The Effect of Ionizing Irradiation on the Autotaxin-Lysophasphatidic Acid Axis and Interleukin-6/8 Secretion in Different Breast Cancer Cell Lines
Abstract
1. Introduction
2. Materials and Methods
2.1. The Cell Lines and Cell Culture
2.2. Irradiation
2.3. Flow Cytometry for the Analysis of Apoptosis and Necrosis
2.4. Quantitative Real-Time PCR
2.5. Enzyme-Linked Immunosorbent Assay (ELISA) Measurements
2.6. The Stimulation of ADSCs
2.7. Statistics
3. Results
3.1. 5 Gy Irradiation Reduced Cell Survival Rates
3.2. LPAR Expression of Cell Lines after Irradiation
3.3. ATX Expression Was Significantly Increased in the MDA-MB-231 Cells after 5 Gy Irradiation
3.4. Irradiation Leads to Higher Levels of IL-6 Secretion in MDA-MB-231 and Higher Levels of IL-8 Secretion in MDA-MB-468 and MDA-MB-231
3.5. IL-6 and IL-8 Stimulates ATX Expression in ADSC
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ciabattoni, A.; Gregucci, F.; De Rose, F.; Falivene, S.; Fozza, A.; Daidone, A.; Morra, A.; Smaniotto, D.; Barbara, R.; Lozza, L.; et al. AIRO Breast Cancer Group Best Clinical Practice 2022 Update. Tumori 2022, 108, 1–144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brindley, D.N.; Lin, F.T.; Tigyi, G.J. Role of the autotaxin-lysophosphatidate axis in cancer resistance to chemotherapy and radiotherapy. Biochim. Biophys. Acta 2013, 1831, 74–85. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Benesch, M.G.K.; Tang, X.; Brindley, D.N.; Takabe, K. Autotaxin and Lysophosphatidate Signaling: Prime Targets for Mitigating Therapy Resistance in Breast Cancer. World J. Oncol. 2024, 15, 1–13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tang, X.; Benesch, M.G.K.; Brindley, D.N. Role of the autotaxin-lysophosphatidate axis in the development of resistance to cancer therapy. Biochim. Biophys. Acta Mol. Cell. Biol. Lipids 2020, 1865, 158716. [Google Scholar] [CrossRef] [Scilit]
- Laface, C.; Ricci, A.D.; Vallarelli, S.; Ostuni, C.; Rizzo, A.; Ambrogio, F.; Centonze, M.; Schirizzi, A.; De Leonardis, G.; D’Alessandro, R.; et al. Autotaxin-Lysophosphatidate Axis: Promoter of Cancer Development and Possible Therapeutic Implications. Int. J. Mol. Sci. 2024, 25, 7737. [Google Scholar] [CrossRef] [Scilit]
- Rancoule, C.; Espenel, S.; Trone, J.C.; Langrand-Escure, J.; Vallard, A.; Rehailia-Blanchard, A.; El Meddeb Hamrouni, A.; Xia, Y.; Guy, J.B.; Ben-Mrad, M.; et al. Lysophosphatidic acid (LPA) as a pro-fibrotic and pro-oncogenic factor: A pivotal target to improve the radiotherapy therapeutic index. Oncotarget 2017, 8, 43543–43554. [Google Scholar] [CrossRef] [Scilit]
- Akira, T.; Kengo, H.; Kenji, F.; Hiroaki, T. Involvement of lysophospholipase D in the production of lysophosphatidic acid in rat plasma. Biochim. Biophys. Acta (BBA) Lipids Lipid Metab. 1986, 875, 31–38. [Google Scholar] [CrossRef] [Scilit]
- Tokumura, A.; Majima, E.; Kariya, Y.; Tominaga, K.; Kogure, K.; Yasuda, K.; Fukuzawa, K. Identification of human plasma lysophospholipase D, a lysophosphatidic acid-producing enzyme, as autotaxin, a multifunctional phosphodiesterase. J. Biol. Chem. 2002, 277, 39436–39442. [Google Scholar] [CrossRef] [Scilit]
- Umezu-Goto, M.; Kishi, Y.; Taira, A.; Hama, K.; Dohmae, N.; Takio, K.; Yamori, T.; Mills, G.B.; Inoue, K.; Aoki, J.; et al. Autotaxin has lysophospholipase D activity leading to tumor cell growth and motility by lysophosphatidic acid production. J. Cell. Biol. 2002, 158, 227–233. [Google Scholar] [CrossRef] [Scilit]
