossRef]
  7. Rahman, S.; Zhao, Z.; Umair, S.M.; Zhang, Y.; Jiang, H. Case study using recommended reference genes actin and 18S for reverse-transcription quantitative real-time PCR analysis in Myzus persicae. PLoS ONE 2021, 16, e0258201. [Google Scholar] [CrossRef]
  8. Sellamuthu, G.; Amin, S.; Bily, J.; Synek, J.; Modlinger, R.; Sen, M.K.; Chakraborty, A.; Roy, A. Reference gene selection for normalizing gene expression in Ips Sexdentatus (Coleoptera: Curculionidae: Scolytinae) under different experimental conditions. Front. Physiol. 2021, 12, 752768. [Google Scholar] [CrossRef]
  9. Shen, C.H.; Peng, L.J.; Zhang, Y.X.; Zeng, H.R.; Yu, H.F.; Jin, L.; Li, G.Q. Reference genes for expression analyses by qRT-PCR in Phthorimaea operculella (Lepidoptera: Gelechiidae). Insects 2022, 13, 140. [Google Scholar] [CrossRef]
  10. Deng, Y.C.; Zhao, H.X.; Yang, S.; Zhang, L.; Zhang, L.N.; Hou, C.S. Screening and validation of reference genes for RT-qPCR under different honey bee Viral Infections and dsRNA treatment. Front. Microbiol. 2020, 11, 1715. [Google Scholar] [CrossRef]
  11. Zhang, B.Z.; Liu, J.J.; Chen, X.L.; Yuan, G.H. Selection and evaluation of reference genes for gene expression using quantitative real-time PCR in Mythimna separata walker (Lepidoptera: Noctuidae). Entomol. Res. 2018, 48, 390–399. [Google Scholar] [CrossRef]
  12. Nakamura, A.M.; Chahad-Ehlers, S.; Lima, A.L.; Taniguti, C.H.; Sobrinho, I.J.; Torres, F.R.; de Brito, R.A. Reference genes for accessing differential expression among developmental stages and analysis of differential expression of OBP genes in Anastrepha obliqua. Sci. Rep. 2016, 6, 17480. [Google Scholar] [CrossRef] [PubMed]
  13. Shakeel, M.; Rodriguez, A.; Tahir, U.B.; Jin, F. Gene expression studies of reference genes for quantitative real-time PCR: An overview in insects. Biotechnol. Lett. 2018, 40, 227–236. [Google Scholar] [CrossRef] [PubMed]
  14. Zheng, X.S.; Ren, X.B.; Su, J.Y. Insecticide susceptibility of Cnaphalocrocis medinalis (Lepidoptera: Pyralidae) in China. J. Econ. Entomol. 2011, 104, 653–658. [Google Scholar] [CrossRef] [PubMed]
  15. Deng, Q.Q.; Ye, M.; Wu, X.B.; Song, J.; Wang, J.; Chen, L.N.; Zhu, Z.Y.; Xie, J. Damage of brown planthopper (BPH) Nilaparvata lugens and rice leaf folder (RLF) Cnaphalocrocis medinalis in parent plants lead to distinct resistance in ratoon rice. Plant Signal. Behav. 2022, 17, 2096790. [Google Scholar] [CrossRef]
  16. Lv, W.X.; Jiang, X.F.; Chen, X.J.; Cheng, Y.X.; Xia, J.X.; Zhang, L. Flight and reproduction variations of rice leaf roller, Cnaphalocrocis medinalis in response to different rearing temperatures. Insects 2021, 12, 1083. [Google Scholar] [CrossRef]
  17. Guo, J.W.; Cui, Y.D.; Lin, P.J.; Zhai, B.P.; Lu, Z.X.; Chapman, J.W.; Hu, G. Male nutritional status does not impact the reproductive potential of female Cnaphalocrocis medinalis moths under conditions of nutrient shortage. Insect Sci. 2021, 29, 467–477. [Google Scholar] [CrossRef]
  18. Guo, J.W.; Yang, F.; Li, P.; Liu, X.D.; Wu, Q.L.; Hu, G.; Zhai, B.P. Female bias in an immigratory population of Cnaphalocrocis medinalis moths based on field surveys and laboratory tests. Sci. Rep. 2019, 9, 18388. [Google Scholar] [CrossRef]
  19. Liang, G.C.; Ouyang, Y.C.; Dai, S.M. Detection and classification of rice infestation with rice leaf folder (Cnaphalocrocis medinalis) using hyperspectral imaging techniques. Remote Sens. 2021, 13, 4587. [Google Scholar] [CrossRef]
