Next Article in Journal
Coexistence of Acute Appendicitis and Mesenteric Cystic Lymphatic Malformation in an Adult: A Case Report and Narrative Review of Intraoperative Management Strategies
Previous Article in Journal
Relationship Between Carotid Intima–Media Thickness, Serum Endocan and Hyaluronic Acid Levels in Multiple Sclerosis
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Life
Volume 15
Issue 9
10.3390/life15091389
life-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Exploring Different Roles of StWRKY4 and StWRKY56 in Transgenic Potato Against Salt Stress

by
Nadia Gul
1,
Sofia Baig
2,
Xiaoliang Shan
3,
Irum Shahzadi
1,
Maria Siddique
4,
Hongwei Zhao
3,*,
Raza Ahmad
1,
Jamshaid Hussain
1,
Samina Khalid
1 and
Ayesha Baig
1,*
1
Department of Biotechnology, COMSATS University Islamabad, Abbottabad Campus, Abbottabad 22044, Pakistan
2
Independent Researcher, Abbottabad 22010, Pakistan
3
Department of Plant Pathology, College of Plant Protection, Nanjing Agricultural University, Nanjing 210095, China
4
Department of Environmental Sciences, COMSATS University Islamabad, Abbottabad Campus, Abbottabad 22044, Pakistan
*
Authors to whom correspondence should be addressed.
Life 2025, 15(9), 1389; https://doi.org/10.3390/life15091389
Submission received: 29 July 2025 / Revised: 22 August 2025 / Accepted: 28 August 2025 / Published: 1 September 2025
(This article belongs to the Special Issue Recent Advances in Plant Genomics and Genetics)
Browse Figures
Versions Notes

Abstract

WRKY transcription factors play an important role in transcriptional reprogramming associated with plant abiotic stress responses. In this study, the role of Solanum tuberosum (S. tuberosum; St) WRKY transcription factors StWRKY4 and StWRKY56 were explored in response to salt stress by generating transgenic potato lines using RNAi. The results showed that the total chlorophyll content in transgenic StWRKY4 was 6.1 mg/g at 200 mM after 35 days; however, in StWRKY56, an elevated 12.6 mg/g total chlorophyll was observed which indicated different operating mechanisms of these StWRKY transcription factors under salt stress. Proline content increased to 1.0 mg/g in StWRKY4 while it decreased to 0.54 mg/g in StWRKY56 as compared to their respective control plants after 35 days at 200 mM of salt stress. For Na+/K+ ratios, StWRKY4 and StWRKY56 showed 32.3 and 5.5 values, respectively, in silenced plants under similar conditions. This shows contrasting trends in StWRKY4 and StWRKY56 for Na+/K+. However, the expression analyses of StSOS1s were found to be upregulated, whereas for StNHX3s these were found to be downregulated in StWRKY4 and StWRKY56 under salt stress. Thus, this study, for the first time, demonstrated the different but critical roles of StWRKY4 and StWRKY56 for fine-regulating salt stress tolerance in complex signaling network of potato plant.

