Comparison of Biomarkers Playing a Role in Pterygium Development in Pterygium and Recurrent Pterygium Tissues
Abstract
1. Introduction
2. Materials and Methods
- Patients aged 18–65 years;
- Patients presenting with specific pterygium symptoms;
- Patients with primary or recurrent pterygium;
- Patients who agreed to sign the individual consent form.
- Failure to diagnose specific pterygium symptoms (patients with atypical pterygium, pseudopterjium);
- Patients with bleeding diathesis;
- Patients who did not provide informed consent for the study.
2.1. Homogenization of Tissues
2.2. Determination of Total Protein via Bicinchoninic Acid (BCA) Protein Assay
2.3. Determination of TGF-β1, IL-1β, IL-6, IL-8, and IL-10 Levels in Tissue Homogenates via ELISA
2.4. Total RNA Extraction, Reverse Transcription, and Quantitative PCR
2.5. Statistical Analysis
3. Results
Comparative Analysis of mRNA Expression Levels
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Chui, J.; Coroneo, M.T.; Tat, L.T.; Crouch, R.; Wakefield, D.; Di Girolamo, N. Ophthalmic pterygium: A stem cell disorder with premalignant features. Am. J. Pathol. 2011, 178, 817–827. [Google Scholar] [CrossRef] [PubMed]
- Liu, T.; Liu, Y.; Xie, L.; He, X.; Bai, J. Progress in the pathogenesis of pterygium. Curr. Eye Res. 2013, 38, 1191. [Google Scholar] [CrossRef] [PubMed]
- Gazzard, G.; Saw, S.M.; Farook, M.; Koh, D.; Widjaja, D.; Chia, S.E.; Hong, C.Y.; Tan, D.T. Pterygium in Indonesia: Prevalence, severity and risk factors. Br. J. Ophthalmol. 2002, 86, 1341–1346. [Google Scholar] [CrossRef] [PubMed]
- Chui, J.; di Girolamo, N.; Wakefield, D.; Coroneo, M.T. The pathogenesis of pterygium: Current concepts and their therapeutic implications. Ocul. Surf. 2008, 6, 24–43. [Google Scholar] [CrossRef]
- Sul, S.; Korkmaz, Ş.; Novruzlu, Ş. Seasonal effects on pterygium surgery outcome: Implications for the role of sunlight exposure. Cornea 2014, 33, 504–506. [Google Scholar] [CrossRef] [PubMed]
- Durkin, S.R.; Abhary, S.; Newland, H.S.; Selva, D.; Aung, T.; Casson, R.J. The prevalence, severity and risk factors for pterygium in central Myanmar: The Meiktila Eye Study. Br. J. Ophthalmol. 2008, 92, 25–29. [Google Scholar] [CrossRef]
- Di Girolamo, N.; Chui, J.; Coroneo, M.T.; Wakefield, D. Pathogenesis of pterygia: Role of cytokines, growth factors, and matrix metalloproteinases. Prog. Retin. Eye Res. 2004, 23, 195–228. [Google Scholar] [CrossRef]
- Detorakis, E.T.; Drakonaki, E.E.; Spandidos, D.A. Molecular genetic alterations and viral presence in ophthalmic pterygium. Int. J. Mol. Med. 2000, 6, 35–41. [Google Scholar] [CrossRef]
- Noma, H.; Mimura, T.; Yasuda, K.; Shimura, M. Role of inflammation in diabetic macular edema. Ophthalmologica 2014, 232, 127–135. [Google Scholar] [CrossRef]