  20. Alka, K.; Rabindra, P. Impact of abiotic factors on incidence of rice leaf folder (Cnaphalocrocis medinalis Guenée) in agro-climatic condition of Ranchi, Jharkhand. J. Eco-Friendly Agric. 2022, 17, 100–104. [Google Scholar]
  21. Vennila, S.; Adlul, I.; Nisar, S.; Bhat, M.N.; Ankur, T.; Sanjay, S.; Preetinder, S.S.; Mathirajan, V.G.; Rao, M.S.; Prabhakar, M. Prediction of rice leaf folder Cnaphalocrosis medinalis (Guenée) for future periods under climate change scenario of 4.5 representative concentration pathway. Plant Prot. Sci. 2019, 27, 214. [Google Scholar] [CrossRef]
  22. Liu, S.; Rao, X.J.; Li, M.Y.; Feng, M.F.; He, M.Z.; Li, S.G. Glutathione s-transferase genes in the leaffolder, Cnaphalocrocis medinalis (Lepidoptera; Pyralidae): Indentication and expression profiles. Arch. Insect Biochem. Physiol. 2015, 90, 1–13. [Google Scholar] [CrossRef] [PubMed]
  23. Han, G.J.; Liu, Q.; Li, C.M.; Xu, B.; Xu, J. Transcriptome sequencing reveals Cnaphalocrocis medinalis against baculovirus infection by oxidative stress. Mol. Immunol. 2021, 129, 63–69. [Google Scholar] [CrossRef] [PubMed]
  24. Wen, N.; Chen, J.J.; Chen, G.; Du, L.X.; Chen, H.; Li, Y.H.; Peng, Y.F.; Yang, X.W.; Han, L.Z. The overexpression of insect endogenous microRNA in transgenic rice inhibits the pupation of Chilo suppressalis and Cnaphalocrocis medinalis. Pest Manag. Sci. 2021, 77, 3990–3999. [Google Scholar] [CrossRef]
  25. Shakeel, M.; Du, J.; Li, S.W.; Zhou, Y.J.; Sarwar, N.; Bukhari, S.A.H. Characterization, knockdown and parental effect of hexokinase gene of Cnaphalocrocis medinalis (Lepidoptera: Pyralidae) revealed by RNA interference. Genes 2020, 11, 1258. [Google Scholar] [CrossRef]
  26. Chen, J.; Li, C.; Yang, Z.F. Identification and expression of two novel cytochrome P450 genes, CYP6CV1 and CYP9A38, in Cnaphalocrocis medinalis (Lepidoptera: Pyralidae). J. Insect Sci. 2015, 15, 50. [Google Scholar] [CrossRef]
  27. Tian, P.; Qiu, L.; Zhou, A.; Chen, G.; He, H.; Ding, W.; Li, Y. Evaluation of appropriate reference genes for investigating gene expression in Chlorops oryzae (Diptera: Chloropidae). J. Econ. Entomol. 2019, 112, 2207–2214. [Google Scholar] [CrossRef]
  28. Tan, Y.; Zhou, X.R.; Pang, B.P. Reference gene selection and evaluation for expression analysis using qRT-PCR in Galeruca daurica (Joannis). Bull. Entomol. Res. 2016, 107, 359–368. [Google Scholar] [CrossRef]
  29. Liu, Z.Y.; Han, H.; Chen, W.; Wang, S.W.; Meng, F.M.; Cai, J.F.; Guo, Y.D. Evaluation of reference genes and age estimation of forensically useful Aldrichina grahami (Diptera: Calliphoridae) during intrapuparial period. J. Med. Entomol. 2021, 58, 47–55. [Google Scholar] [CrossRef]
  30. Chen, C.; Li, S.Y.; Zhu, H.; Fan, B.Q.; Wang, Y.; Hao, D.J. Identification and evaluation of reference genes for gene expression analysis in the weevil pest Pagiophloeus tsushimanus using RT-qPCR. J. Asia-Pacif. Entomol. 2020, 23, 336–344. [Google Scholar] [CrossRef]
  31. Li, X.N.; Gong, P.P.; Wang, B.T.; Wang, C.; Li, M.Y.; Zhang, Y.H.; Li, X.R.; Gao, H.F.; Ju, J.S.; Zhu, X. Selection and validation of experimental condition-specific reference genes for qRT-PCR in Metopolophium dirhodum (Walker) (Hemiptera: Aphididae). Sci. Rep. 2020, 10, 21951. [Google Scholar] [CrossRef] [PubMed]
  32. Lu, J.; Yang, C.X.; Zhang, Y.J.; Pan, H.P. Selection of reference genes for the normalization of RT-qPCR data in gene expression studies in insects: A systematic review. Front. Physiol. 2018, 9, 1560. [Google Scholar] [CrossRef] [PubMed]