1. Introduction

Potato (S. tuberosum) is a significant agricultural commodity worldwide due to its nutritional content, profitable yield and high industrial value [1]. It is regarded as an immensely important food crop because of its potential to reduce hunger, having three growing seasons per year and constantly being under the influence of climate/environment effect. Biotic and abiotic stressors have a detrimental impact on potato crop yield [2,3]. Potato crops can be severely affected by various abiotic factors including salinity [3]. Salt is a highly toxic element and the greatest hurdle faced internationally today, posing a hazard to over 800 million hectares of agricultural land [4,5]. Nearly 1.4 billion acres of land throughout the globe is impacted by soil salinity [6]. Salinity affects plant metabolism, growth rate, architecture, gene regulation and many other important functions. It is predicted that potato yield may potentially suffer an overall 50% decrease by the year 2050, under the influence of salinization [4,5].
The elevated level of soluble salts in the soil moisture hinders plant growth. Sodium chloride (NaCl) is the primary salt that contributes to salinization and exhibits an adverse impact on plants than Ca+ salts [4]. For proper growth and development, plants need to regulate a balance among (Na+) input and potassium (K+) efflux into plant tissues through ion homeostasis. The canonical salt overly sensitive (SOS) pathway exists within potato plants which is critical in regulating salt stress. SOS1, SOS2 and SOS3 are all interconnected SOS components that eliminate excessive accumulation of Na+ ions in the cell cytosol [3]. Similarly to this, high-affinity potassium transporters (HKTs) that regulate K+/Na+ homeostasis and sodium/hydrogen antiporters (NHXs) that take the cytosol’s accumulating K+ or Na+ ions within a vacuole are vital for salt stress tolerance [7]. Whilst the function of these important genes has been elucidated and extensively characterized, the underlying transcriptional network is not yet completely characterized in potato plants.
Drought and salinity tolerance are extremely low in potato and the development of novel varieties is sluggish because of their complex genetic makeup and narrow germplasm [7]. There is an urgent need for the development of novel potato cultivars that are resistant to stress factors under current environment influence. Consequently, understanding the intricate underlying process of salt tolerance is essential for recognizing and producing salt-tolerant plants which enhance agriculture productivity [8]. To survive under salt stress, plants develop a range of balancing mechanisms such as optimal growth rate, osmotic adjustment and ion homeostasis [8,9]. Perhaps the most important and critical adjustment mechanism adopted by plants under stress conditions is the transcriptional regulation maintained by transcription factors (TFs) [10].
TFs are regulatory proteins that work with a specific gene sequence by triggering or inhibiting the expression or transcription of desired genes [10]. Various TFs families based on conserved DNA-binding domain have been recognized in plants [10,11]. TFs play a key role in a number of regulatory processes in abiotic stress tolerance. Majority include DNA-binding WRKY domain (WRKY) Dehydration-responsive element binding (DREB), based on conserved MYB domain (MYB), Ethylene Response Factor (ERF) and bZIP gene families [10]. One of the largest and significant TFs families is the WRKY family [11]. WRKY TFs regulate numerous downstream stress-related genes that result in biochemical and physiological modifications required for plant adaptation under stress conditions. The WRKY TFs are based on conserved domain of nearly invariant stretch WRKYGQK followed by unique zinc-finger structure of Cystine (C) and Histidine (H) residues [12]. In potato, 79 WRKY TFs have been identified based on WRKYGQK domain and zinc-finger structure [13]. A total of 13 members belong to group I with two WRKYGQK domains and characteristic zinc-finger CX4CX22HXH or CX4CX23HXH. Group II has 52 members with one WRKY domain and CX5CX23HXH zinc-finger structure. The third group has 14 members with one WRKY domain and CX7CX24HXC zinc-finger motif. WRKY proteins play an important role in plant stress response as they may associate with a specific W-box motif (TTGAC/T) in promoter regions [13]. Different studies have demonstrated a vital role played by numerous WRKY family members in abiotic stress tolerance including S. tuberosum StWRKY. StWRKY1 conferred improved tolerance to Phytophthora infestans (P. infestans) and water stress [14]. StWRKY2 showed a strong resistance to P. infestans and improved drought tolerance [15]. Other WRKY TFs such as Fortunella crassifolia FcWRKY40 significantly regulated salt tolerance by using SOS pathway [15]. In Arabidopsis thaliana (A. thaliana) and Chrysanthemum morifolium, CmWRKY17 significantly affected salt stress tolerance via modulating the expression of stress-sensitive genes [16]. Triticum aestivum TaWRKY2, TaWRKY93 and TaWRKY24 raised drought and salinity tolerance by accumulating osmo-protectants and managing oxidative stress [17,18]. In addition to reducing oxidative stress, Tamarix hispida ThWRKY4 enhanced Arabidopsis growth under salt stress and inhibited chlorophyll degradation [19]. Salt stress tolerance in Arabidopsis was decreased by overexpression of Zea mays ZmWRKY17 [20]. Transgenic Populus alba × P. glandulosa PagWRKY75 reduced expression through RNAi indicated that the transgenic poplar lines were more sensitive to salt and osmotic stresses compared to the wild type [21]. Moreover, transgenic Arabidopsis overexpressing Glycine max GmWRKY17 exhibited increased osmotic tolerance and Malus domestica MdWRKY56 positively regulated drought stress tolerance in transgenic Arabidopsis, apple calli and plants [22,23]. These studies indicate that WRKY TFs play a critical role in plant stress responses.
Salt stress applied to chickpea (Cicer arietinum; Cs) showed upregulation of CsWRKY4 and CsWRKY56 against NaCl based on the transcriptome data [24]. Similarly, date palm (Phoenix dactylifera; Pd) genome wise expression analysis showed PdWRKY4 and PdWRKY56 role in salt stress [25]. A recent study by Jiang et al. in 2025 showed StWRKY4 upregulated and StWRKY56 downregulated in response to salt stress based on RNA-seq data [26]. Thus, although different WRKY TFs have been recognized for their roles in abiotic stress tolerance and expression data for potato StWRKYs against salinity showed StWRKY4 and StWRKY56 upregulation, functional characterization of potato StWRKY TFs against salt stress remains unknown. Given this, we examined the role of potato StWRKY4 and StWRKY56 in salt stress tolerance using RNAi. Different parameters including chlorophyll, proline and Na+/K+ ratio were evaluated by developing transgenic potato lines of StWRKY4 and StWRKY56. Our data suggests that StWRKY4 and StWRKY56 are differentially expressed under salt stress and could play opposite roles in salt stress tolerance.

