Function and Characterization Analysis of BodoOBP8 from Bradysia odoriphaga (Diptera: Sciaridae) in the Recognition of Plant Volatiles and Sex Pheromones
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Insect Rearing and Chemical Ligands
2.2. Cloning, Sequencing, and Phylogenetic Analysis of BodoOBP8
2.3. qRT-PCR
2.4. Bacterial Expression and Purification of BodoOBP8
2.5. Fluorescence Binding Assays
2.6. Homology Modeling and Molecular Docking
3. Results
3.1. Characteristics, Sequence, and Phylogenetic Analysis of BodoOBP8
3.2. Spatio-Temporal Expression Analysis of BodoOBP8
3.3. Expression, Purification, and Fluorescence Competitive Binding Assays of BodoOBP8
3.4. D model of BodoOBP8 and Molecular Docking
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Li, W.X.; Yang, Y.T.; Xie, W.; Wu, Q.J.; Xu, B.Y.; Wang, S.L.; Zhang, Y.J. Effects of temperature on the age-stage, two-sex life table of Bradysia odoriphaga (Diptera: Sciaridae). J. Econ. Entomol. 2015, 108, 126–134. [Google Scholar] [CrossRef]
- Yang, Y.T.; Li, W.X.; Xie, W.; Wu, Q.J.; Xu, B.Y.; Wang, S.L.; Zhang, Y.J. Development of Bradysia odoriphaga (Diptera: Sciaridae) as affected by humidity: An age-stage, two-sex, life-table study. Appl. Entomol. Zool. 2015, 50, 3–10. [Google Scholar] [CrossRef]
- Shi, C.H.; Hu, J.R.; Wei, Q.W.; Yang, Y.T.; Cheng, J.X.; Han, H.L.; Wu, Q.J.; Wang, S.L.; Xu, B.Y.; Su, Q.; et al. Control of Bradysia odoriphaga (Diptera: Sciaridae) by soil solarization. Crop. Prot. 2018, 114, 76–82. [Google Scholar] [CrossRef]
- Conchou, L.; Anderson, P.; Birgersson, G. Host plant species differentiation in a polyphagous moth: Olfaction is enough. J. Chem. Ecol. 2017, 43, 794–805. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.F.; Chen, H.H.; Li, J.K.; Zhang, R.; Turlings, T.C.; Chen, L. Volatiles released by Chinese liquorice roots mediate host location behaviour by neonate Porphyrophora sophorae (Hemiptera: Margarodidae). Pest Manag. Sci. 2016, 72, 1959–1964. [Google Scholar] [CrossRef] [PubMed]
- Collignon, R.M.; Swift, I.P.; Zou, Y.; McElfresh, J.S.; Hanks, L.M.; Millar, J.G. The in fluence of host plant volatiles on the attraction of longhorn beetles to pheromones. J. Chem. Ecol. 2016, 42, 215–229. [Google Scholar] [CrossRef]
- Cunningham, J.P.; Carlsson, M.A.; Villa, T.F.; Dekker, T.; Clarke, A.R. Do fruit ripening volatiles enable resource specialist in polyphagous fruit flies? J. Chem. Ecol. 2016, 42, 931–940. [Google Scholar] [CrossRef] [PubMed]
- Lee, G.; Joo, Y.; Diezel, C.; Lee, E.J.; Baldwin, I.T.; Kim, S.G. Trichobaris weevils distinguish amongst toxic host plants by sensing volatiles that do not affect larval performance. Mol. Ecol. 2016, 25, 3509–3519. [Google Scholar] [CrossRef]
- Bruce, T.J.; Pickett, J.A. Perception of plant volatile blends by herbivorous insects-finding the right mix. Phytochemistry 2011, 72, 1605–1611. [Google Scholar] [CrossRef]
- Tabanca, N.; Demirci, B.; Kiyan, H.T.; Ali, A.; Bernier, U.R.; Wedge, D.E.; Khan, I.A.; Başer, K.H.C. Repellent and larvicidal activity of Ruta graveolens essential oil and its major individual constituents against Aedes aegypti. Planta Med. 2012, 78, 90. [Google Scholar] [CrossRef]
- St Onge, A.; Cárcamo, H.A.; Evenden, M.L. Evaluation of semiochemical-baited traps for monitoring the pea leaf weevil, Sitona lineatus (Coleoptera: Curculionidae) in field pea crops. Environ. Entomol. 2018, 47, 93–106. [Google Scholar] [CrossRef] [PubMed]