  33. Yang, Y.J.; Xu, H.X.; Wu, Z.H.; LU, Z.X. Effects of inhibitors on the protease profiles and degradation of activated Cry toxins in larval midgut juices of Cnaphalocrocis medinalis (Lepidoptera: Pyralidae). J. Integr. Agric. 2021, 20, 2195–2203. [Google Scholar] [CrossRef]
  34. Zhu, A.X.; Qiu, Q.; Liu, X.D. A method for rearing the rice leaf folder(Cnaphalocrocis medinalis) using wheat seedlings. J. Appl. Entomol. 2015, 52, 883–889. [Google Scholar]
  35. Tu, K.Y.; Tsai, S.F.; Guo, T.W.; Lin, H.H.; Yang, Z.W.; Liao, C.T.; Chuang, W.P. The role of plant abiotic factors on the interactions between Cnaphalocrocis medinalis (Lepidoptera: Crambidae) and its host plant. Environ. Entomol. 2018, 47, 857–866. [Google Scholar] [CrossRef]
  36. Huang, J.C.; Zhang, G.A.; Wang, B.P. Effects of age, ambient temperature and reproductive status on wing beat frequency of the rice leaf roller Cnaphalocrocis medinalis (Guenée) (Lepidoptera: Crambidae). Appl. Entomol. Zool. 2013, 48, 499–505. [Google Scholar] [CrossRef]
  37. Wang, F.Y.; Yang, F.; Lu, M.H.; Luo, S.Y.; Zhai, B.P.; Lim, K.S.; McInerney, C.E.; Hu, G. Determining the migration duration of rice leaf folder (Cnaphalocrocis medinalis (Guenée)) moths using a trajectory analytical approach. Sci. Rep. 2017, 7, 39853. [Google Scholar] [CrossRef]
  38. Green, M.R.; Sambrook, J. Removing DNA contamination from RNA samples by treatment with RNase-free DNase I. Cold Spring Harb. Protoc. 2019, 10, 709–710. [Google Scholar] [CrossRef]
  39. Zhao, X.X.; Xu, H.X.; He, K.; Shi, Z.M.; Chen, X.; Ye, X.H.; Mei, Y.; Yang, Y.J.; Li, M.Z.; Gao, L.B.; et al. A chromosome-level genome assembly of rice leaffolder, Cnaphalocrocis medinalis. Mol. Ecol. Resour. 2021, 21, 561–572. [Google Scholar] [CrossRef]
  40. Derveaux, S.; Vandesompele, J.; Hellemans, J. How to do successful gene expression analysis using real-time PCR. Nat. Methods 2010, 50, 227–230. [Google Scholar] [CrossRef]
  41. Wang, Z.; Meng, Q.Q.; Zhu, X.; Sun, S.W.; Liu, A.Q.; Gao, S.F.; Gou, Y.F. Identification and evaluation of reference genes for normalization of gene expression in developmental stages, sexes, and tissues of Diaphania caesalis (Lepidoptera, Pyralidae). J. Insect Sci. 2020, 20, 1–9. [Google Scholar] [CrossRef] [PubMed]
  42. Liang, C.; Han, S.P.; Han, H.; Zhao, F.; He, Y.Z. Selection of reference genes for Harmonia axyridis (Coleoptera: Coccinellidae) feeding on different diets. J. Asia-Pacif. Entomol. 2019, 22, 1115–1122. [Google Scholar] [CrossRef]
  43. Qu, C.; Wang, R.; Che, W.N.; Zhu, X.; Li, F.Q.; Luo, C. Selection and evaluation of reference genes for expression analysis using quantitative real-time PCR in the Asian Ladybird Harmonia axyridis (Coleoptera: Coccinellidae). PLoS ONE 2018, 13, e0192521. [Google Scholar] [CrossRef] [PubMed]
  44. Vandesompele, J.; Katleen, D.P.; Filip, P.; Bruce, P.; Nadine, V.R.; Anne, D.P.; Frank, S. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, research0034.1–research0034.11. [Google Scholar] [CrossRef]
  45. Wang, X.; Xiong, M.; Wang, J.; Lei, C.; Zhu, F. Reference gene stability of a synanthropic fly, Chrysomya megacephala. Parasit Vectors 2015, 8, 565. [Google Scholar] [CrossRef] [PubMed]
  46. Lu, Y.H.; Zheng, X.S.; Liang, Q.; Xu, H.X.; Yang, Y.J.; Tian, J.C.; He, X.C.; Lu, Z.X. Evaluation and validation of reference genes for SYBR Green qRT-PCR normalization in Sesamia inferens (Lepidoptera: Noctuidae). J. Asia-Pacif. Entomol. 2015, 18, 669–675. [Google Scholar] [CrossRef]
