Effects of Vitamin D Receptor Genotype on Lipid Profiles and Retinopathy Risk in Type 2 Diabetes Patients: A Pilot Study
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemical Compounds
2.2. Study Participants
2.3. Data Collection
2.4. Genotyping of VDR Variants
2.5. In-Silico Analysis of the Promoter Sequence
2.6. Statistical Analysis
3. Results
3.1. Patient Data
3.2. VDR Genotypes of T2DM Patients
3.3. VDR Haplotype and Linkage Disequilibrium among T2DM Patients
3.4. Associations of VDR Genotypes with Lipid, Glycemic, and Creatinine Levels
3.5. Associations of VDR Genotypes with Diabetes Complications
3.6. In-Silico Prediction of VDREs in Promoter Sequences
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kharroubi, A.T.; Darwish, H.M. Diabetes mellitus: The epidemic of the century. World J. Diabetes 2015, 6, 850–867. [Google Scholar] [CrossRef] [PubMed]
- Hirano, T. Pathophysiology of Diabetic Dyslipidemia. J. Atheroscler. Thromb. 2018, 25, 771–782. [Google Scholar] [CrossRef] [PubMed]
- Basa, A.L.; Garber, A.J. Cardiovascular disease and diabetes: Modifying risk factors other than glucose control. Ochsner. J. 2001, 3, 132–137. [Google Scholar] [PubMed]
- Khodaeian, M.; Enayati, S.; Tabatabaei-Malazy, O.; Amoli, M.M. Association between Genetic Variants and Diabetes Mellitus in Iranian Populations: A Systematic Review of Observational Studies. J. Diabetes Res. 2015, 2015, 585917. [Google Scholar] [CrossRef]
- Kruzliak, P.; Haley, A.P.; Starcevic, J.N.; Gaspar, L.; Petrovic, D. Polymorphisms of the peroxisome prolifera-tor-activated receptor-gamma (rs1801282) and its coactivator-1 (rs8192673) are associated with obesity indexes in subjects with type 2 diabetes mellitus. Cardiovasc. Diabetol. 2015, 14, 42. [Google Scholar] [CrossRef]
- Aranow, C. Vitamin D and the Immune System. J. Investig. Med. 2011, 59, 881–886. [Google Scholar] [CrossRef]
- Surdu, A.; Pînzariu, O.; Ciobanu, D.-M.; Negru, A.-G.; Căinap, S.-S.; Lazea, C.; Iacob, D.; Săraci, G.; Tirinescu, D.; Borda, I.; et al. Vitamin D and Its Role in the Lipid Metabolism and the Development of Atherosclerosis. Biomedicines 2021, 9, 172. [Google Scholar] [CrossRef]
- Alruwaili, M.A.; Jarrar, Y. Effects of vitamin C and D on the mRNA expression of angiotensin converting enzyme 2 receptor, cathepsin L, and transmembrane serine protease in the mouse lungs. Libyan J. Med. 2022, 17, 2054111. [Google Scholar] [CrossRef]
- Li, Y.; Tong, C.H.; Rowland, C.M.; Radcliff, J.; Bare, L.A.; McPhaul, M.J.; Devlin, J.J. Association of changes in lipid levels with changes in vitamin D levels in a real-world setting. Sci. Rep. 2021, 11, 21536. [Google Scholar] [CrossRef]