2. Methodology

2.1. Plant Material and Growth Conditions

Potato (cv. Desiree) certified tubers/plants from Hazara Agriculture Research Centre, Abbottabad, Pakistan were used in this study. Plant tissue culture work was performed at Tissue culture lab of COMSATS University, Abbottabad. Potato plants were grown on Murashige and Skoog (MS) media for 30 days that were used as an explant source [27]. Culture conditions were 25 ± 2 °C and 16 h photoperiod (32 mmole/m.s), 45–55% relative humidity which were maintained throughout our experiments. Later, 1-month-old transgenic potato plants were transferred to a hydroponic system under similar conditions to evaluate StWRKY4 and StWRKY56 for salt stress.

2.2. Cloning of a Unique Sequence of StWRKY4 and StWRKY56 into RNAi Vector for Transformation into Agrobacterium Tumefaciens

The data for potato StWRKY4 and StWRKY56 were retrieved from PGSC database http://solanaceae.plantbiology.msu.edu/pgsc_download.shtml (accessed on 22 February 2021) to pick unique sequences for generating transgenic RNAi lines. The distinctiveness of particular segments was verified using GenBank, National Center for Biotechnology Information (NCBI) http://www.ncbi.nlm.nih.gov/Genbank/ (accessed on 22 February 2021). Online service Primer 3 https://primer3.ut.ee (accessed on 27 February 2021) was used to generate primers for the selected sequences. Distinct DNA sequences of 312 and 327 base pairs for StWRKY4 and StWRKY56 respectively, were amplified using 2X Taq DNA polymerase and cloned into Gateway pDONR vector [28]. Positive Escherichia coli DH5α with pDONR StWRKY4 and StWRKY56 were confirmed on 50 mg/L kanamycin Luria–Bertani (LB) agar media and colony PCR. Confirmed PCR products were cloned into pk7GW1WG11 vector (https://vectorvault.vib.be/; accessed on 13 September 2021) and transferred through electroporation into Agrobacterium tumefaciens (A. tumefaciens) GV3101. LB agar plates with kanamycin 50 mg/L, spectinomycin 25 mg/L along with colony PCR were used for the selection of positive clones. The PCR products were confirmed by sequencing using gene-specific primers (Table 1).