- Silk, P.; Mayo, P.; Ryall, K.; Roscoe, L. Semiochemical and communication ecology of the emerald ash borer, Agrilus planipennis (Coleoptera: Buprestidae). Insects 2019, 10, 323. [Google Scholar] [CrossRef] [Green Version]
- Li, D.X.; Li, C.B.; Liu, D.G. Analyses of structural dynamics revealed flexible binding mechanism for the Agrilu mali odorant binding protein 8 towards plant volatiles. Pest Manag. Sci. 2021, 71, 1642–1653. [Google Scholar] [CrossRef] [PubMed]
- Mabrouka, G.; Salvatore, G.; Virgilio, C.; Filippo, S.; Milko, S.; Nuray, B.; Jouda MB., J.; Gabriella, L.V. Behavior-modifying and insecticidal effects of plant extracts on adults of Ceratitis capitata (Wiedemann) (Diptera Tephritidae). J. Pest. Sci. 2018, 91, 907–917. [Google Scholar]
- Lassance, J.M.; Ding, B.J.; Löfstedt, C. Evolution of the codling moth pheromone via an ancient gene duplication. BMC Biol. 2021, 19, 83. [Google Scholar] [CrossRef]
- Yang, Y.T.; Su, Q.; Shi, L.L.; Chen, G.; Zeng, Y.; Shi, C.H.; Zhang, Y.J. Electrophysiological and behavioural responses of Bradysia odoriphaga Yang et Zhang (Diptera: Sciaridae) to volatiles from its host plant, Chinese chives (Allium tuberosum Rottler). J. Econ. Entom. 2019, 112, 1638–1644. [Google Scholar] [CrossRef]
- Li, H.J.; He, X.K.; Zeng, A.J.; Liu, Y.J.; Jiang, S.R. Bradysia odoriphaga copulatory behavior and evidence of a female sex pheromone. J. Agricul. Urban Entomol. 2007, 24, 27–34. [Google Scholar] [CrossRef]
- Leal, W. Odorant reception in insects: Roles of receptors, binding proteins, and degrading enzymes. Annu. Rev. Entomol. 2013, 58, 373–391. [Google Scholar] [CrossRef]
- Pelosi, P.; Calvello, M.; Ban, L.P. Diversity of odorant-binding proteins and chemosensory proteins in insects. Chem. Senses 2005, 30, 291–292. [Google Scholar] [CrossRef] [Green Version]
- Li, N.; Sun, X.; Wang, M.Q. Expression pattern and ligand-binding properties odorant-binding protein 13 from Manochamus alternatus hope. J. Appl. Entomol. 2017, 141, 751–757. [Google Scholar] [CrossRef]
- Field, L.M.; Pickett, J.A.; Wadhams, L.J. Molecular studies in insect olfaction. Insect Mol. Biol. 2000, 9, 545–551. [Google Scholar] [CrossRef] [PubMed]
- Tian, W.; Zhang, T.; Gu, S.; Guo, Y.; Gao, X.; Zhang, Y. OBP14 (Odorant-Binding Protein) sensing in Adelphocoris lineolatus based on peptide nucleic acid and graphene oxide. Insects 2021, 12, 422. [Google Scholar] [CrossRef] [PubMed]
- Vogt, R.G.; Riddiford, L.M. Pheromone binding and inactivation by moth antennae. Nature 1981, 293, 161–163. [Google Scholar] [CrossRef] [PubMed]
- Vieira, F.G.; Rozas, J. Comparative genomics of the odorant-binding and chemosensory protein gene families across the arthropoda: Origin and evolutionary history of the chemosensory system. Genome Biol. Evol. 2011, 3, 476–490. [Google Scholar] [CrossRef] [PubMed]
- Fan, J.; Francis, F.; Liu, Y.; Chen, J.L.; Cheng, D.F. An overview of odorant-binding protein functions in insect peripheral olfactory reception. Genet. Mol. Res. 2011, 10, 3056–3069. [Google Scholar] [CrossRef] [PubMed]
- Northey, T.; Venthur, H.; De Biasio, F.; Chauviac, F.X.; Cole, A.; Ribeiro, K.A.L.; Grossi, G.; Falabella, P.; Field, L.M.; Keep, N.H.; et al. Crystal structures and binding dynamics of odorant-binding protein 3 from two aphid species Megoura viciae and Nasonovia ribisnigri. Sci. Rep. 2016, 6, 24739. [Google Scholar] [CrossRef] [PubMed]
- Venthur, H.; Zhou, J.J. Odorant receptors and odorant-binding proteins as insect pest control targets: A comparative analysis. Front. Physiol. 2018, 9, 1163. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Zhang, G.; Wang, M.Q. Chemosensory protein genes of Batocera horsfieldi (Hope): Identification and expression pattern. J. Appl. Entomol. 2012, 136, 781–792. [Google Scholar] [CrossRef]
- Zhang, H.; Chen, J.L.; Lin, J.H.; Lin, J.T.; Wu, Z.Z. Odorant-binding protein and chemosensory proteins potentially involved in host plant recognition in the Asian citrus psyllid, Diaphorina citri. Pest Manag. Sci. 2020, 76, 2609–2618. [Google Scholar] [CrossRef]
- Li, Z.Q.; Zhang, S.; Luo, Y.J.; Cui, J.J.; Ma, Y.; Dong, S.L. Two Minus-C odorant binding proteins from Helicoverpa armigera display higher ligand binding affinity at acidic pH than neutral pH. J. Insect. Physiol. 2013, 59, 263–272. [Google Scholar] [CrossRef]
- Wang, R.; Hu, Y.; Wei, P.L.; Qu, C.; Luo, C. Molecular and functional characterization of one odorant-binding protein gene OBP3 in Bemisia tabaci (Hemiptera: Aleyrodidae). J. Econom. Entomol. 2020, 113, 299–305. [Google Scholar] [CrossRef]
- Zhang, F.M.; Merchant, A.; Zhao, Z.B.; Zhang, Y.H.; Zhang, J.; Zhang, Q.W.; Wang, Q.H.; Li, X.R. Charaeterization of MaltOBP1, a Minus-C odorant-binding protein, from the Japanese Pine Sawyer Beetle, Monochamus alternatus Hope (Coleoptera: Cerambycidae). Front. Physiol. 2020, 11, 212. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- De Biasio, F.; Riviello, L.; Bruno, D.; Grimaldi, A.; Congiu, T.; Sun, Y.F.; Falabella, P. Expression pattern analysis of odorant-binding proteins in the pea aphid Acyrthosiphon pisum. Insect Sci. 2015, 22, 220–234. [Google Scholar] [CrossRef] [PubMed]
- Bruno, D.; Grossi, G.; Salvia, R.; Scala, A.; Farina, D.; Grimaldi, A.; Zhou, J.J.; Bufo, S.A.; Vogel, H.; Grosse-Wilde, E.; et al. Sensilla morphology and complex expression pattern of odorant binding proteins in the Vetch Aphid Megoura viciae (Hemiptera: Aphididae). Front. Physiol. 2018, 9, 777. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tang, B.W.; Tai, S.L.; Dai, W.; Zhang, C.C. Expression and functional analysis of two odorant-binding proteins from Bradysia odoriphaga (Diptera: Sciaridae). J. Agric. Food Chem. 2019, 67, 3565–3574. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.T.; Hua, D.K.; Shi, C.H.; Xie, W.; Zhang, Y.J. Molecular and binding characteristics of OBP5 of Bradysia odoriphaga (Diptera: Sciaridae). J. Econ. Entomol. 2021, 114, 1509–1516. [Google Scholar]
- Zhao, Y.; Ding, J.; Zhang, Z.; Liu, F.; Zhou, C.; Mu, W. Sex- and tissue-specific expression profiles of odorant binding protein and chemosensory protein genes in Bradysia odoriphaga (Diptera: Sciaridae). Front. Physiol. 2018, 9, 107. [Google Scholar] [CrossRef] [Green Version]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, 2002–2007. [Google Scholar] [CrossRef]
- Campanacci, V.; Krieger, J.; Bette, S.; Sturgis, J.N.; Lartigue, A.; Cambillau, C.; Breer, H.; Tegoni, M. Revisiting the specificity of Mamestra brassicae and Antheraea polyphemus pheromone-binding proteins with a fluorescence binding assay. J. Biol. Chem. 2001, 276, 20078–20084. [Google Scholar] [CrossRef] [Green Version]
- Zacharuk, R.Y. Ultratructure and function of insect chemosensillar. Annu. Rev. Entomol. 1980, 25, 17–47. [Google Scholar] [CrossRef]
- Pelosi, P.; Iovinella, I.; Zhu, J.; Wang, G.; Dani, F.R. Beyond chemoreception: Diverse tasks of soluble olfactory proteins in insects. Biol. Rev. Camb. Philos. Soc. 2018, 93, 184–200. [Google Scholar] [CrossRef] [Green Version]
- Pelosi, P.; Zhou, J.J.; Ban, L.P.; Calvello, M. Soluble proteins in insect chemical communication. Cell. Mol. Life Sci. 2006, 63, 1658–1676. [Google Scholar] [CrossRef]
- Zhou, J.J.; Field, L.M.; He, X.L. Insect odorant-binding proteins: Do they offer an alternative pest control strategy? Outlooks Pest Manag. 2010, 21, 31–34. [Google Scholar] [CrossRef]
- Pelosi, P.I.; Iovinella, F.A.; Dani, F.F. Soluble proteins of chemical communication: An overview across athrapods. Front. Physiol. 2014, 5, 320. [Google Scholar] [CrossRef] [Green Version]
- Liu, X.; Jiang, H.; Fan, J.; Liu, T.; Meng, L.; Liu, Y.; Yu, H.Z.; Dou, W.; Wang, J.J. An odorant-binding protein of Asian citrus psyllid, Diaphorina citri, participates in the response of host plant volatiles. Pest Manag. Sci. 2021, 77, 3068–3079. [Google Scholar] [CrossRef]
- Brito, N.F.; Moreira, M.F.; Melo, A.C.A. A look inside odorant-binding proteins in insect chemoreception. J. Insect Physiol. 2016, 95, 51–65. [Google Scholar] [CrossRef]
- Vogt, R.G.; Groβe-Wilde, E.; Zhou, J.J. The Lepidoptera odorant binding protein gene family: Gene gain and loss within the GOBP/PBP complex of moths and butterflies. Insect Biochem. Mol. Biol. 2015, 62, 142–153. [Google Scholar] [CrossRef]
- Zeng, F.F.; Sun, X.; Dong, H.B.; Wang, M.Q. Analysis of a cDNA library from the antenna of Cnaphalocrocis medinalis and the expression pattern of olfactory genes. Biochem. Biophys. Res. Commun. 2013, 433, 463–469. [Google Scholar] [CrossRef] [PubMed]
- Sun, L.; Wei, Y.; Zhang, D.D.; Ma, X.Y.; Xiao, Y.; Zhang, Y.N.; Yang, X.M.; Xiao, Q.; Guo, Y.Y.; Zhang, Y.J. The mouthparts enriched odorant binding protein 11 of the Alfalfa plant Bug Adelphocoris lineolatus displays a preferential Binding behavior to host plant secondary metabolites. Front. Physiol. 2016, 7, 201. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Qu, Y.; Liu, X.; Zhao, X.; Qin, J.; Cao, Y.; Li, K.; Zhou, J.J.; Wang, S.; Yin, J. Evidence of the involvement of a Plus-C odorant-binding protein HparOBP14 in host plant selection and oviposition of the Scarab Beetle Holotrichia parallela. Insects 2021, 12, 430. [Google Scholar] [CrossRef] [PubMed]
- Hua, J.F.; Pan, C.; Huang, Y.M.; Li, Y.Q.; Li, H.F.; Wu, C.R.; Chen, T.Y.; Ma, D.F.; Li, Z.Y. Functional characteristic analysis of three odorant-binding proteins from the sweet potato weevil (Cylas formicarius) in the perception of sex pheromones and host plant volatiles. Pest Manag. Sci. 2021, 77, 300–312. [Google Scholar] [CrossRef] [PubMed]
- Gu, S.H.; Wu, K.M.; Guo, Y.Y.; Pickett, J.A.; Field, L.M.; Zhou, J.J.; Zhang, Y.J. Identification of genes expressed in the sex pheromone gland of the black cutworm Agrotis ipsilon with putative roles in sex pheromone biosynthesis and transport. BMC Genomics 2013, 14, 636. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Łyczko, J.; Twardowski, J.P.; Skalny, B.; Galek, R.; Szumny, A.; Gruss, I.; Piesik, D.; Sendel, S. Sarracenia alata (Alph.Wood) Alph. wood microcuttings as a source of volatiles potentially responsible for insects’ respond. Molecules 2021, 26, 2406. [Google Scholar] [CrossRef] [PubMed]