- Pike, J.W.; Meyer, M.B. The Vitamin D Receptor: New Paradigms for the Regulation of Gene Expression by 1,25-Dihydroxyvitamin D3. Endocrinol. Metab. Clin. N. Am. 2010, 39, 255–269. [Google Scholar] [CrossRef] [Green Version]
- Marozik, P.; Rudenka, A.; Kobets, K.; Rudenka, E. Vitamin D Status, Bone Mineral Density, and VDR Gene Poly-morphism in a Cohort of Belarusian Postmenopausal Women. Nutrients 2021, 13, 837. [Google Scholar] [CrossRef] [PubMed]
- Vishnupriya, S.; Bindu, C.H.; Annamaneni, S.; Reddy, K.P. Association of vitamin D receptor gene start codon (Fok1) polymorphism with high myopia. Oman J. Ophthalmol. 2011, 4, 57–62. [Google Scholar] [CrossRef] [PubMed]
- Kılıç, S.; Sılan, F.; Hız, M.M.; Işık, S.; Ögretmen, Z.; Özdemir, O. Vitamin D Receptor Gene BSMI, FOKI, APAI, and TAQI Polymorphisms and the Risk of Atopic Dermatitis. J. Investig. Allergy Clin. Immunol. 2016, 26, 106–110. [Google Scholar] [CrossRef] [PubMed]
- Khan, A.; Khan, S.; Aman, A.; Ali, Y.; Jamal, M.; Rahman, B.; Ahmad, M.; Aasim, M.; Jalil, F.; Shah, A.A. Associa-tion of VDR Gene Variant (rs1544410) with Type 2 Diabetes in a Pakistani Cohort. Balkan J. Med. Genet. 2019, 22, 59–64. [Google Scholar] [CrossRef]
- Khdair, S.I.; Jarrar, Y.B.; Jarrar, W. Immunogenetic Prediction of VDR Gene SNPs: Lack of Association with Sus-ceptibility to Type 1 Diabetes in Jordanian Patients. Diabetes Metab. Syndr. Obes. 2021, 14, 4079–4087. [Google Scholar] [CrossRef]
- American Diabetes, A. 2. Classification and Diagnosis of Diabetes: Standards of Medical Care in Diabetes-2020. Diabetes Care 2020, 43, S14–S31. [Google Scholar] [CrossRef]
- Farré, D.; Roset, R.; Huerta, M.; Adsuara, J.E.; Roselló, L.; Albà, M.M.; Messeguer, X. Identification of patterns in biological sequences at the ALGGEN server: PROMO and MALGEN. Nucleic Acids Res. 2003, 31, 3651–3653. [Google Scholar] [CrossRef]
- Périer, R.C.; Junier, T.; Bonnard, C.; Bucher, P. The Eukaryotic Promoter Database (EPD): Recent developments. Nucleic Acids Res. 1999, 27, 307–309. [Google Scholar] [CrossRef]
- Sirajudeen, S.; Shah, I.; Al Menhali, A. A Narrative Role of Vitamin D and Its Receptor: With Current Evidence on the Gastric Tissues. Int. J. Mol. Sci. 2019, 20, 3832. [Google Scholar] [CrossRef]
- Alhawari, H.; Jarrar, Y.; Alkhatib, M.A.; Alhawari, H.; Momani, M.; Zayed, A.; Alkamhawi, R.; Zihlif, M. The Association of 3-Hydroxy-3-Methylglutaryl-CoA Reductase, Apolipoprotein E, and Solute Carrier Organic Anion Genetic Variants with Atorvastatin Response among Jordanian Patients with Type 2 Diabetes. Life 2020, 10, 232. [Google Scholar] [CrossRef]