2.3. Phylogenetic Tree Construction for StWRKY4 and StWRKY56

Comparative analyses of StWRKY4 and StWRKY56 protein sequences were conducted based on sequence homology using Arabidopsis thaliana (At; thale cress), Solanum pennellii (S. pennellii; Sp; wild tomato), Solanum lycopersicum (S. lycopersicum; Sl; tomato), Lycium barbarum (L. barbarum; Lb; Goji berry) and Capsicum chinense (C. chinense; Cs; Chinese pepper) BLASTp (version BLAST+ 2.17.0) from NCBI [29]. The WRKY accession numbers for all WRKYs used in the phylogenetic analysis were StWRKY4 (XM_006350101.2), StWRKY56 (XM_006343863.2), CcWRKY56 (PHU28072.1), SlWRKY56 (XP_004245563.1), SlWRKY4 X1 (XP_004235494.1), SlWRKY4 X2 (XP_069151062.1), SpWRKY45 (XP_015085317.1), SpWRKY4_X1 (XP_015070047.1), LbWRKY4 X2 (XP_060187049.1), LbWRKY (XP_060211036.1), LbWRKY4 X1 (XP_060187048.1), SpWRKY4 X2 (XP_015070048.1), AtWRKY11 (AEE85928.1). Integrated tool PhyloSuite (version 1.2.3) was used to build the phylogenetic tree, which incorporates tools such as IQ-TREE2, MAFFT and Gblocks [30]. The sequences were aligned and trimmed using MAFFT (version 7.526) [31]. Maximum likelihood analyses were performed with IQ-TREE v2.2.0, using models selected by Partition Finder [32,33]. The Shimodaira–Hasegawa-like approximate likelihood-ratio test (SH-aLRT) was used for fast branch tests to support the ML tree [34]. The best-fit model, JTT+G4, was used for phylogenetic inference, and the resulting tree was visualized with FigTree http://tree.bio.ed.ac.uk/software/figtree (accessed on 14 March 2025).

2.4. Development of StWRKY4 and StWRKY56 Transgenic Lines

A single A. tumefaciens colony with StWRKY4 or StWRKY56 was cultured in a 2 mL LB broth medium with selected antibiotics. The bacterial culture was placed in shaking incubator at 250 rpm under 28 °C for 48 h. Then, 600 to 800 μL culture was transferred to 50 mL of LB broth and incubated for 24 h at 225 rpm shaking. After centrifugation, the pellet was reconstituted in MS liquid medium with 74 mM acetosyringone and bacterial density was adjusted at OD 600–800. A. tumefaciens mediated transformation of transgenic potato plants containing StWRKY4 and StWRKY56 was performed [35]. Potato explants grown on MS medium were shifted to an MS inoculation medium. Leaves were infected with A. tumefaciens infection medium with continuous shaking at 50 rpm for 20 min. Potato explants were cultured on a co-cultivation medium for two days before being placed on MS regeneration and selection media supplemented with cefotaxime (250 mg/L) and 50 mg/L of kanamycin, along with growth hormones BAP and IAA (1:1.5 mg/L). Potato explants were grown in the growth chamber until the appearance of roots and shoots [32]. These potato plants were grown till tuber formation in 1:1 sterilized sand and soil mix autoclaved at 121 °C at 15 psi, and confirmed transgenic plants (Supplementary Figures S1 and S2) were transferred to hydroponics for further experiments (Supplementary Figure S3).

2.5. Salt Stress Analysis

For salt stress analysis, transgenic and non-transgenic potato plants were constantly aerated in pots containing 1/3rd of Hoagland’s solution. Plants were adapted to full strength solution with 25% increments [36]. Potato plants were exposed to sodium chloride (NaCl) stress at 0, 100 and 200 mM for 35 days. Leaves from untreated and treated plants were taken after 0 h, 21 and 35 days for biochemical analyses. Each parameter was tested with at least 3–4 biological replicates. Non-transgenic control plants (StWT); non-transgenic control salt stressed plants at 100 and 200 mM NaCl (StWT at 100 mM and StWT at 200 mM); transgenic silenced control plants StWRKY4 and StWRKY56; transgenic silenced salt stressed plants at 100 and 200 mM NaCl (StWRKY56 at 100 and 200 mM; StWRKY56 at 100 and 200 mM); these six different treatments for each StWRKY4 and StWRKY56 were evaluated for number of leaves, number of roots, shoot length (cm) and root length (cm) using ruler scale measurements after 21 and 35 days of salt stress with detailed experimental design (Supplementary Figure S4).

2.6. Pigment Analysis for StWRKY4 and StWRKY56

Pigment analysis protocol was followed with some modifications for quantification of carotenoid, chlorophyll-a, chlorophyll-b and total chlorophyll content [37]. A total of 0.1 g of fresh leaves from non-silenced and silenced treated plants with salt treatments was crushed with pestle mortar. The sample solution was suspended in 10 mL of 80% acetone and was left overnight in the dark. Later, the mixture was centrifuged at 4 °C for 10 min at 5000 rpm. The supernatant from each sample was collected and absorbance was determined using spectrophotometer for chlorophyll-a, chlorophyll-b and carotenoids at 645 nm, 663 nm and at 470 nm, respectively, using T80+ UV/Vis (PG Instruments Ltd., Lutterworth, UK) spectrophotometer [37].

2.7. Proline Content

The proline content was evaluated using the Bates et al. method with some modifications [38,39]. A total of 0.2 g of fresh leaves from potato plants were mashed in a 1 mL of sulfosalicylic acid (3% w/v) to make a final homogenate powder and centrifuge at 6000 rpm for 5 min. The supernatant was mixed with 1 mL of glacial acetic acid (GAA) and 1 mL of ninhydrin reagent and placed in a water bath for an hour at 92 °C. The reaction was terminated by 5 min ice treatment and later mixed with 2 mL toluene. Tubes were vortexed for 5 min and supernatant was taken for UV absorbance measurement at 520 nm by using toluene blank with UV-Vis spectrophotometer. L-proline was used as standard control, and the proline concentrations were calculated via standard curve and estimated using formula provided by [35].

2.8. Sodium and Potassium Ratio Determination

For determination of K+ and Na+ concentrations, 100 mg of fresh non-silenced plants and transgenic silenced StWRKY4 and StWRKY56 were heated in a furnace at 520 °C for 5 h to turn them into ash. A mixture of nitric acid and perchloric acid in 5:1 was added. The solutions were filtered through 0.2 mm Whatman filter paper and the volume was raised to 15 mL using distilled water. The amounts of Na+ and K+ were measured in filtered suspensions using Atomic absorption spectrometry (PerkinElmer AAnalyst 700; Waltham, MA, USA). Various concentrations of K+ and Na+ were generated by using NaCl and KCl dilutions. The standard curve was used to determine Na+ and K+ contents in plant leaves in mg/g of dry weight [40].

2.9. RNA Extraction Quantification and Complementary DNA (cDNA) Synthesis

About five-week-old potato silenced and non-silenced plants grown in half-strength Hoagland nutrient solution was treated with 0, 100 and 200 mM NaCl for 0 h, 21 and 35 days. Leaves samples were immediately frozen in liquid nitrogen and stored at −80 °C. CTAB protocol was used for the purpose of extracting RNA as reported with minor modifications [41]. Briefly, leaves were treated with CTAB and later with chloroform–isoamyl alcohol (24:1). The supernatant was treated with 10 M lithium chloride and RNA pellet was obtained in 70% ethanol. The pellet was suspended in 50 µL ddH2O. The quantity of cDNA was checked at wavelengths of 260 and 280 nm while ddH2O was utilized as a blank control by using Nano Drop spectrophotometer (Colibri Microvolume Spectrometer; Berthold Technologies GmbH & Co. KG, Bad Wildbad, Germany). WizScript High Capacity (cDNA synthesis kit; Wizbiosolutions Inc., Seongnam-si, Republic of Korea) was used to synthesize cDNA. The reaction mixture was formed using 10X reaction buffers 2 μL, 20X dNTPs mixture 1 μL, Random hexamer 2 μL, WizScript RTase 1 μL, RNase Inhibitor 0.5 μL and RNase free water 4 μL and 10 μL RNA. The reaction was left to incubate at 25 °C for about 10 min, 37 °C to 120 min and terminated at 85 °C for 5 min [41].

2.10. Quantitative Real-Time qPCR

The step-one software (Applied Biosystem; Foster city CA, USA) version 2.3 was used to carry out real-time PCR. The ROX qPCR Mastermix SYBR Green 2X (WizPure; Bioquest, Inc., Pleasanton, CA, USA) was used in 48-well plate. StActin was used as internal control for comparative data analysis. The reaction of control and silenced plants were carried out in duplicate. Then, 200 ng of cDNA as a template was added to qRT-PCR reaction mixture. The sequence of StActin, gene-specific primers and salt stress primers used in this study are mentioned in Table 1 [42,43]. Amplification was carried out using WizPure SYBR Green. The reaction mixture of 20 µL with 2 µL cDNA, 1 µL primer pair, 10 µL RT-qPCR Master Mix and 6 µL autoclaved deionized double-distilled H2O was prepared. The reaction had an initial denaturation step of 5 min at 95 °C, 40 cycles and had three steps: denaturation for 45 s at 95 °C, annealing for 45 s at 62 °C and extension for 1 min at 72 °C. The Ct values of different plants were analyzed statistically using step-one software 9 Applied Biosystems (version 2.3; Waltham, MA, USA). In each reaction run, the gene of interest and reference gene were tested. Relative fold expression was calculated by ΔΔCt method [44].

2.11. Statistical Analysis

The results from the research work were provided as means ± standard deviation for a minimum of three separate samples. R-program was used to examine quantitative data using two-way analysis of variance ANOVA at p ≤ 0.05 and the Duncan multiple range test (DMRT) [45].

3. Results

3.1. Development of Transgenic Potato StWRKY4 and StWRKY56

Transgenic StWRKY4 and StWRKY56 potato lines (Supplementary Figure S2) were used for salt stress analysis. RNAi-mediated gene silencing was used for generating transgenic StWRKY4 and StWRKY56 plants that were confirmed for downregulation through expression analysis as compared to control wild-type potato plants (Figure 1).

3.2. Phylogenetic Tree for StWRKY4 and StWRKY56

A phylogenetic tree was constructed based on protein sequence homology of StWRKY4 (XM_006350101) and StWRKY56 (XM_006343863) along with 11 derived sequences similar to the two WRKY TFs. These homology sequences used were from A. thaliana, S. pennellii, S. lycopersicum, L. barbarum and C. chinense. A. thaliana, AtWRKY11 was used as an outgroup in the phylogenetic tree (Figure 2). StWRKY4 was found closely associated with L. barbarum LbWRKY4 and S. pennellii SpWRKY4 while StWRKY56 was found related to S. pennellii SpWRKY56 and S. lycopersicum SlWRKY56.

3.3. Number of Leaves, Number of Roots, Shoot Length and Root Length

StWRKY4 transgenic potato plants were evaluated for number of leaves, number of roots, shoot length and root length against salt stress (Figure 3 and Supplementary Table S1). StWRKY4 non-silenced plants/silenced plants showed number of leaves in ratios; 5.3:4.3 at 100 and 5.0:3.5 at 200 mM after 35 days, respectively (Figure 3a). For StWRKY4, in non-silenced/silenced plants the number of roots were 3.8:8.8 and 5.0:2.3 at 100 and 200 mM after 35 days (Figure 3b). Shoot length was 4.9:5.5 and 3.9:4.0 cm at 100 and 200 mM salt stress after 35 days (Figure 3c). Root length was 6.1:5.5 and 6.4:4.7 cm vs. 3.0:1.9 and 2.0:1.0 after 21 and 35 days at 100:200 mM salt stress for non- silenced wild-type/silenced StWRKY4 plants (Figure 3d).
For StWRKY56, the number of leaves for non-silenced wild-type/silenced StWRKY56 plants were 8.8:7.5 and 7.3:6.0 at 100 and 200 mM after 35 days (Figure 4a). The number of roots with non-silenced/silenced plants were 8.0:4.5 and 7.6:6.3 at 100 and 200 mM after 35 days (Figure 4b). For StWRKY56, it was noted that for non-silenced and silenced plants at 100:200 mM salt stress, shoot length was 8.3:6.9 and 7.6:5.3 cm after 35 days while root length was observed to be 3.3:2.7 and 2.7:2.3 cm with 100 and 200 mM salt stress at 35 days (Figure 4c,d). This indicated that silenced StWRKY56 has reduced shoot length while StWRKY4 has reduced root length as compared to non-silenced plants under salt stress.

