Silencing the Myosin Regulatory Light Chain Gene sqh Reduces Cold Hardiness in Ophraella communa LeSage (Coleoptera: Chrysomelidae)
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Insect Source
2.2. RNA Extraction, cDNA Synthesis, and Gene Cloning
2.3. Sequence Analysis
2.4. Quantitative Real-Time PCR (qPCR) Analysis
2.5. Low-Temperature Stress Treatment
2.6. RNAi
2.7. Measurement of CCRT
2.8. Statistical Analyses
3. Results
3.1. Cloning and Sequence Analysis of MRLC-sqh
3.2. Expression Profile of MRLC-sqh in Various Tissues and Developmental Stages
3.3. MRLC-sqh Expression in Response to Exposure to Low Temperature Conditions
3.4. Effect of RNAi on MRLC-sqh Expression and CCRT
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Bale, J.S.; Gregory, J.M.; Ian, D.H.; Caroline, A.T.; Bezemer, T.M.; Brown, V.K.; Butterfield, J.; Buse, A.; Coulson, J.C.; Farrar, J.; et al. Herbivory in global climate change research: Direct effects of rising temperature on insect herbivores. Glob. Chang. Biol. 2002, 8, 1–16. [Google Scholar] [CrossRef]
- Zhou, Z.S.; Guo, J.Y.; Chen, H.S.; Wan, F.H. Effects of temperature on survival, development, longevity, and fecundity of Ophraella communa (Coleoptera: Chrysomelidae), a potential biological control agent against Ambrosia artemisiifolia (Asterales: Asteraceae). Environ. Entomol. 2010, 39, 1021–1027. [Google Scholar] [CrossRef]
- Tian, Z.; Wang, S.; Bai, B.; Gao, B.; Liu, J. Effects of temperature on survival, development, and reproduction of Aphis glycines (Hemiptera: Aphididae) autumnal morphs. Fla. Entomol. 2020, 103, 236–242. [Google Scholar] [CrossRef]
- Teets, N.M.; Denlinger, D.L. Physiological mechanisms of seasonal and rapid cold-hardening in insects. Physiol. Entomol. 2013, 38, 105–116. [Google Scholar] [CrossRef]
- Overgaard, J.; Macmillan, H.A. The integrative physiology of insect chill tolerance. Annu. Rev. Physiol. 2017, 79, 187–208. [Google Scholar] [CrossRef] [PubMed]
- Toxopeus, J.; Sinclair, B.J. Mechanisms underlying insect freeze tolerance. Biol. Rev. 2018, 93, 1891–1914. [Google Scholar] [CrossRef] [PubMed]
- Masters, T.A.; Kendrick-Jones, J.; Buss, F. Myosins: Domain organisation, motor properties, physiological roles and cellular functions. Handb. Exp. Pharmacol. 2017, 235, 77–122. [Google Scholar]
- Nebenfuhr, A.; Dixit, R. Kinesins and myosins: Molecular motors that coordinate cellular functions in plants. Annu. Rev. Plant Biol. 2018, 69, 329–361. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.Z.; Zhu, F. Advances in non-muscle myosin II (NM II) research. Fudan Univ. J. Medical Sci. 2014, 41, 841–845. [Google Scholar]
- Vicente-Manzanares, M.; Ma, X.; Adelstein, R.S.; Horwitz, A.R. Non-muscle myosin II takes centre stage in cell adhesion and migration. Nat. Rev. Mol. Cell Biol. 2009, 10, 778–790. [Google Scholar] [CrossRef]