- Abed, E.; Jarrar, Y.; Alhawari, H.; Abdullah, S.; Zihlif, M. How the cytochrome 7a1 (CYP7A1) and ATP-binding cassette G8 (ABCG8) genetic variants affect atorvastatin response among type 2 diabetic patients attending the University of Jordan Hospital. Int. J. Clin. Pharmacol. Ther. 2021, 59, 99–108. [Google Scholar] [CrossRef] [PubMed]
- Nathan, D.M. Long-Term Complications of Diabetes Mellitus. N. Engl. J. Med. 1993, 328, 1676–1685. [Google Scholar] [CrossRef]
- Wu, H.; Norton, V.; Cui, K.; Zhu, B.; Bhattacharjee, S.; Lu, Y.W.; Wang, B.; Shan, D.; Wong, S.; Dong, Y.; et al. Di-abetes and Its Cardiovascular Complications: Comprehensive Network and Systematic Analyses. Front Cardiovasc. Med. 2022, 9, 841928. [Google Scholar] [CrossRef] [PubMed]
- Al-Amer, R.M.; Khader, Y.; Malas, S.; Abu-Yaghi, N.; Al-Bdour, M.; Ajlouni, K. Prevalence and risk factors of dia-betic retinopathy among Jordanian patients with type 2 diabetes. Digit J. Ophthalmol. 2008, 14, 42–49. [Google Scholar] [CrossRef]
- Bos, M.; Agyemang, C. Prevalence and complications of diabetes mellitus in Northern Africa, a systematic review. BMC Public Health 2013, 13, 387. [Google Scholar] [CrossRef] [PubMed]
- Jia, J.; Tang, Y.; Shen, C.; Zhang, N.; Ding, H.; Zhan, Y. Vitamin D receptor polymorphism rs2228570 is significantly associated with risk of dyslipidemia and serum LDL levels in Chinese Han population. Lipids Health Dis. 2018, 17, 193. [Google Scholar] [CrossRef] [PubMed]
- Al-Daghri, N.M.; Mohammed, A.K.; Al-Attas, O.S.; Ansari, M.G.A.; Wani, K.; Hussain, S.D.; Sabico, S.; Tripathi, G.; Alokail, M.S. Vitamin D Receptor Gene Polymorphisms Modify Cardiometabolic Response to Vitamin D Supplementation in T2DM Patients. Sci. Rep. 2017, 7, 8280. [Google Scholar] [CrossRef] [PubMed]
- Karonova, T.; Grineva, E.; Belyaeva, O.; Bystrova, A.; Jude, E.B.; Andreeva, A.; Kostareva, A.; Pludowski, P. Rela-tionship Between Vitamin D Status and Vitamin D Receptor Gene Polymorphisms with Markers of Metabolic Syndrome Among Adults. Front Endocrinol. 2018, 9, 448. [Google Scholar] [CrossRef]
- Xia, Z.; Hu, Y.; Han, Z.; Gao, Y.; Bai, J.; He, Y.; Zhao, H.; Zhang, H. Association of vitamin D receptor gene pol-ymorphisms with diabetic dyslipidemia in the elderly male population in North China. Clin. Interv. Aging 2017, 12, 1673–1679. [Google Scholar] [CrossRef]
- Al-Daghri, N.M.; Al-Attas, O.S.; Alkharfy, K.M.; Khan, N.; Mohammed, A.K.; Vinodson, B.; Ansari, M.G.A.; Alenad, A.; Alokail, M.S. Association of VDR-gene variants with factors related to the metabolic syndrome, type 2 diabetes and vitamin D deficiency. Gene 2014, 542, 129–133. [Google Scholar] [CrossRef]