- Yung, Y.C.; Stoddard, N.C.; Chun, J. LPA receptor signaling: Pharmacology, physiology, and pathophysiology. J. Lipid Res. 2014, 55, 1192–1214. [Google Scholar] [CrossRef] [Scilit]
- Euer, N.; Schwirzke, M.; Evtimova, V.; Burtscher, H.; Jarsch, M.; Tarin, D.; Weidle, U.H. Identification of genes associated with metastasis of mammary carcinoma in metastatic versus non-metastatic cell lines. Anticancer Res. 2002, 22, 733–740. [Google Scholar] [PubMed]
- Zhang, X.; Li, M.; Yin, N.; Zhang, J. The Expression Regulation and Biological Function of Autotaxin. Cells 2021, 10, 939. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Drosouni, A.; Panagopoulou, M.; Aidinis, V.; Chatzaki, E. Autotaxin in Breast Cancer: Role, Epigenetic Regulation and Clinical Implications. Cancers 2022, 14, 5437. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lei, L.; Su, J.; Chen, J.; Chen, W.; Chen, X.; Peng, C. The role of lysophosphatidic acid in the physiology and pathology of the skin. Life Sci. 2019, 220, 194–200. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xiang, H.; Lu, Y.; Shao, M.; Wu, T. Lysophosphatidic Acid Receptors: Biochemical and Clinical Implications in Different Diseases. J. Cancer 2020, 11, 3519–3535. [Google Scholar] [CrossRef] [Scilit]
- Suenaga, R.; Takemoto, M.; Inoue, A.; Ishitani, R.; Nureki, O. Lateral access mechanism of LPA receptor probed by molecular dynamics simulation. PLoS ONE 2022, 17, e0263296. [Google Scholar] [CrossRef] [Scilit]
- Hauck, T.; Kadam, S.; Heinz, K.; Garcia Peraza, M.; Schmid, R.; Kremer, A.E.; Wolf, K.; Bauer, A.; Horch, R.E.; Arkudas, A.; et al. Influence of the autotaxin-lysophosphatidic acid axis on cellular function and cytokine expression in different breast cancer cell lines. Sci. Rep. 2022, 12, 5565. [Google Scholar] [CrossRef] [Scilit]
- Sun, K.; Cai, H.; Duan, X.; Yang, Y.; Li, M.; Qu, J.; Zhang, X.; Wang, J. Aberrant expression and potential therapeutic target of lysophosphatidic acid receptor 3 in triple-negative breast cancers. Clin. Exp. Med. 2015, 15, 371–380. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Popnikolov, N.K.; Dalwadi, B.H.; Thomas, J.D.; Johannes, G.J.; Imagawa, W.T. Association of autotaxin and lysophosphatidic acid receptor 3 with aggressiveness of human breast carcinoma. Tumour Biol. 2012, 33, 2237–2243. [Google Scholar] [CrossRef] [Scilit]
- Brindley, D.N.; Tang, X.; Meng, G.; Benesch, M.G.K. Role of Adipose Tissue-Derived Autotaxin, Lysophosphatidate Signaling, and Inflammation in the Progression and Treatment of Breast Cancer. Int. J. Mol. Sci. 2020, 21, 5938. [Google Scholar] [CrossRef] [Scilit]
- Schmid, R.; Wolf, K.; Robering, J.W.; Strauß, S.; Strissel, P.L.; Strick, R.; Rübner, M.; Fasching, P.A.; Horch, R.E.; Kremer, A.E.; et al. ADSCs and adipocytes are the main producers in the autotaxin-lysophosphatidic acid axis of breast cancer and healthy mammary tissue in vitro. BMC Cancer 2018, 18, 1273. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Benesch, M.G.; Tang, X.; Dewald, J.; Dong, W.F.; Mackey, J.R.; Hemmings, D.G.; McMullen, T.P.; Brindley, D.N. Tumor-induced inflammation in mammary adipose tissue stimulates a vicious cycle of autotaxin expression and breast cancer progression. FASEB J. 2015, 29, 3990–4000. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Deng, W.; Balazs, L.; Wang, D.A.; Van Middlesworth, L.; Tigyi, G.; Johnson, L.R. Lysophosphatidic acid protects and rescues intestinal epithelial cells from radiation- and chemotherapy-induced apoptosis. Gastroenterology 2002, 123, 206–216. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Deng, W.; Wang, D.A.; Gosmanova, E.; Johnson, L.R.; Tigyi, G. LPA protects intestinal epithelial cells from apoptosis by inhibiting the mitochondrial pathway. Am. J. Physiol. Gastrointest. Liver Physiol. 2003, 284, G821–G829. [Google Scholar] [CrossRef] [Scilit]
- Meng, G.; Tang, X.; Yang, Z.; Benesch, M.G.K.; Marshall, A.; Murray, D.; Hemmings, D.G.; Wuest, F.; McMullen, T.P.W.; Brindley, D.N. Implications for breast cancer treatment from increased autotaxin production in adipose tissue after radiotherapy. FASEB J. 2017, 31, 4064–4077. [Google Scholar] [CrossRef] [Scilit]
- Meng, G.; Wuest, M.; Tang, X.; Dufour, J.; Zhao, Y.; Curtis, J.M.; McMullen, T.P.W.; Murray, D.; Wuest, F.; Brindley, D.N. Repeated Fractions of X-Radiation to the Breast Fat Pads of Mice Augment Activation of the Autotaxin-Lysophosphatidate-Inflammatory Cycle. Cancers 2019, 11, 1816. [Google Scholar] [CrossRef] [Scilit]
- Dai, X.; Cheng, H.; Bai, Z.; Li, J. Breast Cancer Cell Line Classification and Its Relevance with Breast Tumor Subtyping. J. Cancer 2017, 8, 3131–3141. [Google Scholar] [CrossRef] [Scilit]
- Abdelhakiem, M.K.; Johnstone, C.; Bergom, C.; Currey, A.; Robbins, J.R. The influence of breast cancer subtype on survival after palliative radiation for osseous metastases. Cancer Med. 2020, 9, 8979–8988. [Google Scholar] [CrossRef] [Scilit]
- Sit, D.; Zhao, B.; Chen, K.T.; Lohrisch, C.; Olson, R.; Nichol, A.; Hsu, F. The Effect of Breast Cancer Subtype on Symptom Improvement Following Palliative Radiotherapy for Bone Metastases. Clin. Oncol. 2022, 34, 267–273. [Google Scholar] [CrossRef] [Scilit]
- Mao, J.-H.; Diest, P.J.v.; Perez-Losada, J.; Snijders, A.M. Revisiting the impact of age and molecular subtype on overall survival after radiotherapy in breast cancer patients. Sci. Rep. 2017, 7, 12587. [Google Scholar] [CrossRef] [Scilit]
- Bai, X.; Ni, J.; Beretov, J.; Wang, S.; Dong, X.; Graham, P.; Li, Y. THOC2 and THOC5 Regulate Stemness and Radioresistance in Triple-Negative Breast Cancer. Adv. Sci. 2021, 8, e2102658. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barker, H.E.; Paget, J.T.E.; Khan, A.A.; Harrington, K.J. The tumour microenvironment after radiotherapy: Mechanisms of resistance and recurrence. Nat. Rev. Cancer 2015, 15, 409–425. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumar, H.; Gupta, N.V.; Jain, R.; Madhunapantula, S.V.; Babu, C.S.; Kesharwani, S.S.; Dey, S.; Jain, V. A review of biological targets and therapeutic approaches in the management of triple-negative breast cancer. J. Adv. Res. 2023, 54, 271–292. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bai, X.; Ni, J.; Beretov, J.; Graham, P.; Li, Y. Triple-negative breast cancer therapeutic resistance: Where is the Achilles’ heel? Cancer Lett. 2021, 497, 100–111. [Google Scholar] [CrossRef] [Scilit]