  47. Sellamuthu, G.; Bily, J.; Joga, M.R.; Synek, J.; Roy, A. Identifying optimal reference genes for gene expression studies in Eurasian spruce bark beetle, Ips typographus (Coleoptera: Curculionidae: Scolytinae). Sci. Rep. 2022, 12, 4671. [Google Scholar] [CrossRef]
  48. Toutges, M.J.; Hartzer, K.; Lord, J.; Oppert, B. Evaluation of reference genes for quantitative polymerase chain reaction across life cycle stages and tissue types of Tribolium castaneum. J. Agric. Food Chem. 2010, 58, 8948–8951. [Google Scholar] [CrossRef]
  49. Hansen, M.C.; Nielsen, A.K.; Molin, S.; Hammer, K.; Kilstrup, M. Changes in rRNA levels during stress invalidates results from mRNA blotting: Fluorescence in situ rRNA hybridization permits renormalization for estimation of cellular mRNA levels. J. Bacteriol. 2001, 183, 4747–4751. [Google Scholar] [CrossRef]
  50. Guo, J.W.; Li, P.; Zhang, J.; Liu, X.D.; Zhai, B.P.; Hu, G. Cnaphalocrocis medinalis moths decide to migrate when suffering nutrient shortage on the first day after emergence. Insects 2019, 10, 364. [Google Scholar] [CrossRef] [PubMed]
  51. Colell, A.; Green, D.R.; Ricci, J.E. Novel roles for GAPDH in cell death and carcinogenesis. Cell Death Differ. 2009, 16, 1573–1581. [Google Scholar] [CrossRef] [PubMed]
  52. Ma, K.S.; Li, F.; Liang, P.Z.; Chen, X.W.; Liu, Y.; Gao, X.W. Identification and validation of reference genes for the normalization of gene expression data in qRT-PCR analysis in Aphis gossypii (Hemiptera: Aphididae). J. Insect Sci. 2016, 16, 1–9. [Google Scholar] [CrossRef] [PubMed]
  53. Yu, Y.C.; Zhang, J.; Huang, C.; Hou, X.J.; Sun, X.L.; Xiao, B. Reference genes selection for quantitative gene expression studies in tea green leafhoppers, Empoasca onukii Matsuda. PLoS ONE 2018, 13, e0205182. [Google Scholar] [CrossRef] [PubMed]
  54. Pinheiro, D.H.; Siegfried, B.D. Selection of reference genes for normalization of RT-qPCR data in gene expression studies in Anthonomus eugenii Cano (Coleoptera: Curculionidae). Sci. Rep. 2020, 10, 5070. [Google Scholar] [CrossRef] [PubMed]
  55. Labroussaa, F.; Dubrana, M.P.; Nathalie, A.B.; Béven, L.; Saillard, C. Involvement of a minimal actin-binding region of Spiroplasma citri phosphoglycerate kinase in spiroplasma transmission by its leafhopper vector. PLoS ONE 2011, 6, e17357. [Google Scholar] [CrossRef] [PubMed]
  56. Rehfuss, L.R.; Feng, Y.; Lissemore, J.L.; Sullivan, D.T. Structure and expression of the phosphoglycerate kinase (Pgk) gene of Drosophila melanogaster. Mol. Gen. Genet. 1992, 235, 213–220. [Google Scholar] [CrossRef]
  57. Dzaki, N.; Azzam, G. Assessment of Aedes albopictus reference genes for quantitative PCR at different stages of development. PLoS ONE 2018, 13, e0194664. [Google Scholar] [CrossRef]
  58. Lazarević, J.; Tomanić, M.J. Dietary and phylogenetic correlates of digestive trypsin activity in insect pests. Entomol. Exp. Appl. 2015, 157, 123–151. [Google Scholar] [CrossRef]
  59. Fu, W.; Xie, W.; Zhang, Z.; Wang, S.L.; Wu, Q.J.; Liu, Y.; Zhou, X.M.; Zhou, X.G.; Zhang, Y.J. Exploring valid reference genes for quantitative real-time PCR analysis in Plutella xylostella (Lepidoptera: Plutellidae). Int. J. Biol. Sci. 2013, 9, 792–802. [Google Scholar] [CrossRef]
  60. Quan, P.Q.; Li, M.Z.; Wang, G.R.; Gu, L.L.; Liu, X.D. Comparative transcriptome analysis of the rice leaf folder (Cnaphalocrocis medinalis) to heat acclimation. BMC Genom. 2020, 21, 450. [Google Scholar] [CrossRef]
