Sensitive Detection of KRAS Mutations by Clustered Regularly Interspaced Short Palindromic Repeats
Abstract
1. Introduction
2. Materials and Methods
3. Results
3.1. CRISPR–Cas12a Can Detect KRAS Mutations
3.2. CRISPR–Cas12a Has a Higher Sensitivity for Detecting KRAS Mutations Compared with PCR Assay
3.3. CRISPR–Cas12a Can Specifically Detect KRAS Mutations
3.4. CRISPR–Cas12a Can Sensitively Detect KRAS Mutations in the Tumor Tissues of Lung Cancer Patients
3.5. The Results of CRISPR–Cas12a for Testing KRAS Mutations Can Be Immediately Read by a UV Light Illuminator with Naked Eyes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Conflicts of Interest
References
- Timar, J.; Kashofer, K. Molecular epidemiology and diagnostics of KRAS mutations in human cancer. Cancer Metastasis Rev. 2020, 39, 1029–1038. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zinsky, R.; Bolukbas, S.; Bartsch, H.; Schirren, J.; Fisseler-Eckhoff, A. Analysis of KRAS Mutations of Exon 2 Codons 12 and 13 by SNaPshot Analysis in Comparison to Common DNA Sequencing. Gastroenterol. Res. Pract. 2010, 2010, 789363. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ghimessy, A.; Radeczky, P.; Laszlo, V.; Hegedus, B.; Renyi-Vamos, F.; Fillinger, J.; Klepetko, W.; Lang, C.; Dome, B.; Megyesfalvi, Z. Current therapy of KRAS-mutant lung cancer. Cancer Metastasis Rev. 2020, 39, 1159–1177. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Anderson, S.M. Laboratory methods for KRAS mutation analysis. Expert Rev. Mol. Diagn. 2011, 11, 635–642. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gootenberg, J.S.; Abudayyeh, O.O.; Kellner, M.J.; Joung, J.; Collins, J.J.; Zhang, F. Multiplexed and portable nucleic acid detection platform with Cas13, Cas12a, and Csm6. Science 2018, 360, 439–444. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.S.; Ma, E.; Harrington, L.B.; Da Costa, M.; Tian, X.; Palefsky, J.M.; Doudna, J.A. CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science 2018, 360, 436–439. [Google Scholar] [CrossRef] [Scilit]
- Abudayyeh, O.O.; Gootenberg, J.S.; Essletzbichler, P.; Han, S.; Joung, J.; Belanto, J.J.; Verdine, V.; Cox, D.B.T.; Kellner, M.J.; Regev, A.; et al. RNA targeting with CRISPR-Cas13. Nature 2017, 550, 280–284. [Google Scholar] [CrossRef] [Scilit]
- Chertow, D.S. Next-generation diagnostics with CRISPR. Science 2018, 360, 381–382. [Google Scholar] [CrossRef] [Scilit]
- Tsou, J.H.; Leng, Q.; Jiang, F. A CRISPR Test for Detection of Circulating Nuclei Acids. Transl. Oncol. 2019, 12, 1566–1573. [Google Scholar] [CrossRef] [Scilit]
- Tsou, J.H.; Leng, Q.; Jiang, F. A CRISPR Test for Rapidly and Sensitively Detecting Circulating EGFR Mutations. Diagnostics 2020, 10, 114. [Google Scholar] [CrossRef] [Scilit]
- Su, Y.; Shetty, A.; Jiang, F. Integrated analysis of miRNAs and DNA methylation identifies miR-132-3p as a tumor suppressor in lung adenocarcinoma. Thorac. Cancer 2020. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Su, Y.; Fang, H.B.; Jiang, F. An epigenetic classifier for early stage lung cancer. Clin. Epigenetics 2018, 10, 68. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Su, Y.; Fang, H.; Jiang, F. Integrating DNA methylation and microRNA biomarkers in sputum for lung cancer detection. Clin. Epigenetics 2016, 8, 109. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, F.; Qiu, Q.; Khanna, A.; Todd, N.W.; Deepak, J.; Xing, L.; Wang, H.; Liu, Z.; Su, Y.; Stass, S.A.; et al. Aldehyde dehydrogenase 1 is a tumor stem cell-associated marker in lung cancer. Mol. Cancer Res. 2009, 7, 330–338. [Google Scholar] [CrossRef] [Scilit]
- Yu, H.A.; Sima, C.S.; Shen, R.; Kass, S.; Gainor, J.; Shaw, A.; Hames, M.; Iams, W.; Aston, J.; Lovely, C.M.; et al. Prognostic impact of KRAS mutation subtypes in 677 patients with metastatic lung adenocarcinomas. J. Thorac. Oncol. 2015, 10, 431–437. [Google Scholar] [CrossRef] [Scilit]
- Kempf, E.; Rousseau, B.; Besse, B.; Paz-Ares, L. KRAS oncogene in lung cancer: Focus on molecularly driven clinical trials. Eur. Respir. Rev. 2016, 25, 71–76. [Google Scholar] [CrossRef] [Scilit]
- Angulo, B.; Lopez-Rios, F.; Gonzalez, D. A new generation of companion diagnostics: Cobas BRAF, KRAS and EGFR mutation detection tests. Expert Rev. Mol. Diagn. 2014, 14, 517–524. [Google Scholar] [CrossRef] [Scilit]
- Assi, M.; Dauguet, N.; Jacquemin, P. DIE-RNA: A Reproducible Strategy for the Digestion of Normal and Injured Pancreas, Isolation of Pancreatic Cells from Genetically Engineered Mouse Models and Extraction of High Quality RNA. Front. Physiol. 2018, 9, 129. [Google Scholar] [CrossRef] [Scilit]
- Loong, H.H.; Raymond, V.M.; Shiotsu, Y.; Chua, D.T.; Teo, P.M.; Yung, T.; Skrzypczak, S.; Lanman, R.B.; Mok, T.S.K. Clinical Application of Genomic Profiling With Circulating Tumor DNA for Management of Advanced Non-Small-cell Lung Cancer in Asia. Clin. Lung Cancer 2018, 19, 601–608. [Google Scholar] [CrossRef] [Scilit]
- Kunnath, A.P.; Priyashini, T. Potential Applications of Circulating Tumor DNA Technology as a Cancer Diagnostic Tool. Cureus 2019, 11, 4907. [Google Scholar] [CrossRef] [Scilit]
- Oxnard, G.R.; Paweletz, C.P.; Kuang, Y.; Mach, S.L.; O’Connell, A.; Messineo, M.M.; Luke, J.J.; Butaney, M.; Kirschmeier, P.; Jackman, D.M.; et al. Noninvasive detection of response and resistance in EGFR-mutant lung cancer using quantitative next-generation genotyping of cell-free plasma DNA. Clin. Cancer Res. 2014, 20, 1698–1705. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sacher, A.G.; Paweletz, C.; Dahlberg, S.E.; Alden, R.S.; O’Connell, A.; Feeney, N.; Mach, S.L.; Jänne, P.A.; Oxnard, G.R. Prospective Validation of Rapid Plasma Genotyping for the Detection of EGFR and KRAS Mutations in Advanced Lung Cancer. JAMA Oncol. 2016, 2, 1014–1022. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yanagita, M.; Redig, A.J.; Paweletz, C.P.; Dahlberg, S.E.; O’Connell, A.; Feeney, N.; Taibi, M.; Boucher, D.; Oxnard, G.R.; Johnson, B.E.; et al. A Prospective Evaluation of Circulating Tumor Cells and Cell-Free DNA in EGFR-Mutant Non-Small Cell Lung Cancer Patients Treated with Erlotinib on a Phase II Trial. Clin. Cancer Res. 2016, 22, 6010–6020. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Canevari, F.R.; Montevecchi, F.; Galla, S.; Sorrentino, R.; Vicini, C.; Sireci, F. Trans-oral robotic surgery for a Ewing’s sarcoma of tongue in a pediatric patient: A case report. Braz. J. Otorhinolaryngol. 2020, 86, 26–29. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| crRNA’s Names | Sequence (5′->3′) |
|---|---|
| LbaCas12a crRNA-34G | AGCUGGUGGCGUAGGCA |
| LbaCas12a crRNA-G12C-34T | AGCUUGUGGCGUAGGCA |
| LbaCas12a crRNA-G12S-34A | AGCUAGUGGCGUAGGCA |
| LbaCas12a crRNA-G12D-35T | AGCUGUUGGCGUAGGCA |
| Hairpin | UAAUUUCUACUAAGUGUAGAU |
| Substrate’s name | Sequence (5′->3′) |
| ssDNA-FQ reporter | /56-FAM/TTATT/3IABKFQ/ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, H.; Tsou, J.-H.; Leng, Q.; Jiang, F. Sensitive Detection of KRAS Mutations by Clustered Regularly Interspaced Short Palindromic Repeats. Diagnostics 2021, 11, 125. https://doi.org/10.3390/diagnostics11010125
Zhou H, Tsou J-H, Leng Q, Jiang F. Sensitive Detection of KRAS Mutations by Clustered Regularly Interspaced Short Palindromic Repeats. Diagnostics. 2021; 11(1):125. https://doi.org/10.3390/diagnostics11010125
Chicago/Turabian StyleZhou, Huifen, Jen-Hui Tsou, Qixin Leng, and Feng Jiang. 2021. "Sensitive Detection of KRAS Mutations by Clustered Regularly Interspaced Short Palindromic Repeats" Diagnostics 11, no. 1: 125. https://doi.org/10.3390/diagnostics11010125
APA StyleZhou, H., Tsou, J.-H., Leng, Q., & Jiang, F. (2021). Sensitive Detection of KRAS Mutations by Clustered Regularly Interspaced Short Palindromic Repeats. Diagnostics, 11(1), 125. https://doi.org/10.3390/diagnostics11010125

