Exploration of Exosomal miRNAs from Serum and Synovial Fluid in Arthritis Patients
Abstract
1. Introduction
2. Materials and Methods
2.1. Fabrication of the Exosome Separation Device
2.2. Sources and Storage Conditions of Human Serum and Synovial Fluid
2.3. Exosome Collection from Cell Culture Medium
2.4. Pretreatment of Clinical Samples
2.5. Isolation of Exosomes Using the Exosome Separation Device
2.6. Quantitative Analysis of Exosomes
2.7. Particle Size Analysis
2.8. Transmission Electron Microscopy Image
2.9. Scanning Electron Microscopy Image
2.10. Western Blot Analysis
2.11. RNA Extraction and Quantification
2.12. miRNA Sequencing
2.13. Data Analysis
3. Results and Discussion
3.1. Design of the Exosome Separation Device
3.2. Performance of the Exosome Separation Device
3.3. Characterization of Exosomes Isolated from Serum and Synovial Fluid Using the Exosome Separation Device
3.4. Transcriptome Analysis of Differentially Expressed Exosomal miRNAs in Serum and Synovial Fluid
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Helmick, C.G.; Felson, D.T.; Lawrence, R.C.; Gabriel, S.; Hirsch, R.; Kwoh, C.K.; Liang, M.H.; Kremers, H.M.; Mayes, M.D.; Merkel, P.A.; et al. Estimates of the prevalence of arthritis and other rheumatic conditions in the United States. Part I. Arthritis Rheum. 2008, 58, 15–25. [Google Scholar] [CrossRef] [Scilit]
- Hunter, D.J.; Bierma-Zeinstra, S. Osteoarthritis. Lancet 2019, 393, 1745–1759. [Google Scholar] [CrossRef] [Scilit]
- Livingston, E. Drugs for Osteoarthritis. JAMA-J. Am. Med. Assoc. 2021, 325, 581–582. [Google Scholar]
- Kalluri, R.; LeBleu, V.S. The biology, function, and biomedical applications of exosomes. Science 2020, 367, 6478. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, M.; Ouyang, Y.; Wang, Z.; Zhang, R.; Huang, P.-H.; Chen, C.; Li, H.; Li, P.; Quinn, D.; Dao, M.; et al. Isolation of exosomes from whole blood by integrating acoustics and microfluidics. Proc. Natl. Acad. Sci. USA 2017, 114, 10584–10589. [Google Scholar] [CrossRef] [Scilit]
- Kong, Y.; Tian, X.; He, R.; Li, C.; Xu, H.; Tian, L.; Liu, Z. The accumulation of exosome-associated microRNA-1246 and microRNA-150-3p in human red blood cell suspensions. J. Transl. Med. 2021, 19, 1–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sancho-Albero, M.; Sebastian, V.; Sese, J.; Pazo-Cid, R.; Mendoza, G.; Arruebo, M.; Martin-Duque, P.; Santamaria, J. Isolation of exosomes from whole blood by a new microfluidic device: Proof of concept application in the diagnosis and monitoring of pancreatic cancer. J. Nanobiotechnol. 2020, 18, 1–15. [Google Scholar] [CrossRef] [Scilit]
- Mizutani, K.; Kawakami, K.; Horie, K.; Fujita, Y.; Kameyama, K.; Kato, T.; Nakane, K.; Tsuchiya, T.; Yasuda, M.; Masunaga, K.; et al. Urinary exosome as a potential biomarker for urinary tract infection. Cell. Microbiol. 2019, 21, e13020. [Google Scholar] [CrossRef] [Scilit]
- Yang, Q.; Cheng, L.; Hu, L.; Lou, D.; Zhang, T.; Li, J.; Zhu, Q.; Liu, F. An integrative microfluidic device for isolation and ultrasensitive detection of lung cancer-specific exosomes from patient urine. Biosens. Bioelectron. 2020, 163, 112290. [Google Scholar] [CrossRef] [Scilit]
- Wu, C.-X.; Liu, Z.-F. Proteomic Profiling of Sweat Exosome Suggests Its Involvement in Skin Immunity. J. Investig. Dermatol. 2018, 138, 89–97. [Google Scholar] [CrossRef] [Scilit]
- Han, Y.; Jia, L.; Zheng, Y.; Li, W. Salivary Exosomes: Emerging Roles in Systemic Disease. Int. J. Biol. Sci. 2018, 14, 633–643. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qin, W.; Tsukasaki, Y.; Dasgupta, S.; Mukhopadhyay, N.; Ikebe, M.; Sauter, E.R. Exosomes in Human Breast Milk Promote EMT. Clin. Cancer Res. 2016, 22, 4517–4524. [Google Scholar] [CrossRef] [Scilit]
- Shao, H.; Im, H.; Castro, C.M.; Breakefield, X.; Weissleder, R.; Lee, H. New Technologies for Analysis of Extracellular Vesicles. Chem. Rev. 2018, 118, 1917–1950. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- LeBleu, V.S.; Kalluri, R. Exosomes as a Multicomponent Biomarker Platform in Cancer. Trends Cancer 2020, 6, 767–774. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mori, M.A.; Ludwig, R.G.; Garcia-Martin, R.; Brandao, B.B.; Kahn, C.R. Extracellular miRNAs: From Biomarkers to Mediators of Physiology and Disease. Cell Metab. 2019, 30, 656–673. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, T.; Zhang, Q.; Zhang, J.K.; Li, C.; Miao, Y.R.; Lei, Q.; Li, Q.B.; Guo, A.Y. EVmiRNA: A database of miRNA profiling in extracellular vesicles. Nucleic Acids Res. 2019, 47, D89–D93. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Murata, K.; Furu, M.; Yoshitomi, H.; Ishikawa, M.; Shibuya, H.; Hashimoto, M.; Imura, Y.; Fujii, T.; Ito, H.; Mimori, T.; et al. Comprehensive microRNA Analysis Identifies miR-24 and miR-125a-5p as Plasma Biomarkers for Rheumatoid Arthritis. PLoS ONE 2013, 8, e69118. [Google Scholar] [CrossRef] [Scilit]
- Duroux-Richard, I.; Pers, Y.-M.; Fabre, S.; Ammari, M.; Baeten, D.; Cartron, G.; Touitou, I.; Jorgensen, C.; Apparailly, F. Circulating miRNA-125b Is a Potential Biomarker Predicting Response to Rituximab in Rheumatoid Arthritis. Mediat. Inflamm. 2014, 2014, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Foers, A.D.; Garnham, A.L.; Chatfield, S.; Smyth, G.K.; Cheng, L.; Hill, A.F.; Wicks, I.P.; Pang, K.C. Extracellular Vesicles in Synovial Fluid from Rheumatoid Arthritis Patients Contain miRNAs with Capacity to Modulate Inflammation. Int. J. Mol. Sci. 2021, 22, 4910. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, W.; Xie, Y.; Chang, Y.; Xu, Y.; Zhao, M.; Deng, P.; Qin, J.; Li, H. A Portable Device for Simple Exosome Separation from Biological Samples. Micromachines 2021, 12, 1182. [Google Scholar] [CrossRef] [Scilit]
- Chen, W.; Cao, R.; Su, W.; Zhang, X.; Xu, Y.; Wang, P.; Gan, Z.; Xie, Y.; Li, H.; Qin, J. Simple and fast isolation of circulating exosomes with a chitosan modified shuttle flow microchip for breast cancer diagnosis. Lab A Chip 2021, 21, 1759–1770. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| miRNA | Sequence |
|---|---|
| Novel_4 | CAACGGAAUCCCAAAAGCAGCUG |
| Novel_16 | ACUGCCCCAGGUGCUGCUGGG |
| Novel_81 | UGGGGCGUCGCCAAGUGG |
| Novel_82 | GCAGGCCCGGCGGGGAAGG |
| Novel_94 | GGAGAGGUGGAUGAGUGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xie, Y.; Chen, W.; Zhao, M.; Xu, Y.; Yu, H.; Qin, J.; Li, H. Exploration of Exosomal miRNAs from Serum and Synovial Fluid in Arthritis Patients. Diagnostics 2022, 12, 239. https://doi.org/10.3390/diagnostics12020239
Xie Y, Chen W, Zhao M, Xu Y, Yu H, Qin J, Li H. Exploration of Exosomal miRNAs from Serum and Synovial Fluid in Arthritis Patients. Diagnostics. 2022; 12(2):239. https://doi.org/10.3390/diagnostics12020239
Chicago/Turabian StyleXie, Yingying, Wenwen Chen, Mengqian Zhao, Yuhai Xu, Hao Yu, Jianhua Qin, and Hongjing Li. 2022. "Exploration of Exosomal miRNAs from Serum and Synovial Fluid in Arthritis Patients" Diagnostics 12, no. 2: 239. https://doi.org/10.3390/diagnostics12020239
APA StyleXie, Y., Chen, W., Zhao, M., Xu, Y., Yu, H., Qin, J., & Li, H. (2022). Exploration of Exosomal miRNAs from Serum and Synovial Fluid in Arthritis Patients. Diagnostics, 12(2), 239. https://doi.org/10.3390/diagnostics12020239