  61. Yang, Y.J.; Xu, H.X.; Lu, Y.H.; Wang, C.Y.; Lu, Z.X. Midgut transcriptomal response of the rice leaffolder, Cnaphalocrocis medinalis (Guenée) to Cry1C toxin. PLoS ONE 2018, 13, e0191686. [Google Scholar] [CrossRef] [PubMed]
  62. Guo, P.L.; Guo, Z.Q.; Liu, X.D. Cuticular protein genes involve heat acclimation of insect larvae under global warming. Insect Mol. Biol. 2022, 31, 519–532. [Google Scholar] [CrossRef] [PubMed]
  63. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
  64. Yu, H.Z.; Wen, D.F.; Wang, W.L.; Geng, L.; Zhang, Y.; Xu, J.P. Identification of genes putatively involved in chitin metabolism and insecticide detoxification in the rice leaf folder (Cnaphalocrocis medinalis) larvae through transcriptomic analysis. Int. J. Mol. Sci. 2015, 16, 21873–21896. [Google Scholar] [CrossRef] [PubMed]
  65. Shakeel, M.; Du, J.; Li, S.W.; Zhou, Y.J.; Sarwar, N.; Guo, X. Glucosamine-6-phosphate N-acetyltransferase gene silencing by parental RNA interference in rice leaf folder, Cnaphalocrocis medinalis (Lepidoptera: Pyralidae). Sci. Rep. 2022, 12, 2141. [Google Scholar] [CrossRef]
Figure 1. Expression profiles of candidate reference genes under eight experimental conditions. (A) developmental stages; (B) larval tissues; (C) larvae feeding on different rice varieties; (D) larvae temperature treatments; (E) adult ages; (F) adult nutritional conditions; (G) adult mating statuses; (H) different adult take-off characteristics. Lines across the Violin plots depict the medians of Ct values. Black dots represent measured values (jitter effect was applied to avoid overplotting).
Figure 1. Expression profiles of candidate reference genes under eight experimental conditions. (A) developmental stages; (B) larval tissues; (C) larvae feeding on different rice varieties; (D) larvae temperature treatments; (E) adult ages; (F) adult nutritional conditions; (G) adult mating statuses; (H) different adult take-off characteristics. Lines across the Violin plots depict the medians of Ct values. Black dots represent measured values (jitter effect was applied to avoid overplotting).
Insects 13 01046 g001
Figure 2. Expression stability of the candidate reference genes under eight experimental conditions calculated by RefFinder: (A) developmental stages; (B) larval tissues; (C) larvae feeding on different rice varieties; (D) larvae temperature treatments; (E) adult ages; (F) adult nutritional conditions; (G) adult mating statuses; (H) different adult take-off characteristics. A lower Geomean order indicated more stable expression.
Figure 2. Expression stability of the candidate reference genes under eight experimental conditions calculated by RefFinder: (A) developmental stages; (B) larval tissues; (C) larvae feeding on different rice varieties; (D) larvae temperature treatments; (E) adult ages; (F) adult nutritional conditions; (G) adult mating statuses; (H) different adult take-off characteristics. A lower Geomean order indicated more stable expression.
Insects 13 01046 g002
Figure 3. Determination of optimal number of normalization factors in C. medinalis under eight experimental treatments. The pairwise variation (Vn/Vn+1) was analyzed by geNorm algorithm. When the V value is below 0.15, there is no need to add additional reference genes for normalization.
Figure 3. Determination of optimal number of normalization factors in C. medinalis under eight experimental treatments. The pairwise variation (Vn/Vn+1) was analyzed by geNorm algorithm. When the V value is below 0.15, there is no need to add additional reference genes for normalization.