- Rayment, I.; Rypniewski, W.R.; Schmidt-Bäse, K.; Smith, R.; Tomchick, D.R.; Benning, M.M.; Winkelmann, D.A.; Wesenberg, G.; Holden, H.M. Three-dimensional structure of myosin subfragment-1: A molecular motor. Science 1993, 261, 50–58. [Google Scholar] [CrossRef] [PubMed]
- Nieznanski, K.; Nieznanska, H.; Skowronek, K.; Kasprzak, A.A.; Stepkowski, D. Ca2+ binding to myosin regulatory light chain affects the conformation of the N-terminus of essential light chain and its binding to actin. Arch. Biochem. Biophys. 2003, 417, 153–158. [Google Scholar] [CrossRef]
- Takashima, S. Phosqhorylation of myosin regulatory light chain by myosin light chain kinase, and muscle contraction. Circulation 2009, 73, 208–213. [Google Scholar] [CrossRef] [PubMed]
- Hao, L.J.; Kang, Z.Q.; Ma, S.S.; Lv, P.; Yao, Q.; Chen, K.P. Progresses on myosin phosqhorylation. Life Sci. Res. 2015, 19, 154–164. [Google Scholar]
- Moore, J.R.; Dickinson, M.H.; Vigoreaux, J.O.; Maughan, D.W. The effect of removing the N-terminal extension of the Drosophila myosin regulatory light chain upon flight ability and the contractile dynamics of indirect flight muscle. Biophys. J. 2000, 78, 1431–1440. [Google Scholar] [CrossRef]
- Yang, M.; Qian, J.; Sun, J.; Xu, Y.; Zhang, D.; Ma, L.; Sun, Y.; Zhu, C. Cloning and characterization of myosin regulatory light chain (MRLC) gene from Culex pipiens pallens. Comp. Biochem. Phys. B 2008, 151, 230–235. [Google Scholar] [CrossRef]
- Chakravorty, S.; Vu, H.; Foelber, V.; Vigoreaux, J.O. Mutations of the Drosophila myosin regulatory light chain affect courtship song and reduce reproductive success. PLoS ONE 2014, 9, e90077. [Google Scholar] [CrossRef]
- Macmillan, H.A.; Knee, J.M.; Dennis, A.B.; Udaka, H.; Marshall, K.E.; Merritt, T.J.; Sinclair, B.J. Cold acclimation wholly reorganizes the Drosophila melanogaster transcriptome and metabolome. Sci. Rep. 2016, 6, 28999. [Google Scholar] [CrossRef]
- Tusong, K.; Guo, X.; Meng, S.; Liu, X.; Ma, J. Comparative analysis of the transcriptome of the overwintering desert beetle Microdera punctipennis. Cryobiology 2017, 78, 80–89. [Google Scholar] [CrossRef]
- Yang, S.; Zhang, X.; Wang, J.; Wang, S.; Pan, Y.; Zhang, J.; Xi, J. Identification and analysis of up-regulated proteins in Lissorhoptrus oryzophilus adults for rapid cold hardening. Gene 2018, 642, 9–15. [Google Scholar] [CrossRef]
- Smith, M.; Cecchi, L.; Skjøth, C.A.; Karrer, G.; Šikoparija, B. Common ragweed: A threat to environmental health in Europe. Environ. Int. 2013, 61, 115–126. [Google Scholar] [CrossRef] [PubMed]
- Mazza, G.; Tricarico, E.; Genovesi, P.; Gherardi, F. Biological invaders are threats to human health: An overview. Ethol. Ecol. Evol. 2014, 26, 112–129. [Google Scholar] [CrossRef]
- Zhou, Z.S.; Guo, J.Y.; Wan, F.H. Review on management of Ambrosia artemisiifolia using natural enemy insects. Chin. J. Biol. Control 2015, 31, 657–665. [Google Scholar]
- Rogers, C.A.; Wayne, P.M.; Macklin, E.A.; Muilenberg, M.L.; Wagner, C.J.; Epstein, P.R.; Bazzaz, F.A. Interaction of the onset of spring and elevated atmospheric CO2 on ragweed (Ambrosia artemisiifolia L.) pollen production. Environ. Health Persp. 2006, 114, 865–869. [Google Scholar] [CrossRef] [PubMed]