- Tang, X.; Wuest, M.; Benesch, M.G.K.; Dufour, J.; Zhao, Y.; Curtis, J.M.; Monjardet, A.; Heckmann, B.; Murray, D.; Wuest, F.; et al. Inhibition of Autotaxin with GLPG1690 Increases the Efficacy of Radiotherapy and Chemotherapy in a Mouse Model of Breast Cancer. Mol. Cancer Ther. 2020, 19, 63–74. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Sun, Y.; Qu, J.; Yan, Y.; Yang, Y.; Cai, H. Roles of LPA receptor signaling in breast cancer. Expert Rev. Mol. Diagn. 2016, 16, 1103–1111. [Google Scholar] [CrossRef] [Scilit]
- Lei, J.; Guo, S.; Li, K.; Tian, J.; Zong, B.; Ai, T.; Peng, Y.; Zhang, Y.; Liu, S. Lysophosphatidic acid receptor 6 regulated by miR-27a-3p attenuates tumor proliferation in breast cancer. Clin. Transl. Oncol. 2022, 24, 503–516. [Google Scholar] [CrossRef] [Scilit]
- Tao, K.; Guo, S.; Chen, R.; Yang, C.; Jian, L.; Yu, H.; Liu, S. Lysophosphatidic Acid Receptor 6 (LPAR6) Expression and Prospective Signaling Pathway Analysis in Breast Cancer. Mol. Diagn. Ther. 2019, 23, 127–138. [Google Scholar] [CrossRef] [Scilit]
- Kiss, G.N.; Lee, S.C.; Fells, J.I.; Liu, J.; Valentine, W.J.; Fujiwara, Y.; Thompson, K.E.; Yates, C.R.; Sümegi, B.; Tigyi, G. Mitigation of radiation injury by selective stimulation of the LPA2 receptor. Biochim. Biophys. Acta 2013, 1831, 117–125. [Google Scholar] [CrossRef] [Scilit]
- Balogh, A.; Shimizu, Y.; Lee, S.C.; Norman, D.D.; Gangwar, R.; Bavaria, M.; Moon, C.; Shukla, P.; Rao, R.; Ray, R.; et al. The autotaxin–LPA2 GPCR axis is modulated by γ-irradiation and facilitates DNA damage repair. Cell. Signal. 2015, 27, 1751–1762. [Google Scholar] [CrossRef] [Scilit]
- Lin, F.-T.; Lai, Y.-J.; Makarova, N.; Tigyi, G.; Lin, W.-C. The Lysophosphatidic Acid 2 Receptor Mediates Down-regulation of Siva-1 to Promote Cell Survival. J. Biol. Chem. 2007, 282, 37759–37769. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Panupinthu, N.; Lee, H.Y.; Mills, G.B. Lysophosphatidic acid production and action: Critical new players in breast cancer initiation and progression. Br. J. Cancer 2010, 102, 941–946. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hartman, Z.C.; Poage, G.M.; den Hollander, P.; Tsimelzon, A.; Hill, J.; Panupinthu, N.; Zhang, Y.; Mazumdar, A.; Hilsenbeck, S.G.; Mills, G.B.; et al. Growth of triple-negative breast cancer cells relies upon coordinate autocrine expression of the proinflammatory cytokines IL-6 and IL-8. Cancer Res. 2013, 73, 3470–3480. [Google Scholar] [CrossRef] [Scilit]
- Bravatà, V.; Minafra, L.; Forte, G.I.; Cammarata, F.P.; Russo, G.; Di Maggio, F.M.; Augello, G.; Lio, D.; Gilardi, M.C. Cytokine profile of breast cell lines after different radiation doses. Int. J. Radiat. Biol. 2017, 93, 1217–1226. [Google Scholar] [CrossRef] [Scilit]
- Desai, S.; Kumar, A.; Laskar, S.; Pandey, B.N. Cytokine profile of conditioned medium from human tumor cell lines after acute and fractionated doses of gamma radiation and its effect on survival of bystander tumor cells. Cytokine 2013, 61, 54–62. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Al-Khalaf, H.H.; Al-Harbi, B.; Al-Sayed, A.; Arafah, M.; Tulbah, A.; Jarman, A.; Al-Mohanna, F.; Aboussekhra, A. Interleukin-8 Activates Breast Cancer-Associated Adipocytes and Promotes Their Angiogenesis- and Tumorigenesis-Promoting Effects. Mol. Cell. Biol. 2019, 39, e00332-18. [Google Scholar] [CrossRef] [Scilit]