Insects 13 01046 g003
Figure 4.  Expression of Try3 gene under different rice feeding using validated reference genes for data normalization. Four reference gene combinations (PGK, EF1β + PGK, UCCR, UCCR + AK) were used for the normalization. The data in the figure were the mean ± standard error. Different lowercase letters indicate that, after normalization with the same reference gene, there was a significant difference in the expression level of Try3 in larvae of C. medinalis feeding on different rice varieties (Tukey’s HSD-p < 0.05). Different uppercase letters indicate that there were significant differences in the normalization results of each reference gene (Tukey’s HSD-p < 0.05).
Figure 4.  Expression of Try3 gene under different rice feeding using validated reference genes for data normalization. Four reference gene combinations (PGK, EF1β + PGK, UCCR, UCCR + AK) were used for the normalization. The data in the figure were the mean ± standard error. Different lowercase letters indicate that, after normalization with the same reference gene, there was a significant difference in the expression level of Try3 in larvae of C. medinalis feeding on different rice varieties (Tukey’s HSD-p < 0.05). Different uppercase letters indicate that there were significant differences in the normalization results of each reference gene (Tukey’s HSD-p < 0.05).
Insects 13 01046 g004
Table 1. Primer sequences and amplicon characteristics of the thirteen reference genes in Cnaphalocrocis medinalis.
Table 1. Primer sequences and amplicon characteristics of the thirteen reference genes in Cnaphalocrocis medinalis.
Gene NameGene SymbolPrimer Sequence (5′ to 3′)Product Size (bp)Tm (°C)Efficiency (%)Regression Coefficient (R2)Slope
Elongation factor 1 αEF1αF: CTGCTGTCGCTTTCGTCCC
R: CTTGCCCTCAGCCTTACCCTC
122551050.992−3.217
Arginine kinaseAKF: CGCAACCCTCGAGAAATTGGA
R: ACACCCGACTGGATGCAA
159551120.996−3.071
Elongation factor 1 βEF1βF: CTTCTTACACTCCCGCCGAAC
R: GCGTCCTCTTCCTCATCACC
154551080.996−3.135
Glyceraldehyde-3-Phosphate
dehydrogenase
GAPDHF: CTGCCACTCAAAAGACCGT
R: AAGGCCATACCAGTCAGT
154531040.992−3.233
Phosphoglycerate kinasePGKF: CAGCCCTCATTGCAAAGTCC
R: GCAGCTTGTTGATTCCATAACCA
162571090.999−3.115
Ribosomal protein L 13RPL13F: ATCAACAGCCGTCAGATCG
R: TTTCCATTGTGTGTCGCCTC
193551090.995−3.117
Ribosomal protein L 18RPL18F: GGCGCACCGAAGTTAAATCTCA
R: AGCCACGGTCATCTTAGGAAC
263541100.996−3.111
Ribosomal protein S 3RPS3F: AGGTTCAACATCCCCGAGCA
R: CGGACACAACAACCTCGCAAC
193551090.995−3.114
18S ribosomal RNA18S rRNAF: TTTTATAATGCCGACGAAGCGAGA
R: CCCGAAAGCCCTGAACCAC
155561040.990−3.226
TATA-box binding protein 1TBP1F: AATGCTGAATACAACCCGAAG
R: TCCTAGCAGCTAATCTTGAGT
142551080.982−3.141
TATA-box binding protein 2TBP2F: ATAACCAATGCTGCAAACACC
R: CGCTGTCTTTCATTTGTAGAACCA
128551080.996−3.146
β-actinACTF: CACACAGTGCCCATCTACGA
R: GCGGTGGTGGTGAATGAGTA
125551020.998−3.276
Ubiquinol-cytochrome c reductaseUCCRF: ACAGTCGCCTTCAAAGCTGGT
R: CCAATCTGTGCCAACTTGCGT
165551190.999−2.937
Table 2. Ranking of the candidate reference genes in C. medinalis under different conditions.
Table 2. Ranking of the candidate reference genes in C. medinalis under different conditions.