- Assis, C.S.; Diniz, T.G.; Alcantara, J.O.S.; Brito, V.; do Nascimento, R.A.F.; Nunes, M.; Silva, A.S.; de Queiroga Evangelista, I.W.; Viturino, M.G.M.; de Lima, R.; et al. Metabolic impact of the VDR rs1544410 in diabetic retinopathy. PLoS ONE 2022, 17, e0263346. [Google Scholar] [CrossRef]
- Mackawy, A.M.; Badawi, M.E. Association of vitamin D and vitamin D receptor gene polymorphisms with chronic inflammation, insulin resistance and metabolic syndrome components in type 2 diabetic Egyptian patients. Meta Gene 2014, 2, 540–556. [Google Scholar] [CrossRef] [PubMed]
- Hong, Y.J.; Kang, E.S.; Ji, M.J.; Choi, H.J.; Oh, T.; Koong, S.-S.; Jeon, H.J. Association between Bsm1 Polymorphism in Vitamin D Receptor Gene and Diabetic Retinopathy of Type 2 Diabetes in Korean Population. Endocrinol. Metab. 2015, 30, 469–474. [Google Scholar] [CrossRef]
- Sasso, F.C.; Pafundi, P.C.; Gelso, A.; Bono, V.; Costagliola, C.; Marfella, R.; Sardu, C.; Rinaldi, L.; Galiero, R.; Acierno, C.; et al. High HDL cholesterol: A risk factor for diabetic retinopathy? Findings from NO BLIND study. Diabetes Res. Clin. Pract. 2019, 150, 236–244. [Google Scholar] [CrossRef] [PubMed]
- Nosratabadi, R.; Arababadi, M.K.; Salehabad, V.A.; Shamsizadeh, A.; Mahmoodi, M.; Sayadi, A.R.; Kennedy, D. Polymorphisms within exon 9 but not intron 8 of the vitamin D receptor are associated with the nephropathic complication of type-2 diabetes. Int. J. Immunogenet. 2010, 37, 493–497. [Google Scholar] [CrossRef]
- Yang, L.; Wu, L.; Fan, Y.; Ma, J. Vitamin D receptor gene polymorphisms in association with diabetic nephropathy: A systematic review and meta-analysis. BMC Med. Genet. 2017, 18, 95. [Google Scholar] [CrossRef] [PubMed]
- Soroush, N.; Radfar, M.; Hamidi, A.K.; Abdollahi, M.; Qorbani, M.; Razi, F.; Esfahani, E.N.; Amoli, M.M. Vitamin D receptor gene FokI variant in diabetic foot ulcer and its relation with oxidative stress. Gene 2016, 599, 87–91. [Google Scholar] [CrossRef]
Primer | Primer Sequence (5′-3′) | Size (bp) |
---|---|---|
FokI F | AGTTGGCCCTGGCACTGACTCTGCTCT | 245 |
FokI R | ATGGAAACACCTTGCTTCTTCTCC CTC | |
ApaI-TaqI F | CAGAGCATGGACAGGGAGCAA | 745 |
ApaI-TaqI R | GCAACTCCTCATGGCTGAGGTCTC | |
BsmI F | AACCAGCGGGAAGAG GTCAAGGG | 823 |
BsmI R | CAACCAAGACTACAAGTACCGCGTCAG |
Demographic Data | Value |
---|---|
Age (mean ± SD) | 63.43 ± 13.62 years |
Sex (%) | 40 (44.4) males, 50 (44.6) females |
Biochemical parameters (mean ± SD) | |
HbcA1 | 7.57 ± 1.71% |
LDL | 105.17 ± 41.16 mg/dL |
HDL | 45.69 ± 14.18 mg/dL |
TG | 165.28 ± 86.29 mg/dL |
Creatinine | 0.95 ± 0.49 mg/dL |
Diabetic complications (%) | |