- Jin, K.; Pandey, N.B.; Popel, A.S. Crosstalk between stromal components and tumor cells of TNBC via secreted factors enhances tumor growth and metastasis. Oncotarget 2017, 8, 60210–60222. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, X.; Zhang, J.; Lv, W.; Zhao, C.; Xia, Y.; Wu, Y.; Zhang, Q. The pleiotropic roles of adipocyte secretome in remodeling breast cancer. J. Exp. Clin. Cancer Res. 2022, 41, 203. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.; Wei, Y.; Yang, W.; Huang, Q.; Chen, Y.; Zeng, K.; Chen, J. IL-6: The Link Between Inflammation, Immunity and Breast Cancer. Front. Oncol. 2022, 12, 903800. [Google Scholar] [CrossRef] [Scilit]
- Habanjar, O.; Bingula, R.; Decombat, C.; Diab-Assaf, M.; Caldefie-Chezet, F.; Delort, L. Crosstalk of Inflammatory Cytokines within the Breast Tumor Microenvironment. Int. J. Mol. Sci. 2023, 24, 4002. [Google Scholar] [CrossRef] [Scilit]
- Jin, K.; Pandey, N.B.; Popel, A.S. Simultaneous blockade of IL-6 and CCL5 signaling for synergistic inhibition of triple-negative breast cancer growth and metastasis. Breast Cancer Res. 2018, 20, 54. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fernando, R.I.; Castillo, M.D.; Litzinger, M.; Hamilton, D.H.; Palena, C. IL-8 signaling plays a critical role in the epithelial-mesenchymal transition of human carcinoma cells. Cancer Res. 2011, 71, 5296–5306. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Castelino, F.V.; Bain, G.; Pace, V.A.; Black, K.E.; George, L.; Probst, C.K.; Goulet, L.; Lafyatis, R.; Tager, A.M. An Autotaxin/Lysophosphatidic Acid/Interleukin-6 Amplification Loop Drives Scleroderma Fibrosis. Arthritis Rheumatol. 2016, 68, 2964–2974. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Gene | Forward | Reverse |
|---|---|---|
| ENPP2 | TGAATCATCTCCTGCGCACT | ATCCAACTTGTTCTTTGGCTCT |
| LPAR1 | TTTATGAAGCTCCCCATCCACC | TGAACACGCCCCAGAACTAC |
| LPAR2 | TACCGAGAGACCACGCTCAG | GCCTAAACCATCCAGGAGCA |
| LPAR3 | GAGTTTCCTGGGGGAATTTTGC | ACGTTCTCTCACTGTTCAGCA |
| LPAR6 | TGGGTTGGACTCGTTGACTG | TTCCGCTGGGTTCTTCAACA |
| hu YWHAZ | ATGAGCTGGTTCAGAAGGCC | AAGATGACCTACGGGCTCCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Promny, T.; Scherrer, I.; Kadam, S.; Schmid, R.; Jost, T.; Distel, L.V.; Arkudas, A.; Horch, R.E.; Kengelbach-Weigand, A. The Effect of Ionizing Irradiation on the Autotaxin-Lysophasphatidic Acid Axis and Interleukin-6/8 Secretion in Different Breast Cancer Cell Lines. J. Pers. Med. 2024, 14, 968. https://doi.org/10.3390/jpm14090968
Promny T, Scherrer I, Kadam S, Schmid R, Jost T, Distel LV, Arkudas A, Horch RE, Kengelbach-Weigand A. The Effect of Ionizing Irradiation on the Autotaxin-Lysophasphatidic Acid Axis and Interleukin-6/8 Secretion in Different Breast Cancer Cell Lines. Journal of Personalized Medicine. 2024; 14(9):968. https://doi.org/10.3390/jpm14090968
Chicago/Turabian StylePromny, Theresa, Isabell Scherrer, Sheetal Kadam, Rafael Schmid, Tina Jost, Luitpold V. Distel, Andreas Arkudas, Raymund E. Horch, and Annika Kengelbach-Weigand. 2024. "The Effect of Ionizing Irradiation on the Autotaxin-Lysophasphatidic Acid Axis and Interleukin-6/8 Secretion in Different Breast Cancer Cell Lines" Journal of Personalized Medicine 14, no. 9: 968. https://doi.org/10.3390/jpm14090968
APA StylePromny, T., Scherrer, I., Kadam, S., Schmid, R., Jost, T., Distel, L. V., Arkudas, A., Horch, R. E., & Kengelbach-Weigand, A. (2024). The Effect of Ionizing Irradiation on the Autotaxin-Lysophasphatidic Acid Axis and Interleukin-6/8 Secretion in Different Breast Cancer Cell Lines. Journal of Personalized Medicine, 14(9), 968. https://doi.org/10.3390/jpm14090968