- Salazar, A.; Casanova-Méndez, I.; Pacheco-Quito, M.; Velázquez-Soto, H.; Ayala-Balboa, J.; Graue-Hernández, E.O.; Serafín-López, J.; Jiménez-Martínez, M.C. Low expression of IL-10 in circulating bregs and inverted IL-10/tnf-α ratio in tears of patients with perennial allergic conjunctivitis: A preliminary study. Int. J. Mol. Sci. 2019, 20, 1035. [Google Scholar] [CrossRef]
- Moudi, B.; Heidari, Z.; Mahmoudzadeh-Sagheb, H.; Moudi, M. Analysis of interleukin-10 gene polymorphisms in patients with chronic periodontitis and healthy controls. Dent. Res. J. 2018, 15, 71–79. [Google Scholar] [CrossRef]
- González Maglio, D.H.; Paz, M.L.; Leoni, J. Sunlight effects on ımmune system: Is there something else in addition to UV-induced immunosuppression? BioMed Res. Int. 2016, 2016, 1934518. [Google Scholar] [CrossRef] [PubMed]
- Cai, L.; Li, Z.; Guan, X.; Cai, K.; Wang, L.; Liu, J.; Tong, Y. The research progress of host genes and tuberculosis susceptibility. Oxid. Med. Cell Longev. 2019, 2019, 9273056. [Google Scholar] [CrossRef]
- Fang, Y.; Gao, Q.; Jin, W.; Li, J.; Yuan, H.; Lin, Z.; Pan, G.; Lin, W. Clinical characteristics and prognostic analysis of acute necrotizing encephalopathy of childhood: A retrospective study at a single center in China over 3 years. Front. Neurol. 2023, 14, 1308044. [Google Scholar] [CrossRef]
- Wang, Z.W.; Chen, L.; Hao, X.R.; Qu, Z.A.; Huang, S.B.; Ma, X.J.; Wang, J.C.; Wang, W.M. Elevated levels of interleukin-1β, interleukin-6, tumor necrosis factor-α and vascular endothelial growth factor in patients with knee articular cartilage injury. World J. Clin. Cases 2019, 7, 1262–1269. [Google Scholar] [CrossRef] [PubMed]
- Szmyd, B.; Sołek, J.; Błaszczyk, M.; Jankowski, J.; Liberski, P.P.; Jaskólski, D.J.; Wysiadecki, G.; Karuga, F.F.; Gabryelska, A.; Sochal, M.; et al. The underlying pathogenesis of neurovascular compression syndromes: A systematic review. Front. Mol. Neurosci. 2022, 15, 923089. [Google Scholar] [CrossRef]
- Rezvan, F.; Khabazkhoob, M.; Hooshmand, E.; Yekta, A.; Saatchi, M.; Hashemi, H. Prevalence and risk factors of pterygium: A systematic review and meta-analysis. Surv. Ophth. 2018, 63, 719–735. [Google Scholar] [CrossRef]
- Kim, J.W.; Jeong, H.; Yang, M.S.; Lim, C.W.; Kim, B. Therapeutic effects of zerumbone in an alkali-burned corneal wound healing model. Int. Immunopharmacol. 2017, 48, 126–134. [Google Scholar] [CrossRef]
- Skwor, T.A.; Atik, B.; Kandel, R.P.; Adhikari, H.K.; Sharma, B.; Dean, D. Role of secreted conjunctival mucosal cytokine and chemokine proteins in different stages of trachomatous disease. PLOS Negl. Trop. Dis. 2008, 2, e264. [Google Scholar] [CrossRef]
- Di Girolamo, N.; Kumar, R.K.; Coroneo, M.T.; Wakefield, D. UVB-mediated induction of interleukin-6 and −8 in pterygia and cultured human pterygium epithelial cells. Investig. Ophthalmol. Vis. Sci. 2002, 43, 3430–3437. [Google Scholar] [CrossRef]
- Yoshida, S.; Kubo, Y.; Kobayashi, Y.; Zhou, Y.; Nakama, T.; Yamaguchi, M.; Tachibana, T.; Ishikawa, K.; Arita, R.; Nakao, S.; et al. Increased vitreous concentrations of MCP-1 and IL-6 after vitrectomy in patients with proliferative diabetic retinopathy: Possible association with postoperative macular oedema. Br. J. Ophthalmol. 2015, 99, 960–966. [Google Scholar] [CrossRef] [PubMed]
- Fodor, M.; Facskó, A.; Rajnavölgyi, E.; Hársfalvi, J.; Bessenyei, E.; Kardos, L.; Berta, A. Enhanced release of IL-6 and IL-8 into tears in various anterior segment eye diseases. Ophthalmic Res. 2006, 38, 182–188. [Google Scholar] [CrossRef] [PubMed]
- Astorri, E.; Nerviani, A.; Bombardieri, M.; Pitzalis, C. Towards a stratified targeted approach with biologic treatments in rheumatoid arthritis: Role of synovial pathobiology. Curr. Pharm. Des. 2015, 21, 2216–2224. [Google Scholar] [CrossRef] [PubMed]
- Venza, I.; Cucinotta, M.; Caristi, S.; Mancuso, G.; Teti, D. Transcriptional regulation of IL-8 by Staphylococcus aureus in human conjunctival cells involves activation of AP-1. Investig. Ophthalmol. Vis. Sci. 2007, 48, 270–276. [Google Scholar] [CrossRef] [PubMed]
- Miyoshi, T.; Fukagawa, K.; Shimmura, S.; Fujishima, H.; Takano, Y.; Takamura, E.; Tsubota, K.; Saito, H.; Oguchi, Y. Interleukin-8 concentrations in conjunctival epithelium brush cytology samples correlate with neutrophil, eosinophil infiltration, and corneal damage. Cornea 2001, 20, 743–747. [Google Scholar] [CrossRef]
- Rossi, D.; Zlotnik, A. The biology of chemokines and their receptors. Annu. Rev. Immunol. 2000, 18, 217–242. [Google Scholar] [CrossRef]
- Chan, M.F.; Sack, R.; Quigley, D.A.; Sathe, S.; Vijmasi, T.; Li, S.; Holsclaw, D.; Strauss, E.C.; McNamara, N.A. Membrane array analysis of tear proteins in ocular cicatricial pemphigoid. Optom. Vis. Sci. 2011, 88, 1005–1009. [Google Scholar] [CrossRef]
- Massingale, M.L.; Li, X.; Vallabhajosyula, M.; Chen, D.; Wei, Y.; Asbell, P.A. Analysis of inflammatory cytokines in the tears of dry eye patients. Cornea 2009, 28, 1023–1027. [Google Scholar] [CrossRef]
- Xi, X.; McMillan, D.H.; Lehmann, G.M.; Sime, P.J.; Libby, R.T.; Huxlin, K.R.; Feldon, S.E.; Phipps, R.P. Ocular fibroblast diversity: Implications for inflammation and ocular wound healing. Investig. Ophthalmol. Vis. Sci. 2011, 52, 4859–4865. [Google Scholar] [CrossRef]
- Tseng, H.C.; Lee, I.T.; Lin, C.C.; Chi, P.L.; Cheng, S.E.; Shih, R.H.; Hsiao, L.D.; Yang, C.M. IL-1beta promotes corneal epithelial cell migration by increasing MMP-9 expression through NF-κB- and AP-1-dependent pathways. PLoS ONE 2013, 8, e57955. [Google Scholar] [CrossRef]
- Guo, Q.; Li, X.; Cui, M.N.; Liang, Y.; Li, X.P.; Zhao, J.; Wei, L.N.; Zhang, X.L.; Quan, X.H. Low-dose mitomycin C decreases the postoperative recurrence rate of pterygium by perturbing NLRP3 inflammatory signalling pathway and suppressing the expression of inflammatory factors. J. Ophthalmol. 2019, 2019, 9472782. [Google Scholar] [CrossRef] [PubMed]
- Kria, L.; Ohira, A.; Amemiya, T. Immunohistochemical localization of basic fibroblast growth factor, platelet derived growth factor, transforming growth factor-beta and tumor necrosis factor-alpha in the pterygium. Acta Histochem. 1996, 98, 195–201. [Google Scholar] [CrossRef]
- Li, G.; Li, Y.Y.; Sun, J.E.; Lin, W.H.; Zhou, R.X. ILK-PI3K/AKT pathway participates in cutaneous wound contraction by regulating fibroblast migration and differentiation to myofibroblast. Lab. Investig. 2016, 96, 741–751. [Google Scholar] [CrossRef]
- Abdalla, M.; Goc, A.; Segar, L.; Somanath, P.R. Akt1 mediates alpha-smooth muscle actin expression and myofibroblast differentiation via myocardin and serum response factor. J. Biol. Chem. 2013, 288, 33483–33493. [Google Scholar] [CrossRef]
- Abdalla, M.; Sabbineni, H.; Prakash, R.; Ergul, A.; Fagan, S.C.; Somanath, P.R. The Akt inhibitor, triciribine, ameliorates chronic hypoxia-induced vascular pruning and TGFbeta-induced pulmonary fibrosis. Br. J. Pharmacol. 2015, 172, 4173–4188. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.W.; Kim, H.I.; Thapa, B.; Nuwormegbe, S.; Lee, K. Critical role of mTORC2-Akt signaling in TGF-β1-induced myofibroblast differentiation of human pterygium fibroblasts. Investig. Ophthalmol. Vis. Sci. 2019, 60, 82–92. [Google Scholar] [CrossRef] [PubMed]
- Shayegan, M.R.; Khakzad, M.R.; Gharaee, H.; Varasteh, A.R.; Sankian, M. Evaluation of transforming growth factor-beta1 gene expression in pterygium tissue of atopic patients. J. Chin. Med. Assoc. 2016, 79, 565–569. [Google Scholar] [CrossRef]
- Chan, C.M.L.; Liu, Y.P.; Tan, D.T.H. Ocular surface changes in pterygium. Cornea 2002, 21, 38–42. [Google Scholar] [CrossRef]
- Yeung, S.N.; Kim, P.; Lichtinger, A.; Amiran, M.D.; Cote, E.; Teitel, S.; Slomovic, A.R. Incidence of ocular surface squamous neoplasia in pterygium specimens: An 8-year survey. Br. J. Ophthalmol. 2011, 95, 592. [Google Scholar] [CrossRef]
- Weinstein, O.; Rosenthal, G.; Zirkin, H.; Monos, T.; Lifshitz, T.; Argov, S. Overexpression of p53 tumor suppressor gene in pterygia. Eye 2002, 16, 619–621. [Google Scholar] [CrossRef]
- Blobe, G.C.; Schiemann, W.P.; Lodish, H.F. Role of transforming growth factor beta in human disease. N. Engl. J. Med. 2000, 342, 1350–1358. [Google Scholar] [CrossRef] [PubMed]
- Maehara, Y.; Kakeji, Y.; Kabashima, A.; Emi, Y.; Watanabe, A.; Akazawa, K.; Baba, H.; Kohnoe, S.; Sugimachi, K. Role of transforming growth factor-beta 1 in invasion and metastasis in gastric carcinoma. J. Clin. Oncol. 1999, 17, 607–614. [Google Scholar] [CrossRef] [PubMed]
- Picon, A.; Gold, L.I.; Wang, J.; Cohen, A.; Friedman, E. A subset of metastatic human colon cancers expresses elevated levels of transforming growth factor beta1. Cancer Epidemiol. Biomarkers Prev. 1998, 7, 497–504. [Google Scholar] [PubMed]
- Balzar, S.; Chu, H.W.; Silkoff, P.; Cundall, M.; Trudeau, J.B.; Strand, M.; Wenzel, S. Increased TGF-beta2 in severe asthma with eosinophilia. J. Allergy Clin. Immunol. 2005, 115, 110–117. [Google Scholar] [CrossRef] [PubMed]
- Leonardi, A.; Di Stefano, A.; Motterle, L.; Zavan, B.; Abatangelo, G.; Brun, P. Transforming growth factor-β/Smad–signalling pathway and conjunctival remodelling in vernal keratoconjunctivitis. Clin. Exp. Allergy 2011, 41, 52–60. [Google Scholar] [CrossRef]
- Singer, A.J.; Clark, R.A. Cutaneous wound healing. N. Engl. J. Med. 1999, 341, 738–746. [Google Scholar] [CrossRef] [PubMed]
- Pang, Y.; Rose, T. Rapid growth of pterygium after photorefractive keratectomy. Optometry 2006, 77, 499–502. [Google Scholar] [CrossRef]
- Gum, S.I.; Kim, Y.H.; Jung, J.C.; Kim, I.G.; Lee, J.S.; Lee, K.W.; Park, Y.J. Cyclosporine A inhibits TGF-β2-induced myofibroblasts of primary cultured human pterygium fibroblasts. Biochem. Biophys. Res. Commun. 2017, 482, 1148–1153. [Google Scholar] [CrossRef]
Genes | Primer Sequences (5′ → 3′) | RT-PCR Programs | Cycle |
---|---|---|---|
GAPDH | F-5′ GATTTGGTCGTATTGGGCGC 3′ R-5′AGTGATGGCATGGACTGTGG 3′ | 95 °C-30 s/59 °C-1 m/72 °C-30 s | 35 |
TGF-β1 | F-5′- ACGCTTCGACAATGAGACGT-3′ R-5′- CACCCTTCTCCAGCTGGAAG -3′ | 95 °C-30 s/57 °C-1 m/72 °C-30 s | 35 |
IL-1β | F-5′-AACAGGCTGCTCTGGGATTC-3′ R-5′-TATCCTGTCCCTGGAGGTGG-3′ | 95 °C-30 s/58 °C-1 m/72 °C-30 s | 35 |
IL-6 | F-5′-CCCAGAAGTTCTCCTGCCAG 3′ R-5′-GAATCTTGCACTGGGAGGCT 3′ | 95 °C-30 s/57 °C-1 m/72 °C-30 s | 35 |
IL-8 | F-5′-TCTGTCTGGACCCCAAGGAA-3′ R-5′-TGGATCCTGGCTAGCAGACT-3′ | 95 °C-30 s/58 °C-1 m/72 °C-30 s | 35 |
IL-10 | F-5′-TACGGCGCTGTCATCGATTT-3′ R-5′-GTGGTCAGGCTTGGAATGGA-3′ | 95 °C-30 s/58 °C-1 m/72 °C-30 s | 35 |
Female | Male | Total Number of Patients | Average Age | p | |
---|---|---|---|---|---|
Primary pterygium | 19 | 11 | 30 | 57.60 ± 11.5 | 0.6808 |
Recurrent pterygium | 10 | 5 | 15 | 59.13 ± 12.13 |
Genes | Recurrent Pterygium Tissues | ||
---|---|---|---|
Gene Expression | p Value | Up-/Downregulation | |
TGF-β1 | 1.253 | 0.034 * | Upregulation |
IL-1β | 1.145 | 0.165 | Nonstatistical |
IL-6 | 1.157 | 0.124 | Nonstatistical |
IL-8 | 1.118 | 0.324 | Nonstatistical |
IL-10 | 0.787 | 0.044 * | Downregulation |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Eroğul, Ö.; Şen, S. Comparison of Biomarkers Playing a Role in Pterygium Development in Pterygium and Recurrent Pterygium Tissues. Diagnostics 2024, 14, 2619. https://doi.org/10.3390/diagnostics14232619
Eroğul Ö, Şen S. Comparison of Biomarkers Playing a Role in Pterygium Development in Pterygium and Recurrent Pterygium Tissues. Diagnostics. 2024; 14(23):2619. https://doi.org/10.3390/diagnostics14232619
Chicago/Turabian StyleEroğul, Özgür, and Serkan Şen. 2024. "Comparison of Biomarkers Playing a Role in Pterygium Development in Pterygium and Recurrent Pterygium Tissues" Diagnostics 14, no. 23: 2619. https://doi.org/10.3390/diagnostics14232619
APA StyleEroğul, Ö., & Şen, S. (2024). Comparison of Biomarkers Playing a Role in Pterygium Development in Pterygium and Recurrent Pterygium Tissues. Diagnostics, 14(23), 2619. https://doi.org/10.3390/diagnostics14232619