Experimental ConditionsRankingΔCtBestKeeperNormFindergeNorm
Developmental
stages
1EF1β1.264GAPDH0.660RPL180.537EF1β
PGK
0.632
2PGK1.278EF1β0.798PGK0.570
3RPL181.286RPL180.800EF1β0.587EF1α0.838
4EF1α1.332EF1α0.840EF1α0.682RPL180.745
5ACT1.375PGK0.875ACT0.733ACT0.922
6RPS31.395RPS30.911RPS30.813RPS30.955
7GAPDH1.403RPL130.997GAPDH0.858GAPDH0.996
8TBP21.470ACT1.005TBP20.906TBP21.053
9TBP11.594TBP21.023TBP11.127TBP11.114
10AK1.780TBP11.302AK1.397RPL131.204
11RPL131.813AK1.398RPL131.469AK1.289
12UCCR2.304UCCR1.426UCCR2.065UCCR1.440
1318S rRNA2.44918S rRNA2.02718S rRNA2.33918S rRNA1.595
Larval tissues1RPL181.270EF1α0.624RPS30.15318S rRNA
TBP1
0.371
2RPS31.283TBP20.894RPL180.153
3TBP11.318RPS30.896EF1α0.219RPL180.446
4EF1α1.367EF1β0.990TBP10.326RPS30.490
518S rRNA1.414PGK1.00618S rRNA0.585PGK0.586
6PGK1.457TBP11.027PGK0.633EF1β0.640
7EF1β1.508RPL181.029EF1β0.738EF1α0.697
8GAPDH1.557RPL131.081GAPDH0.773RPL130.761
9RPL131.62618S rRNA1.113RPL130.933GAPDH0.832
10AK1.802GAPDH1.125AK1.115AK0.941
11TBP21.837AK1.261TBP21.121TBP21.035
12ACT4.052ACT3.144ACT3.944ACT1.494
13UCCR4.054UCCR3.450UCCR3.949UCCR1.888
Larvae feeding on different rice varieties1EF1β0.529PGK0.322EF1β0.177EF1β
PGK
0.247
2PGK0.563EF1α0.328PGK0.249
3EF1α0.597EF1β0.36618S rRNA0.293ACT0.284
4TBP10.597ACT0.420TBP10.299EF1α0.296
518S rRNA0.604GAPDH0.435EF1α0.341RPL180.324
6ACT0.612RPL180.458RPL180.355TBP10.371
7RPL180.619TBP10.466ACT0.37318S rRNA0.399
8GAPDH0.69118S rRNA0.513GAPDH0.441RPS30.433
9TBP20.755RPS30.532TBP20.553GAPDH0.466
10RPS30.757TBP20.533RPS30.609TBP20.509
11RPL130.868UCCR0.638RPL130.699RPL130.566
12AK1.007AK0.735AK0.870AK0.635
13UCCR1.209RPL130.807UCCR1.114UCCR0.724
Larvae temperature treatments1EF1β0.895EF1α0.387EF1β0.412EF1α
PGK
0.507
2RPS30.921PGK0.426TBP10.464
3EF1α0.924RPL180.515TBP20.489RPS30.555
4PGK0.933RPS30.565EF1α0.506EF1β0.597
5TBP10.937EF1β0.648RPS30.520TBP20.659
6TBP20.942TBP10.687PGK0.574TBP10.684
7GAPDH0.998GAPDH0.696GAPDH0.632GAPDH0.713
8RPL181.040RPL130.740RPL130.715RPL180.735
9RPL131.056TBP20.835RPL180.743RPL130.770
10AK1.146ACT0.863AK0.885AK0.805
11ACT1.211AK1.023ACT0.896ACT0.869
1218S rRNA1.40218S rRNA1.29118S rRNA1.16818S rRNA0.953
13UCCR1.925UCCR1.602UCCR1.803UCCR1.102
Adult ages1PGK1.041UCCR0.807PGK0.202PGK
RPL13
0.404
2RPL131.110ACT0.892EF1α0.281
3EF1α1.113GAPDH1.022RPL130.302EF1α0.426
4RPS31.161EF1α1.158RPS30.488EF1β0.505
5EF1β1.197AK1.231EF1β0.538RPS30.556
6RPL181.231RPL131.374RPL180.602RPL180.615
7TBP11.392PGK1.396TBP10.902TBP10.739
8UCCR1.546EF1β1.401UCCR1.136UCCR0.886
9GAPDH1.668RPS31.709GAPDH1.334ACT1.020
10TBP21.692RPL181.744TBP21.365GAPDH1.117
11ACT1.712TBP11.960ACT1.380TBP21.203
12AK2.134TBP22.075AK1.960AK1.335
1318S rRNA2.31418S rRNA2.91918S rRNA2.18418S rRNA1.485
Adult nutritional conditions1PGK1.024ACT0.379PGK0.169EF1α