- Chapman, D.S.; Makra, L.; Albertini, R.; Bonini, M.; Paldy, A.; Rodinkova, V.; Šikoparija, B.; Weryszko-Chmielewska, E.; Bullock, J.M. Modelling the introduction and spread of non-native species: International trade and climate change drive ragweed invasion. Glob. Chang. Biol. 2016, 22, 3067–3079. [Google Scholar] [CrossRef]
- Guo, J.Y.; Zhou, Z.S.; Zheng, X.W.; Chen, H.S.; Wan, F.H.; Luo, Y.H. Control efficiency of leaf beetle, Ophraella communa, on the invasive common ragweed, Ambrosia artemisiifolia, at different growing stages. Biocontrol Sci. Technol. 2011, 21, 1049–1063. [Google Scholar] [CrossRef]
- Schaffner, U.; Steinbach, S.; Sun, Y.; Skjøth, C.A.; de Weger, L.A.; Lommen, S.T.; Augustinus, B.A.; Bonini, M.; Karrer, G.; Šikoparija, B.; et al. Biological weed control to relieve millions from Ambrosia allergies in Europe. Nat. Commun. 2020, 11, 1745. [Google Scholar] [CrossRef]
- Meng, L.; Li, B.P. Advances on biology and host specificity of the newly introduced beetle, Ophraella communa LeSage (Coleoptera: Chrysomelidae), attacking Ambrosia artemisiifolia (Compositae) in continent of China. Chin. J. Biol. Control 2005, 21, 65–69. [Google Scholar]
- Tian, Z.Q.; Ma, C.; Cui, S.W.; Zhou, Z.S. Ophraella communa can establish population in the suburbs of Beijing, China. J. Environ. Entomol. 2020, 42, 1039–1040. [Google Scholar]
- Zhou, Z.; Guo, J.; Li, M.; Ai, H.; Wan, F. Seasonal changes in cold hardiness of Ophraella communa. Entomol Exp. Appl. 2011, 140, 85–90. [Google Scholar] [CrossRef]
- Yue, L.; Zhou, Z.; Liu, Z.; Guo, J.; Wan, F. Effects of rapid cold hardening in different intensities on the physiological indices related to cold tolerance in adults of Ophraella communa (Coleoptera: Chrysomelidae). Acta Entomol. Sin. 2014, 57, 631–638. [Google Scholar]
- Zhao, C.; Yue, L.; Wang, Y.; Guo, J.; Zhou, Z.; Wan, F. Relationship between copulation and cold hardiness in Ophraella communa (Coleoptera: Chrysomelidae). J. Integr. Agric. 2019, 18, 900–906. [Google Scholar] [CrossRef]
- Ma, C.; Cui, S.; Bai, Q.; Tian, Z.; Zhang, Y.; Chen, G.; Gao, X.; Tian, Z.; Chen, H.; Guo, J.; et al. Olfactory co-receptor is involved in host recognition and oviposition in Ophraella communa (Coleoptera: Chrysomelidae). Insect Mol. Biol. 2020, 29, 381–390. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Chen, J.; Chen, G.; Ma, C.; Chen, H.; Gao, X.; Tian, Z.; Cui, S.; Tian, Z.; Guo, J.; et al. Identification and validation of reference genes for quantitative gene expression analysis in Ophraella communa. Front. Physiol. 2020, 11, 355. [Google Scholar] [CrossRef]
- Dai, T.M.; Lü, Z.C.; Wang, Y.; Liu, W.X.; Hong, X.Y.; Wan, F.H. Molecular characterizations of DNA methyltransferase 3 and its roles in temperature tolerance in the whitefly, Bemisia tabaci Mediterranean. Insect Mol. Biol. 2017, 27, 123–132. [Google Scholar] [CrossRef]
- Zhao, C.; Ma, F.; Chen, H.; Wan, F.; Guo, J.; Zhou, Z. Heritability and evolutionary potential drive cold hardiness in the overwintering Ophraella communa beetles. Front. Physiol. 2018, 9, 666. [Google Scholar] [CrossRef]
- Ji, S.X.; Wang, X.D.; Shen, X.N.; Liang, L.; Liu, W.X.; Wan, F.H.; Lü, Z.C. Using RNA interference to reveal the function of chromatin remodeling factor ISWI in temperature tolerance in Bemisia tabaci Middle East–Asia Minor 1 cryptic species. Insects 2020, 11, 113. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef]
- Liu, L.; Wang, H.; Jin, H.; Wu, S.; Li, Y.; Liu, Y.; Li, X.; Qin, L.; Wang, Z. Molecular cloning, expression pattern and phylogenetic analysis of myosin light chain 2 gene from Antheraea pernyi: A potential marker for phylogenetic inference. Biochem. Syst. Ecol. 2010, 38, 981–987. [Google Scholar] [CrossRef]
- Shen, J.M.; Hu, L.M.; Bin, S.Y.; Lin, J.T. Cloning and expression profiling of myosin light chain 2 gene in Bactrocera dorsalis (Hendel) (Diptera: Tephritidae). Acta Entomol. Sin. 2011, 54, 508–514. [Google Scholar]
- Wu, H.J.; Cai, Z.L.; Luo, L.L.; Lin, T. Characterization and expression pattern of myosin light chain 2 gene from Monochamus alternatus. Acta Agric. Bor. Sin. 2015, 30, 25–30. [Google Scholar]
- Zhang, L.; Ward, R.E., IV. Distinct tissue distributions and subcellular localizations of differently phosphorylated forms of the myosin regulatory light chain in Drosophila. Gene Expr. Patterns 2011, 11, 93–104. [Google Scholar] [CrossRef] [PubMed]
- Abdrakhamanova, A.; Wang, Q.; Khokhlova, L.; Nick, P. Is microtubule disassembly a trigger for cold acclimation? Plant Cell Physiol. 2003, 44, 676–686. [Google Scholar] [CrossRef] [PubMed]
- Kim, M.; Robich, R.M.; Rinehart, J.P.; Denlinger, D.L. Upregulation of two actin genes and redistribution of actin during diapause and cold stress in the northern house mosquito, Culex pipiens. J. Insect Physiol. 2006, 52, 1226–1233. [Google Scholar] [CrossRef]
- Ideses, Y.; Sonnsegev, A.; Roichman, Y.; Bernheim-Groswasser, A. Myosin II does it all: Assembly, remodeling, and disassembly of actin networks are governed by myosin II activity. Soft Matter 2013, 9, 7127–7137. [Google Scholar] [CrossRef]
- Reymann, A.; Boujemaapaterski, R.; Martiel, J.; Guerin, C.; Cao, W.; Chin, H.F.; De La Cruz, E.M.; Théry, M.; Blanchoin, L. Actin network architecture can determine myosin motor activity. Science 2012, 336, 1310–1314. [Google Scholar] [CrossRef]
- Macdonald, S.S.; Rako, L.; Batterham, P.; Hoffmann, A.A. Dissecting chill coma recovery as a measure of cold resistance: Evidence for a biphasic response in Drosophila melanogaster. J. Insect Physiol. 2004, 50, 695–700. [Google Scholar] [CrossRef]
- Andersen, J.L.; Manenti, T.; Sorensen, J.G.; Macmillan, H.A.; Loeschcke, V.; Overgaard, J. How to assess Drosophila cold tolerance: Chill coma temperature and lower lethal temperature are the best predictors of cold distribution limits. Funct. Ecol. 2015, 29, 55–65. [Google Scholar] [CrossRef]
- Vesala, L.; Salminen, T.S.; Laiho, A.; Hoikkala, A.; Kankare, M. Cold tolerance and cold-induced modulation of gene expression in two Drosophila virilis group species with different distributions. Insect Mol. Biol. 2012, 21, 107–118. [Google Scholar] [CrossRef]
- Des Marteaux, L.E.; Stinziano, J.R.; Sinclair, B.J. Effects of cold acclimation on rectal macromorphology, ultrastructure, and cytoskeletal stability in Gryllus pennsylvanicus crickets. J. Insect Physiol. 2018, 104, 15–24. [Google Scholar] [CrossRef] [PubMed]
- Toxopeus, J.; Des Marteaux, L.E.; Sinclair, B.J. How crickets become freeze tolerant: The transcriptomic underpinnings of acclimation in Gryllus veletis. Comp. Biochem. Phys. D 2019, 29, 55–66. [Google Scholar] [CrossRef] [PubMed]
- Lin, P.H.; Zhu, H.; Cai, C.X.; Wang, X.H.; Cao, C.M.; Xiao, R.P.; Pan, Z.; Weisleder, N.; Takeshima, H.; Ma, J.J. Nonmuscle myosin IIA facilitates vesicle trafficking for MG53-mediated cell membrane repair. FASEB J. 2012, 26, 1875–1883. [Google Scholar] [CrossRef] [PubMed]
- Terhzaz, S.; Teets, N.M.; Cabrero, P.; Henderson, L.; Ritchie, M.G.; Nachman, R.J.; Dow, J.A.T.; Denlinger, D.L.; Davies, S. Insect capa neuropeptides impact desiccation and cold tolerance. Proc. Natl. Acad. Sci. USA 2015, 11, 2882–2887. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Primer Sequence (5′ to 3′) |
---|---|
RT-PCR | |
MRLC-sqh-F | ATGTCTTCCCGTAAAACT |
MRLC-sqh-R | TTACTGCTCATCTTTATCTT |
qPCR | |
MRLC-sqh-F | CGTCTTCAAGGTACTGATCC |
MRLC-sqh-R | AATGGGAGCCTCTCTGTA |
RPL4-F | TGTGGTAATGCTGTGGTAT |
RPL4-R | TCTAGCACTGCATGAACA |
dsRNA | |
dsMRLC-sqh-F | TAATACGACTCACTATAGGGAACTGTAAGTCGTCGTG |
dsMRLC-sqh-R | TAATACGACTCACTATAGGGCATCAGTGAATCTATCTCCC |
dsGFP-F | TAATACGACTCACTATAGGGTGAGCAAGGGCGAGGAG |
dsGFP-R | TAATACGACTCACTATAGGGCGGCGGTCACGAACTCCAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tian, Z.; Zhang, Y.; Ma, C.; Chen, H.; Guo, J.; Zhou, Z. Silencing the Myosin Regulatory Light Chain Gene sqh Reduces Cold Hardiness in Ophraella communa LeSage (Coleoptera: Chrysomelidae). Insects 2020, 11, 844. https://doi.org/10.3390/insects11120844
Tian Z, Zhang Y, Ma C, Chen H, Guo J, Zhou Z. Silencing the Myosin Regulatory Light Chain Gene sqh Reduces Cold Hardiness in Ophraella communa LeSage (Coleoptera: Chrysomelidae). Insects. 2020; 11(12):844. https://doi.org/10.3390/insects11120844
Chicago/Turabian StyleTian, Zhenqi, Yan Zhang, Chao Ma, Hongsong Chen, Jianying Guo, and Zhongshi Zhou. 2020. "Silencing the Myosin Regulatory Light Chain Gene sqh Reduces Cold Hardiness in Ophraella communa LeSage (Coleoptera: Chrysomelidae)" Insects 11, no. 12: 844. https://doi.org/10.3390/insects11120844
APA StyleTian, Z., Zhang, Y., Ma, C., Chen, H., Guo, J., & Zhou, Z. (2020). Silencing the Myosin Regulatory Light Chain Gene sqh Reduces Cold Hardiness in Ophraella communa LeSage (Coleoptera: Chrysomelidae). Insects, 11(12), 844. https://doi.org/10.3390/insects11120844