Detection of SARS-CoV-2 Variants via Different Diagnostics Assays Based on Single-Nucleotide Polymorphism Analysis
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. RNA Extraction Protocol
2.3. Molecular Assays for SARS-CoV-2 Variant Identification
2.3.1. TaqPath™ COVID 19 CE IVD RT PCR
2.3.2. Seegene Novaplex SARS-CoV-2 Variants VII
2.3.3. Seegene Allplex Variants II
2.4. Sanger Sequencing
2.5. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Zhu, N.; Zhang, D.; Wang, W.; Li, X.; Yang, B.; Song, J.; Zhao, X.; Huang, B.; Shi, W.; Lu, R.; et al. China Novel Coronavirus Investigating and Research Team. A Novel Coronavirus from Patients with Pneumonia in China, 2019. N. Engl. J. Med. 2020, 382, 727–733. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jackson, B.; Boni, M.F.; Bull, M.J.; Colleran, A.; Colquhoun, R.M.; Darby, A.C.; Haldenby, S.; Hill, V.; Lucaci, A.; McCrone, J.T.; et al. Generation and transmission of interlineage recombinants in the SARS-CoV-2 pandemic. Cell 2021, 184, 5179–5188.e8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Velazquez-Salinas, L.; Zarate, S.; Eberl, S.; Gladue, D.P.; Novella, I.; Borca, M.V. Positive Selection of ORF1ab, ORF3a, and ORF8 Genes Drives the Early Evolutionary Trends of SARS-CoV-2 during the 2020 COVID-19 Pandemic. Front. Microbiol. 2020, 11, 550674. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jung, C.; Kmiec, D.; Koepke, L.; Zech, F.; Jacob, T.; Sparrer, K.M.J.; Kirchhoff, F. Omicron: What Makes the Latest SARS-CoV-2 Variant of Concern So Concerning? J. Virol. 2022, 96, e0207721. [Google Scholar] [CrossRef] [Scilit]
- World Health Organization. Available online: https://www.who.int/news/item/28-11-2021-update-on-omicron (accessed on 30 January 2023).
- Shrestha, L.B.; Foster, C.; Rawlinson, W.; Tedla, N.; Bull, R.A. Evolution of the SARS-CoV-2 omicron variants BA.1 to BA.5: Implications for immune escape and transmission. Rev. Med. Virol. 2022, 32, e2381. [Google Scholar] [CrossRef] [Scilit]
- Tallei, T.E.; Alhumaid, S.; AlMusa, Z.; Fatimawali Kusumawaty, D.; Alynbiawi, A.; Alshukairi, A.N.; Rabaan, A.A. Update on the omicron sub-variants BA.4 and BA.5. Rev. Med. Virol. 2023, 33, e2391. [Google Scholar] [CrossRef] [Scilit]
- Coronavirus (COVID-19) Update: FDA Limits Use of Certain Monoclonal Antibodies to Treat COVID-19 due to Omicron Variant. US Food and Drug Administration Website. Available online: https://www.fda.gov/news-events/press-announcements/coronavirus-covid-19-update-fda-limits-use-certain-monoclonal-antibodies-treat-covid-19-due-omicron (accessed on 11 August 2022).
- Jackson, P.E.; Scholl, P.F.; Groopman, J.D. Mass spectrometry for genotyping: An emerging tool for molecular medicine. Mol. Med. Today 2000, 6, 271–276. [Google Scholar] [CrossRef] [Scilit]
- Welch, N.L.; Zhu, M.; Hua, C.; Weller, J.; Mirhashemi, M.E.; Nguyen, T.G.; Mantena, S.; Bauer, M.R.; Shaw, B.M.; Ackerman, C.M.; et al. Multiplexed CRISPR-based microfluidic platform for clinical testing of respiratory viruses and identification of SARS-CoV-2 variants. Nat. Med. 2022, 28, 1083–1094. [Google Scholar] [CrossRef] [Scilit]
- Scott, L.; Hsiao, N.-Y.; Moyo, S.; Singh, L.; Tegally, H.; Dor, G.; Maes, P.; Pybus, O.G.; Kraemer, M.U.G.; Semenova, E.; et al. Track Omicron’s spread with molecular data. Science 2021, 374, 1454–1455. [Google Scholar] [CrossRef] [Scilit]
- Lai, E.; Kennedy, E.B.; Lozach, J.; Hayashibara, K.; Davis-Turak, J.; Becker, D.; Brzoska, P.; Cassens, T.; Diamond, E.; Gandhi, M.; et al. A Method for Variant Agnostic Detection of SARS-CoV-2, Rapid Monitoring of Circulating Variants, and Early Detection of Emergent Variants Such as Omicron. J. Clin. Microbiol. 2022, 60, e0034222. [Google Scholar] [CrossRef] [Scilit]
- Kidd, M.; Richter, A.; Best, A.; Cumley, N.; Mirza, J.; Percival, B.; Mayhew, M.; Megram, O.; Ashford, F.; White, T.; et al. S-Variant SARS-CoV-2 Lineage B1.1.7 Is Associated with Significantly Higher Viral Load in Samples Tested by TaqPath Polymerase Chain Reaction. J. Infect. Dis. 2021, 223, 1666–1670. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Available online: https://www.ecdc.europa.eu/sites/default/files/documents/threat-assessment-covid-19-emergence-sars-cov-2-variant-omicron-december-2021.pdf (accessed on 28 March 2023).
- Available online: https://www.who.int/publications/m/item/enhancing-readiness-for-omicron-(b.1.1.529)-technical-brief-and-priority-actions-for-member-states (accessed on 28 March 2023).
- McMillen, T.; Jani, K.; Robilotti, E.V.; Kamboj, M.; Babady, N.E. The spike gene target failure (SGTF) genomic signature is highly accurate for the identification of Alpha and Omicron SARS-CoV-2 variants. Sci. Rep. 2022, 12, 18968. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Available online: https://www.ecdc.europa.eu/sites/default/files/documents/Methods-for-the-detection-char-SARS-CoV-2-variants_2nd%20update_final.pdf (accessed on 28 March 2023).
- Guerrero-Preston, R.; Rivera-Amill, V.; Caraballo, K.; Rodríguez-Torres, S.; Purcell-Wiltz, A.; García, A.A.; Torres, R.S.; Zamuner, F.T.; Zanettini, C.; MacKay, M.J.; et al. Precision health diagnostic and surveillance network uses S gene target failure (SGTF) combined with sequencing technologies to track emerging SARS-CoV-2 variants. Immun. Inflamm. Dis. 2022, 10, e634. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dol, J.; Boulos, L.; Somerville, M.; Saxinger, L.; Doroshenko, A.; Hastings, S.; Reynolds, B.; Gallant, A.; Shin, H.D.; Wong, H.; et al. Health system impacts of SARS-CoV - 2 variants of concern: A rapid review. BMC Health Serv. Res. 2022, 22, 544. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Campbell, F.; Archer, B.; Laurenson-Schafer, H.; Jinnai, Y.; Konings, F.; Batra, N.; Pavlin, B.; Vandemaele, K.; Van Kerkhove, M.D.; Jombart, T.; et al. Increased transmissibility and global spread of SARS-CoV-2 variants of concern as at June 2021. Eurosurveillance 2021, 26, 2100509. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lai, A.; Bergna, A.; Della Ventura, C.; Menzo, S.; Bruzzone, B.; Sagradi, F.; Ceccherini-Silberstein, F.; Weisz, A.; Clementi, N.; Brindicci, G.; et al. Epidemiological and Clinical Features of SARS-CoV-2 Variants Circulating between April–December 2021 in Italy. Viruses 2022, 14, 2508. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moreno, G.; Braun, K.; Larsen, B.B.; Alpert, T.; Worobey, M.; Grubaugh, N.; Friedrich, T.; O’Connor, D.; Fauver, J.; Brito, A. Detection of non-B.1.1.7 Spike D69/70 Sequences (B.1.375) in the United States. 2021. Published online 12 January 2021. Available online: https://virological.org/t/detection-of-non-b-1-1-7spike-69-70-sequences-b-1-375-in-the-united-states/587 (accessed on 31 January 2023).
- Migueres, M.; Lhomme, S.; Trémeaux, P.; Dimeglio, C.; Ranger, N.; Latour, J.; Dubois, M.; Nicot, F.; Miedouge, M.; Mansuy, J.; et al. Evaluation of two RT-PCR screening assays for identifying SARS-CoV-2 variants. J. Clin. Virol. 2021, 143, 104969. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lam, C.; Gray, K.; Gall, M.; Sadsad, R.; Arnott, A.; Johnson-Mackinnon, J.; Fong, W.; Basile, K.; Kok, J.; Dwyer, D.E.; et al. SARS-CoV-2 Genome Sequencing Methods Differ in Their Abilities To Detect Variants from Low-Viral-Load Samples. J. Clin. Microbiol. 2021, 59, e01046-21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brito-Mutunayagam, S.; Maloney, D.; McAllister, G.; Dewar, R.; McHugh, M.; Templeton, K. Rapid detection of SARS-CoV-2 variants using allele-specific PCR. J. Virol. Methods 2022, 303, 114497. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Charre, C.; Ginevra, C.; Sabatier, M.; Regue, H.; Destras, G.; Brun, S.; Burfin, G.; Scholtes, C.; Morfin, F.; Valette, M.; et al. Evaluation of NGS-based approaches for SARS-CoV-2 whole genome characterisation. Virus Evol. 2020, 6, veaa075. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Berno, G.; Fabeni, L.; Matusali, G.; Gruber, C.E.M.; Rueca, M.; Giombini, E.; Garbuglia, A.R. SARS-CoV-2 Variants Identification: Overview of Molecular Existing Methods. Pathogens 2022, 11, 1058. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vega-Magaña, N.; Sánchez-Sánchez, R.; Hernández-Bello, J.; Venancio-Landeros, A.A.; Peña-Rodríguez, M.; Vega-Zepeda, R.A.; Galindo-Ornelas, B.; Díaz-Sánchez, M.; García-Chagollán, M.; Macedo-Ojeda, G.; et al. RT-qPCR Assays for Rapid Detection of the N501Y, 69-70del, K417N, and E484K SARS-CoV-2 Mutations: A Screening Strategy to Identify Variants with Clinical Impact. Front. Cell. Infect. Microbiol. 2021, 11, 672562. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wegrzynska, K.; Komiazyk, M.; Walory, J.; Kozinska, A.; Wasko, I.; Baraniak, A. Differentiation of SARS-CoV-2 Variants Using RT-qPCRs by Targeting Recurrent Mutation Sites: A Diagnostic Laboratory Experience from Multi-Center Regional Study, August 2020–December 2021, Poland. Int. J. Mol. Sci. 2022, 23, 9416. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| Primer | 5′-3′ Sequence | Amino Acid Coverage | Mutations of Interest |
|---|---|---|---|
| M6970-FW | TGACAAAGTTTTCAGATCCTCAGT | 47–171 | Del69-70, T95I, G142D, Del143-145, and Del144 |
| M6970-RW | GGTCCATAAGAAAAGGCTGAGA | ||
| VAR1-L FW | TCTCTGCTTTACTAATGTCTATGCAGA | 399–616 | K417T/N, D428E, N440K, G446S, L452R, Q474R, S477N, T478K, E484A/Q/K, Q493R, G496S, Q498R, N501Y, Y505H, T547K, A570D, and D614G |
| VAR1-L RW | AACAGGGACTTCTGTGCAGT | ||
| VAR2 FW | GGTTTAACAGGCACAGGTGT | 552–722 | D614G, H655Y, N679K, P681H/R, and T716I |
| VAR2 RW | GACACTGGTAGAATTTCTGTGGTA |
| Assay | Sanger Sequencing n = 268 * | ||
|---|---|---|---|
| BA.1.617.2 (n = 100) PPA | BA.1 (n = 85) PPA | BA.2 (n = 80) PPA | |
| TaqPath Δ69/70-positive | n.d. | 88.90 | n.d. |
| TaqPath Δ69/70-negative | 100 | n.d. | 100 |
| Novaplex | n.d. | 100 | 100 |
| Allplex | 98.0 | n.d. | n.d. |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Specchiarello, E.; Matusali, G.; Carletti, F.; Gruber, C.E.M.; Fabeni, L.; Minosse, C.; Giombini, E.; Rueca, M.; Maggi, F.; Amendola, A.; et al. Detection of SARS-CoV-2 Variants via Different Diagnostics Assays Based on Single-Nucleotide Polymorphism Analysis. Diagnostics 2023, 13, 1573. https://doi.org/10.3390/diagnostics13091573
Specchiarello E, Matusali G, Carletti F, Gruber CEM, Fabeni L, Minosse C, Giombini E, Rueca M, Maggi F, Amendola A, et al. Detection of SARS-CoV-2 Variants via Different Diagnostics Assays Based on Single-Nucleotide Polymorphism Analysis. Diagnostics. 2023; 13(9):1573. https://doi.org/10.3390/diagnostics13091573
Chicago/Turabian StyleSpecchiarello, Eliana, Giulia Matusali, Fabrizio Carletti, Cesare Ernesto Maria Gruber, Lavinia Fabeni, Claudia Minosse, Emanuela Giombini, Martina Rueca, Fabrizio Maggi, Alessandra Amendola, and et al. 2023. "Detection of SARS-CoV-2 Variants via Different Diagnostics Assays Based on Single-Nucleotide Polymorphism Analysis" Diagnostics 13, no. 9: 1573. https://doi.org/10.3390/diagnostics13091573
APA StyleSpecchiarello, E., Matusali, G., Carletti, F., Gruber, C. E. M., Fabeni, L., Minosse, C., Giombini, E., Rueca, M., Maggi, F., Amendola, A., & Garbuglia, A. R. (2023). Detection of SARS-CoV-2 Variants via Different Diagnostics Assays Based on Single-Nucleotide Polymorphism Analysis. Diagnostics, 13(9), 1573. https://doi.org/10.3390/diagnostics13091573