PGK
0.338
2EF1α1.061EF1β0.520EF1α0.310
3RPL131.140EF1α0.594RPL130.380RPL180.481
4RPL181.152RPL180.710RPL180.512ACT0.554
5RPS31.205AK0.718RPS30.512RPL130.628
6ACT1.214PGK0.808GAPDH0.570GAPDH0.709
7GAPDH1.221UCCR0.896TBP10.627RPS30.768
8TBP11.256GAPDH0.911ACT0.721TBP10.807
9EF1β1.351RPL131.000EF1β0.952EF1β0.857
10AK1.411TBP11.377AK1.013AK0.904
11TBP21.609RPS31.430TBP21.232TBP21.004
12UCCR2.236TBP21.957UCCR2.145UCCR1.173
1318S rRNA2.98218S rRNA3.39518S rRNA2.93318S rRNA1.451
Adult mating statuses1RPL181.230UCCR0.560RPL180.088EF1α
PGK
0.210
2PGK1.248AK0.707RPL130.249
3ACT1.271RPS31.105PGK0.268EF1β0.261
4RPL131.286ACT1.260ACT0.412RPL180.277
5EF1β1.295EF1β1.465EF1β0.478ACT0.331
6EF1α1.316RPL181.488EF1α0.518RPS30.398
7RPS31.341EF1α1.555RPS30.576RPL130.454
8GAPDH1.558PGK1.573GAPDH0.668GAPDH0.608
9TBP22.027GAPDH1.583TBP21.540TBP20.887
10TBP12.102RPL131.717TBP11.660TBP11.065
11AK2.234TBP23.040AK1.974AK1.224
12UCCR2.669TBP13.116UCCR2.564UCCR1.433
1318S rRNA3.81418S rRNA4.84518S rRNA3.77018S rRNA1.799
Different adult take-off characteristics1RPS30.374ACT0.208RPS30.085PGK
RPS3
0.093
2PGK0.391UCCR0.240PGK0.186
3RPL180.410EF1α0.258RPL130.203ACT0.156
4EF1α0.414AK0.276RPL180.222EF1α0.165
5ACT0.419PGK0.310EF1α0.237RPL180.188
6RPL130.423RPS30.340ACT0.264RPL130.212
7TBP10.463RPL180.364TBP10.278UCCR0.247
8TBP20.478RPL130.392TBP20.312AK0.277
918S rRNA0.524TBP20.58118S rRNA0.381TBP10.316
10UCCR0.535TBP10.592UCCR0.459TBP20.347
11AK0.56918S rRNA0.661AK0.48318S rRNA0.375
12EF1β0.672EF1β0.668EF1β0.566EF1β0.424
13GAPDH1.007GAPDH0.973GAPDH0.957GAPDH0.514
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Zhao, X.; Guo, J.; Lu, Y.; Sun, T.; Tian, J.; Huang, J.; Xu, H.; Wang, Z.; Lu, Z. Reference Genes for Expression Analysis Using RT-qPCR in Cnaphalocrocis medinalis (Lepidoptera: Pyralidae). Insects 2022, 13, 1046. https://doi.org/10.3390/insects13111046

AMA Style

Zhao X, Guo J, Lu Y, Sun T, Tian J, Huang J, Xu H, Wang Z, Lu Z. Reference Genes for Expression Analysis Using RT-qPCR in Cnaphalocrocis medinalis (Lepidoptera: Pyralidae). Insects. 2022; 13(11):1046. https://doi.org/10.3390/insects13111046

Chicago/Turabian Style

Zhao, Xiaoyu, Jiawen Guo, Yanhui Lu, Tianyi Sun, Junce Tian, Jianlei Huang, Hongxing Xu, Zhengliang Wang, and Zhongxian Lu. 2022. "Reference Genes for Expression Analysis Using RT-qPCR in Cnaphalocrocis medinalis (Lepidoptera: Pyralidae)" Insects 13, no. 11: 1046. https://doi.org/10.3390/insects13111046

APA Style

Zhao, X., Guo, J., Lu, Y., Sun, T., Tian, J., Huang, J., Xu, H., Wang, Z., & Lu, Z. (2022). Reference Genes for Expression Analysis Using RT-qPCR in Cnaphalocrocis medinalis (Lepidoptera: Pyralidae). Insects, 13(11), 1046. https://doi.org/10.3390/insects13111046

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop