Knockdown of the Trehalose-6-Phosphate Synthase Gene Using RNA Interference Inhibits Synthesis of Trehalose and Increases Lethality Rate in Asian Citrus Psyllid, Diaphorina citri (Hemiptera: Psyllidae)
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. D. citri Rearing and Sample Collection
2.2. RNA Isolation and DcTPS cDNA Synthesis
2.3. Molecular Cloning
2.4. Bioinformatic and Phylogenetic Analyses
2.5. Expression of DcTPS Gene
2.6. Preparation of dsRNA and Feeding
2.7. Quantitative Detection of Trehalose-6-Phosphate Synthase Content in D. citri
2.8. Measurements of Trehalose and Glucose Content
2.9. Statistical Analysis
3. Results
3.1. Sequence Analysis of DcTPS cDNA
3.2. Developmental Stage-Specific Expression Pattern of DcTPS
3.3. Phenotype and Survival Rate Analysis after Feeding with dsRNA
3.4. Analysis of Trehalose-6-Phosphate Synthase, Trehalose and Glucose Contents
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Liu, B.; Coy, M.R.; Wang, J.J.; Stelinski, L.L. Characterization of the voltage-gated sodium channel of the Asian citrus psyllid, Diaphorina citri. Insect Sci. 2016, 24, 47–59. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.Q.; Jiang, H.B.; Xiong, Y.; Peng, P.; Li, H.F.; Yuan, G.R.; Dou, W.; Wang, J.J. Genome-wide identification of ATP-binding cassette transporters and expression profiles in the Asian citrus psyllid, Diaphorina citri, exposed to imidacloprid. Comp. Biochem. Physiol. Part D 2019, 30, 305–311. [Google Scholar] [CrossRef] [PubMed]
- Santos-Ortega, Y.; Killiny, N. Silencing of sucrose hydrolase causes nymph mortality and disturbs adult osmotic homeostasis in Diaphorina citri (Hemiptera: Liviidae). Insect Biochem. Mol. Biol. 2018, 101, 131–143. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.D.; Ashfaq, M.; Stelinski, L.L. Susceptible of Asian citrus psyllid, Diaphorina citri (Hemiptera: Liviidae), to the insecticide afidopyropen: A new and potent modulator of insect transient receptor potential channels. Appl. Entomol. Zoolog. 2018, 53, 453–461. [Google Scholar] [CrossRef] [Green Version]
- Qureshi, J.A.; Kostyk, B.C.; Stansly, P.A. Insecticidal suppression of Asian citrus psyllid Diaphorina citri (Hemiptera: Liviidae) vector of huanglongbing pathogens. PLoS ONE 2014, 9, e112331. [Google Scholar] [CrossRef] [Green Version]
- Xiong, X.; Wu, L.Y.; Xin, T.R.; Wang, J.; Zou, Z.W.; Xia, B. The complete mitochondrial genome of Diaphorina citri (Hemiptera: Psyllidae) and phylogenetic analysis. Biochem. Syst. Ecol. 2017, 70, 230–238. [Google Scholar] [CrossRef]
- Zhang, C.; Xiong, X.; Liu, X.; Zou, Z.W.; Xin, T.R.; Wang, J.; Xia, B. Diaphorina citri (Hemiptera: Psylloidea) in China: Two Invasion Routes and Three Transmission Paths. J. Econ. Entomol. 2019, 112, 1418–1427. [Google Scholar] [CrossRef]
- Lu, Z.J.; Huang, Y.L.; Yu, H.Z.; Li, N.Y.; Xie, Y.X.; Zhang, Q.; Zeng, X.D.; Hu, H.; Huang, A.J.; Yi, L.; et al. Silencing of the Chitin Synthase Gene Is Lethal to the Asian Citrus Psyllid, Diaphorina citri. Int. J. Mol. Sci. 2019, 20, 3734. [Google Scholar] [CrossRef] [Green Version]
- Boina, D.R.; Bloomquist, J.R. Chemical control of the Asian citrus psyllid and of huanglongbing disease in citrus. Pest Manag. Sci. 2015, 71, 808–823. [Google Scholar] [CrossRef]
- Kruse, A.; Fattah-Hosseini, S.; Saha, S.; Johnson, R.; Warwick, E.R.; Sturgeon, K.; Mueller, L.; Maccoss, M.J.; Shatters, R.G.; Heck, M.C. Combining’ omics and microscopy to visualize interactions between the Asian citrus psyllid vector and the Huanglongbing pathogen Candidatus Liberibacter asiaticus in the insect gut. PLoS ONE 2017, 12, e0179531. [Google Scholar] [CrossRef] [Green Version]
- Yu, H.Z.; Huang, Y.L.; Lu, Z.J.; Zhang, Q.; Su, H.N.; Du, Y.M.; Yi, L.; Zhong, B.L.; Chen, C.X. Inhibition of trehalase affects the trehalose and chitin metabolism pathways in Diaphorina citri (Hemiptera: Psyllidae). Insect Sci. 2020. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.K.; Hu, R.F.; Pray, C.; Qiao, F.B.; Rozelle, S. Biotechnology as an alternative to chemical pesticides: A case study of Bt cotton in China. J. Agric. Econ. 2003, 29, 55–67. [Google Scholar] [CrossRef]
- Tiwari, S.; Clayson, P.J.; Kuhns, E.H.; Stelinski, L.L. Effects of buprofezin and diflubenzuron on various developmental stages of Asian citrus psyllid, Diaphorina citri. Pest Manag. Sci. 2012, 68, 1405–1412. [Google Scholar] [CrossRef] [PubMed]
- Eaton, B.A.; Fetter, R.D.; Davis, G.W. Dynactin is necessary for synapse stabilization. Neuron 2002, 34, 729–741. [Google Scholar] [CrossRef] [Green Version]
- Mao, Y.B.; Cai, W.J.; Wang, J.W.; Hong, G.J.; Tao, X.Y.; Wang, L.J.; Huang, Y.P.; Chen, X.Y. Silencing a cotton bollworm P450 monooxygenase gene by plant-mediated RNAi impairs larval tolerance of gossypol. Nat. Biotech. 2007, 25, 1307–1313. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.F.; Tian, H.G.; Zou, L.; Tang, B.; Hu, J.; Zhang, W.Q. Disruption of Spodoptera exigua larval development by silencing chitin synthase gene A with RNA interference. Bull. Entomol. Res. 2008, 98, 613–619. [Google Scholar] [CrossRef] [PubMed]
- Dzitoyeva, S.; Dimitrijevic, N.; Manev, H. Intra-abdominal injection of double-stranded RNA into anesthetized adult Drosophila triggers RNA interference in the central nervous system. Mol. Psychiatr. 2001, 6, 665–670. [Google Scholar] [CrossRef] [Green Version]
- Tomoyasu, Y.; Miller, S.C.; Tomita, S.; Schoppmeier, M.; Grossmann, D.; Bucher, G. Exploring systemic RNA interference in insects: A genome-wide survey for RNAi genes in Tribolium. Genome Biol. 2008, 9, R10. [Google Scholar] [CrossRef] [Green Version]
- Bhatia, V.; Bhattacharya, R. Host-mediated RNA interference targeting a cuticular protein gene impaired fecundity in the green peach aphid Myzus persicae. Pest Manag. Sci. 2018, 74, 2059–2068. [Google Scholar] [CrossRef]
- Chen, J.X.; Lyu, Z.H.; Wang, C.Y.; Cheng, J.; Lin, T. RNA interference of a trehalose-6-phosphate synthase gene reveals its roles in the biosynthesis of chitin and lipids in Heortia vitessoides (Lepidoptera: Crambidae). Insect Sci. 2018, 0, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Chen, J.; Zhang, D.; Yao, Q.; Zhang, J.; Dong, X.; Tian, H.; Chen, J.; Zhang, W. Feeding-based RNA interference of a trehalose phosphate synthase gene in the brown planthopper, Nilaparvata lugens. Insect Mol. Biol. 2010, 19, 777–786. [Google Scholar] [CrossRef] [PubMed]
- Chen, Q.W.; Jin, S.; Zhang, L.; Shen, Q.D.; Wei, P.; Wei, Z.M.; Wang, S.G.; Tang, B. Regulatory functions of trehalose-6-phosphate synthase in the chitin biosynthesis pathway in Tribolium castaneum (Coleoptera: Tenebrionidae) revealed by RNA interference. Bull. Entomol. Res. 2017, 108, 388–399. [Google Scholar] [CrossRef] [PubMed]
- Xiong, K.C.; Wang, J.; Li, J.H.; Deng, Y.Q.; Pu, P.; Fan, H.; Liu, Y.H. RNA interference of a trehalose-6-phosphate synthase gene reveals its roles during larval-pupal metamorphosis in Bactrocera minax (Diptera: Tephritidae). J. Insect Physiol. 2016, 91–92, 84–92. [Google Scholar] [CrossRef] [PubMed]