- Piesik, D.; Bocianowski, J.; Sendel, S.; Krawczyk, K.; Kotwica, K. Beetle orientation responses of Gastrophysa viridula and Gastrophysa polygoni (Coleoptera: Chrysomelidae) to a blend of synthetic volatile organic compounds. Environ. Entomol. 2020, 49, 1071–1076. [Google Scholar] [CrossRef] [PubMed]
- Piesik, D.; Rochat, D.; Bocianowski, J.; Marion-Poll, F. Repellent activity of plants from the genus Chenopodium to Ostrinia nubilalis larvae. Plant Protect. Sci. 2018, 54, 265–271. [Google Scholar]
- Pelosi, P.; Mastrogiacomo, R.; Iovinella, I.; Tuccori, E.; Persaud, K.C. Structure and biotechnological applications of odorant-binding proteins. Appl. Microbiol. Biotechnol. 2014, 98, 61–70. [Google Scholar] [CrossRef]
- Wang, S.; Gu, S.; Han, L.; Guo, Y.; Zhou, J.; Zhang, Y. Specific involvement of two amino acid residues in cis-nerolidol binding to odorant-binding protein 5 AlinOBP5 in the alfalfa plant bug, Adelphocoris lineolatus (Goeze). Insect Mol. Biol. 2013, 22, 172–182. [Google Scholar] [CrossRef]
- Zhuang, X.; Wang, Q.; Wang, B.; Zhong, T.; Cao, Y.; Li, K.; Yin, J. Prediction of the key binding site of odorant-binding protein of Holotrichia oblita Faldermann (Coleoptera: Scarabaeida). Insect Mol. Biol. 2014, 23, 381–390. [Google Scholar]
- Dong, K.; Duan, H.X.; Liu, J.T.; Sun, L.; Gu, S.H.; Yang, R.N.; Dhiloo, K.H.; Gao, X.W.; Zhang, Y.J.; Guo, Y.Y. Key site residues of pheromone-binding protein 1 involved in interacting with sex pheromone components of Helicoverpa armigera. Sci. Rep. 2017, 7, 16859. [Google Scholar] [CrossRef] [Green Version]
- Liu, H.W.; Duan, H.X.; Wang, Q.; Xiao, Y.; Wang, Q.; Xiao, Q.; Sun, L.; Zhang, Y.J. Key Amino residues determining binding activities of the odorant binding protein AlucOBP22 to two host plant Terpenoids of Apolygus lucorum. J. Agric. Food Chem. 2019, 67, 5949–5956. [Google Scholar] [CrossRef]
Primer Name | Sequence (5′–3′) |
---|---|
For cloning OBP open reading frame | |
BodoOBP8 | GCACTTGTTCACAGTGTTTATGCTAG |
TCTGGGGAGTTTGAATTAACGAA | |
For spatial and temporal expression of OBP genes | |
BodoOBP8 | GTCGTCGAGTTGTGCAATGTG |
ACTCCACGACGATCCGAAAC | |
Heterologous expression of OBPs | |
BodoOBP8 | CACCGCTGACCTTCGTCGAGATGAGAAAT |
TCAGGGCAAGAAATAATGTTTCGGA |
Gene | Acc. No | Length of ORF | Amino Acid Length | Signal Peptide | Full ORF | Isoelectric Point PI | Mw (kDa) |
---|---|---|---|---|---|---|---|
OBP8 | MG544128.1 | 435 | 144 | 1–17 | Yes | 5.78 | 16.56 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, Y.; Luo, L.; Tian, L.; Zhao, C.; Niu, H.; Hu, Y.; Shi, C.; Xie, W.; Zhang, Y. Function and Characterization Analysis of BodoOBP8 from Bradysia odoriphaga (Diptera: Sciaridae) in the Recognition of Plant Volatiles and Sex Pheromones. Insects 2021, 12, 879. https://doi.org/10.3390/insects12100879
Yang Y, Luo L, Tian L, Zhao C, Niu H, Hu Y, Shi C, Xie W, Zhang Y. Function and Characterization Analysis of BodoOBP8 from Bradysia odoriphaga (Diptera: Sciaridae) in the Recognition of Plant Volatiles and Sex Pheromones. Insects. 2021; 12(10):879. https://doi.org/10.3390/insects12100879
Chicago/Turabian StyleYang, Yuting, Liang Luo, Lixia Tian, Changwei Zhao, Hongli Niu, Yifeng Hu, Caihua Shi, Wen Xie, and Youjun Zhang. 2021. "Function and Characterization Analysis of BodoOBP8 from Bradysia odoriphaga (Diptera: Sciaridae) in the Recognition of Plant Volatiles and Sex Pheromones" Insects 12, no. 10: 879. https://doi.org/10.3390/insects12100879