Cardiovascular disease | 55 (55.6) |
Retinopathy | 10 (11.1) |
Nephropathy | 12 (13.3) |
Neuropathy | 16 (17.8) |
VDR Genetic Variants | ||||
---|---|---|---|---|
Genotype | FokI | ApaI | Taq1 | BsmI |
Wild-type | 41 (45.61%) | 25 (27.8%) | 37 (41.1%) | 27 (30%) |
Heterozygous | 39 (43.30%) | 52 (57.8%) | 38 (42.2%) | 47 (52.2%) |
Homozygous | 10 (11.18%) | 10 (11.1%) | 12 (13.3%) | 16 (17.8%) |
Missing data a | 0 | 3 | 3 | 0 |
Allele frequency | ||||
Observed | 0.32 | 0.41 | 0.36 | 0.44 |
VDR Variant | ||||
---|---|---|---|---|
FokI | ApaI | Taq1 | BsmI | Frequency a |
T | C | T | C | 0.27 |
T | A | C | T | 0.25 |
C | A | C | T | 0.13 |
T | C | C | T | 0.10 |
C | C | C | T | 0.08 |
C | C | T | C | 0.08 |
T | C | C | C | 0.04 |
C | A | C | C | 0.02 |
C | C | C | C | 0.02 |
T | A | C | C | 0.01 |
VDR Variant | Biochemical Parameter | ||||
---|---|---|---|---|---|
FokI genotype | HbA1C (%) | LDL (mg/dL) | HDL (mg/dL) | TG (mg/dL) | Creatinine (mg/dL) |
Wild-type | 7.75 ± 2.04 | 106.51 ± 39.15 | 47.17 ± 14.14 | 184.07 ± 102.8 | 0.98 ± 0.57 |
Heterozygous | 7.34 ± 1.41 | 100.85 ± 38.13 | 43.91 ± 13.98 | 149.17 ± 69.98 | 0.93 ± 0.41 |
Homozygous | 7.76 ± 1.25 | 116.50 ± 59.79 | 46.6 ± 15.81 | 151.20 ± 55.29 | 0.87 ± 0.41 |
p-value | 0.54 | 0.55 | 0.58 | 0.17 | 0.73 |
ApaI genotype | HbA1C (%) | LDL (mg/dL) | HDL (mg/dL) | TG (mg/dL) | Creatinine (mg/dL) |
Wild-type | 7.94 ± 2.16 | 113.2 ± 40.19 | 49.68 ± 15.86 | 177.48 ± 86.83 | 1.05 ± 0.69 |
Heterozygous | 7.5 ± 1.55 | 104.31 ± 41.64 | 44.73 ± 13.38 | 161.32 ± 90.57 | 0.92 ± 0.40 |
Homozygous | 7.11 ± 1.39 | 104.93 ± 36 | 37.93 ± 9.22 | 165.42 ± 54.67 | 0.92 ± 0.34 |
p-value | 0.39 | 0.66 | 0.03 * | 0.52 | 0.52 |
Taq1 genotype | HbA1C (%) | LDL (mg/dL) | HDL (mg/dL) | TG (mg/dL) | Creatinine (mg/dL) |
Wild-type | 7.26 ± 1.48 | 108.71 ± 42.86 | 44.47 ± 12.02 | 161.65 ± 73.17 | 0.88 ± 0.33 |
Heterozygous | 7.65 ± 1.53 | 104.21 ± 37.12 | 44.53 ± 13.51 | 165.96 ± 101.94 | 1.02 ± 0.64 |
Homozygous | 8.45 ± 2.62 | 109.58 ± 45.75 | 50.92 ± 20.44 | 178.41 ± 75.22 | 0.98 ± 0.35 |
p-value | 0.11 | 0.87 | 0.34 | 0.85 | 0.47 |
BsmI genotype | HbA1C (%) | LDL (mg/dL) | HDL (mg/dL) | TG (mg/dL) | Creatinine (mg/dL) |
Wild-type | 7.28 ± 1.55 | 104.01 ± 39.34 | 43.57 ± 13.24 | 154.23 ± 72.39 | 0.77 ± 0.23 |
Heterozygous | 7.59 ± 1.49 | 106.38 ± 41.13 | 43.98 ± 13.17 | 168.54 ± 97.95 | 1.00 ± 0.46 |
Homozygous | 8.00 ± 2.44 | 103.56 ± 46.11 | 54.31 ± 16.45 | 174.43 ± 72.97 | 1.08 ± 0.77 |
p-value | 0.41 | 0.96 | 0.02 * | 0.71 | 0.08 |
VDR Variant | Diabetes Complication | |||||||
---|---|---|---|---|---|---|---|---|
FoxI genotype | Cardiovascular disease | Neuropathy | Retinopathy | Nephropathy | ||||
yes | no | yes | no | yes | no | yes | no | |
Wild-type | 25 | 16 | 9 | 32 | 5 | 36 | 5 | 36 |
Heterozygous | 21 | 18 | 5 | 34 | 5 | 34 | 5 | 34 |
Homozygous | 4 | 6 | 2 | 8 | 0 | 10 | 2 | 8 |
p-value | 0.47 | 0.56 | 0.49 | 0.80 | ||||
ApaI genotype | Cardiovascular disease | Neuropathy | Retinopathy | Nephropathy | ||||
yes | no | yes | no | yes | no | yes | no | |
Wild-type | 13 | 12 | 7 | 18 | 3 | 22 | 3 | 22 |
Heterozygous | 32 | 20 | 9 | 43 | 3 | 49 | 6 | 46 |
Homozygous | 4 | 6 | 0 | 10 | 4 | 6 | 3 | 7 |
p-value | 0.40 | 0.15 | 0.008 * | 0.29 | ||||
Taq1 genotype | Cardiovascular disease | Neuropathy | Retinopathy | Nephropathy | ||||
yes | no | yes | no | yes | no | yes | no | |
Wild-type | 19 | 18 | 3 | 34 | 6 | 31 | 5 | 32 |
Heterozygous | 24 | 14 | 11 | 27 | 2 | 36 | 5 | 33 |
Homozygous | 6 | 6 | 2 | 10 | 1 | 11 | 1 | 11 |
p-value | 0.53 | 0.08 | 0.29 | 0.89 | ||||
BsmI genotype | Cardiovascular disease | Neuropathy | Retinopathy | Nephropathy | ||||
yes | no | yes | no | yes | no | yes | no | |
Wild-type | 14 | 13 | 3 | 24 | 6 | 21 | 4 | 23 |
Heterozygous | 29 | 18 | 9 | 38 | 2 | 45 | 6 | 41 |
Homozygous | 7 | 9 | 4 | 12 | 2 | 14 | 2 | 14 |
p-value | 0.41 | 0.48 | 0.04 * | 0.96 |
Gene | VDRE Position in the Promoter # | VDRE Sequence |
---|---|---|
Human APOA1 | −5 to −8 | ACCC |
−341 to −344 | GGGT | |
−735 to −738 | ACCC | |
−741 to −744 | ACCC | |
−746 to −749 | ACCC | |
−795 to −798 | ACCC | |
−802 to −805 | ACCC | |
−956 to −959 | ACCC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Alhawari, H.; Jarrar, Y.; Abulebdah, D.; Abaalkhail, S.J.; Alkhalili, M.; Alkhalili, S.; Alhawari, H.; Momani, M.; Obeidat, M.N.; Fram, R.K.; et al. Effects of Vitamin D Receptor Genotype on Lipid Profiles and Retinopathy Risk in Type 2 Diabetes Patients: A Pilot Study. J. Pers. Med. 2022, 12, 1488. https://doi.org/10.3390/jpm12091488
Alhawari H, Jarrar Y, Abulebdah D, Abaalkhail SJ, Alkhalili M, Alkhalili S, Alhawari H, Momani M, Obeidat MN, Fram RK, et al. Effects of Vitamin D Receptor Genotype on Lipid Profiles and Retinopathy Risk in Type 2 Diabetes Patients: A Pilot Study. Journal of Personalized Medicine. 2022; 12(9):1488. https://doi.org/10.3390/jpm12091488
Chicago/Turabian StyleAlhawari, Hussam, Yazun Jarrar, Dina Abulebdah, Sara J. Abaalkhail, Marah Alkhalili, Sura Alkhalili, Hussein Alhawari, Munther Momani, Mohammed N. Obeidat, Rand K. Fram, and et al. 2022. "Effects of Vitamin D Receptor Genotype on Lipid Profiles and Retinopathy Risk in Type 2 Diabetes Patients: A Pilot Study" Journal of Personalized Medicine 12, no. 9: 1488. https://doi.org/10.3390/jpm12091488