- Yang, M.M.; Zhao, L.N.; Shen, Q.D.; Xie, G.Q.; Wang, S.G.; Tang, B. Knockdown of two trehalose-6-phosphate synthases severely affects chitin metabolism gene expression in the brown planthopper Nilaparvata lugens. Pest Manag. Sci. 2016, 73, 206–216. [Google Scholar] [CrossRef]
- Becker, A.; Schlöder, P.; Steele, J.E.; Wegener, G. The regulation of trehalose metabolism in insects. Experientia 1996, 52, 433–439. [Google Scholar] [CrossRef]
- Elbein, A.D.; Pan, Y.T.; Pastuszak, I.; Carroll, D. New insights on trehalose: A multifunctional molecule. Glycobiology 2003, 13, 17R–27R. [Google Scholar] [CrossRef]
- Chen, Q. Role of trehalose phosphate synthase and trehalose during hypoxia: From flies to mammals. J. Exp. Biol. 2004, 207, 3125–3129. [Google Scholar] [CrossRef] [Green Version]
- Tang, B.; Chen, X.; Liu, Y.; Tian, H.; Liu, J.; Hu, J. Characterization and expression patterns of a membranebound trehalase from Spodoptera exigua. BMC Mol. Biol. 2008, 9, 51. [Google Scholar] [CrossRef] [Green Version]
- Wyatt, G.R. The biochemistry of sugars and polysaccharides in insects. Adv. Insect Physiol. 1967, 4, 287–360. [Google Scholar] [CrossRef]
- Tang, B.; Wei, P.; Zhao, L.N.; Shi, Z.K.; Shen, Q.D.; Yang, M.M.; Xie, G.Q.; Wang, S.G. Knockdown of five trehalase genes using RNA interference regulates the gene expression of the chitin biosynthesis pathway in Tribolium castaneum. BMC Biotechnol. 2016, 16, 67. [Google Scholar] [CrossRef] [Green Version]
- Tang, B.; Wang, S.; Wang, S.G.; Wang, H.J.; Zhang, J.Y.; Cui, S.Y. Invertebrate Trehalose-6-Phosphate Synthase Gene: Genetic Architecture, Biochemistry, Physiological Function, and Potential Applications. Front. Physiol. 2018, 9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, Q.; Ma, E.; Behar, K.L.; Xu, T.; Haddad, G.G. Role of trehalose phosphate synthase in anoxia tolerance and development in Drosophila melanogaster. J. Biol. Chem. 2002, 277, 3274–3279. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cui, S.Y.; Xia, Y.X. Isolation and characterization of the trehalose-6-phosphate synthase gene from Locusta migratoria manilensis. Insect Sci. 2009, 16, 287–295. [Google Scholar] [CrossRef]
- Tang, B.; Chen, J.; Yao, Q.; Pan, Z.Q.; Xu, W.H.; Wang, S.G. Characterization of a trehalose-6-phosphate synthase gene from Spodoptera exigua, and its function identification through RNA interference. J. Insect Physiol. 2010, 56, 813–821. [Google Scholar] [CrossRef]
- Tang, B.; Zheng, H.Z.; Xu, Q.; Zou, Q.; Wang, G.J.; Zhang, F.; Wang, S.G.; Zhang, Z.H. Cloning and pattern of expression of trehalose-6-phosphate synthase cDNA from Catantops pinguis (Orthoptera: Catantopidae). Eur. J. Entomol. 2011, 108, 355–363. [Google Scholar] [CrossRef]
- Tsai, J.H.; Liu, Y.H. Biology of Diaphorina citri (Homoptera: Psyllidae) on four host plants. J. Econ. Entomol. 2000, 93, 1721–1725. [Google Scholar] [CrossRef]
- Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods Enzymol. 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Shi, J.F.; Xu, Q.Y.; Guo, W.C.; Li, G.Q. Transcription changes of a putative trehalose-6-phosphate synthase gene in response to hormone stimulation in Leptinotarsa decemlineata, (Say). J. Asia-Pac. Entomol. 2016, 19, 775–783. [Google Scholar] [CrossRef]
- Xu, J.; Bao, B.; Zhang, Z.F.; Yi, Y.Z.; Xu, W.H. Identification of a novel gene encoding the trehalose phosphate synthase in the cotton bollworm, Helicoverpa armigera. Glycobiology 2009, 19, 250–257. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.; Wang, F.; Feng, Q.; Wang, H.; Tang, T.; Huang, D.; Liu, F. Involvement of trehalose-6-phosphate synthase in innate immunity of Musca domestica. Dev. Comp. Immunol. 2019, 91, 85–92. [Google Scholar] [CrossRef] [PubMed]
- Sola-Penna, M.; Meyer-Fernandes, J.R. Stabilization against Thermal Inactivation Promoted by Sugars on Enzyme Structure and Function: Why Is Trehalose More Effective than Other Sugars? Arch. Biochem. Biophys. 1998, 360, 10–14. [Google Scholar] [CrossRef] [PubMed]
- Shukla, E.; Thorat, L.J.; Nath, B.B.; Gaikwad, S.M. Insect trehalase: Physiological significance and potential applications. Glycobiology 2018, 25, 357–367. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Primer Names | Primer Sequences | Length of Primer | Primer Usage |
---|---|---|---|
DcTPS-F | ATGCTTGCCGCCAACACT | 18 bp | Middle fragment |
DcTPS-R | CGCATCCCGATAGAACGA | 18 bp | |
Dc5’TPS-R1 | CCTCCAATGTTCGGCACAAA | 20 bp | 5’RACE |
Dc5’TPS-R2 | CCAGAAGGTGCCATTACAGC | 20 bp | |
Dc3’TPS-F1 | GCTCTAACAATGCCCGAGGAC | 21 bp | 3’RACE |
Dc3’TPS-F2 | ACAATGCCCGAGGACGAG | 18 bp | |
UPM long | CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT | 45 bp | |
UPM short | CTAATACGACTCACTATAGGGC | 22 bp | |
NUP | AAGCAGTGGTAACAACGCAGAGT | 23 bp | |
ß-Actin-F | CCCTGGACTTTGAACAGGAA | 20 bp | RT-qPCR |
ß-Actin-R | CTCGTGGATACCGCAAGATT | 20 bp | |
α-tubulin-F | GGTTCAAGGTGGGTATCAACTAT | 23 bp | |
α-tubulin-R | TAGCGGTGGTGTTGGAAAG | 19 bp | |
Q- DcTPS -F | AGGGAATGCTAGGTTGTGAT | 20 bp | |
Q-DcTPS -R | TGCTCTACCAGGAGGTTCTT | 20 bp | |
dsGFP-F | TAATACGACTCACTATAGGGAAGGGCGAGGAGCTGTTCACCG | 42 bp | dsRNA synthesis |
dsGFP-R | TAATACGACTCACTATAGGGCAGCAGGACCATGTGATCGCGC | 42 bp | |
dsDcTPS-F | TAATACGACTCACTATAGGGTCGTCGACTGTTGTCAGAGG | 40 bp | |
dsDcTPS-R | TAATACGACTCACTATAGGGAGAACGACGCCAGTTCATCT | 40 bp |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, X.; Zou, Z.; Zhang, C.; Liu, X.; Wang, J.; Xin, T.; Xia, B. Knockdown of the Trehalose-6-Phosphate Synthase Gene Using RNA Interference Inhibits Synthesis of Trehalose and Increases Lethality Rate in Asian Citrus Psyllid, Diaphorina citri (Hemiptera: Psyllidae). Insects 2020, 11, 605. https://doi.org/10.3390/insects11090605
Liu X, Zou Z, Zhang C, Liu X, Wang J, Xin T, Xia B. Knockdown of the Trehalose-6-Phosphate Synthase Gene Using RNA Interference Inhibits Synthesis of Trehalose and Increases Lethality Rate in Asian Citrus Psyllid, Diaphorina citri (Hemiptera: Psyllidae). Insects. 2020; 11(9):605. https://doi.org/10.3390/insects11090605
Chicago/Turabian StyleLiu, Xinyu, Zhiwen Zou, Cong Zhang, Xian Liu, Jing Wang, Tianrong Xin, and Bin Xia. 2020. "Knockdown of the Trehalose-6-Phosphate Synthase Gene Using RNA Interference Inhibits Synthesis of Trehalose and Increases Lethality Rate in Asian Citrus Psyllid, Diaphorina citri (Hemiptera: Psyllidae)" Insects 11, no. 9: 605. https://doi.org/10.3390/insects11090605
APA StyleLiu, X., Zou, Z., Zhang, C., Liu, X., Wang, J., Xin, T., & Xia, B. (2020). Knockdown of the Trehalose-6-Phosphate Synthase Gene Using RNA Interference Inhibits Synthesis of Trehalose and Increases Lethality Rate in Asian Citrus Psyllid, Diaphorina citri (Hemiptera: Psyllidae). Insects, 11(9), 605. https://doi.org/10.3390/insects11090605