3.4. Chlorophyll and Carotenoid Content

Transgenic StWRKY4 and StWRKY56 potato plants were observed for chlorophyll and carotenoid content under salt stress (Figure 5 and Figure 6 and Supplementary Table S1). StWRKY4 non-silenced plants/silenced plants showed 3.9:6.0 mg/g at 100 and 4.9:4.3 mg/g at 200 mM after 35 days and decreased chlorophyll-a content in silenced plants after 35 days with 200 mM salt stress (Figure 5a). Chlorophyll-b content was 4.8:3.2 mg/g and 2.0:1.7 mg/g in non-silenced/silenced StWRKY4 plants at 100 and 200 mM while carotenoid content was 1.3:0.89 mg/g at 200 mM salt stress after 35 days (Figure 5b,c). Total chlorophyll content decreased for StWRKY4 by 8.7:6.9 mg/g; 9.2:6.1 mg/g after 35 days at 100 and 200 mM salt stress for non- silenced/silenced plants (Figure 5d).
For StWRKY56, chlorophyll-a was 4.7:6.9 mg/g and 6.0:8.5 mg/g for non-silenced/silenced plants at 100 and 200 mM after 35 days (Figure 6a). For StWRKY56, chlorophyll-b was 3.2 and 4.0 mg/g for non-silenced/silenced plants at 200 mM; however, a lower trend was observed for carotenoids with 0.96:0.82 mg/g for non-silenced/silenced plants at 200 mM after 35 days (Figure 6b,c). For total chlorophyll in StWRKY56, non-silenced/silenced plants have 8.7:11.2 mg/g; 10.2:12.6 mg/g values at 100 and 200 mM salt stress after 35 days (Figure 6d). The data showed a somewhat decreased trend in carotenoid contents for both StWRKY4 and StWRKY56; however, interestingly, silenced StWRKY56 had increased chlorophyll content as compared to non-silenced plants under salt stress.

3.5. Proline Content and Na+/K+ Ratio

Proline content is correlated with salt stress tolerance. It serves to reduce plant water potential thereby enhancing water uptake from the soil. It also helps decrease plant transpiration rate. Proline and Na+/K+ ratios were determined for StWRKY4 and StWRKY56 under salt stress (Figure 7 and Figure 8; Supplementary Table S1). It was observed that proline content was 0.6:0.8 mg/g in non-silenced/silenced plants at 100 mM and 0.8:1.1 mg/g in non-silenced/silenced plants at 200 mM after 35 days for StWRKY4 (Figure 7a). Non-silenced/silenced plants had 4.6:5.9 and 5.5:7.2 mg/g (100 and 200 mM) and 6.5:8.8 and 7.5:10.1 mg/g (100 and 200 mM) of Na+ content at 21 and 35 days, respectively (Figure 7b). This shows that StWRKY4 significantly accumulated Na+ ions as compared to non-silenced plants. In non-silenced/silenced plants, 1.8:1.6 and 1.1:0.3 mg/g (100 and 200 mM) of K+ ions content was observed after 35 days (Figure 7c). The Na+/K+ ratio was 1.4:1.9 and 2.7:3.5 (100 and 200 mM) and 3.7:5.7 and 6.8:32.3 (100 and 200 mM) in non-silenced/silenced plants after 21 and 35 days of salt stress. This shows increased Na+/K+ ratio for StWRKY4 under salt stress (Figure 7d).
In case of StWRKY56, proline content in non-silenced/silenced plants was 0.3:0.5 and 0.7:0.5 mg/g (100 and 200 mM) salt stress after 35 days. This shows a decreased proline content at 200 mM at 35 days of salt stress for StWRKY56 (Figure 8a). Na+ content was 3.2:2.5 and 3.9:2.9 mg/g (100 and 200 mM) while K+ content was 0.8:0.3 and 0.9:0.5 mg/g (100 and 200 mM) after 35 days of salt stress in non-silenced wild-type/silenced StWRKY56 (Figure 8b,c). The Na+/K+ ratio in StWRKY56 was 1.8:2.1 and 2.2:1.7 (100 and 200 mM) in non-silenced/silenced plants after 21 days whereas it was 4.2:8.5 and 4.2:5.6 (100 and 200 mM) in non-silenced/silenced plants after 35 days of salt stress. This shows that after 35 days, Na+/K+ ratio was significantly different than wild-type but less significant than StWRKY56 after 35 days of salt stress (Figure 8d).

3.6. Quantitative Analysis of StSOS1 and StNHX3

Real-time qRT-PCR was performed for the expression analyses of StSOS1 and StNHX1 in silenced StWRKY4 potato plants under 100 and 200 mM salt stress after 0 h, 21 and 35 days (Figure 9 and Supplementary Table S1). The expression level of StSOS1 was calculated as fold increase 2−ΔΔCt with 12.3:15.3; 10.8:12.5 (100:200 mM) after 35 days for StWRKY4 in non-silenced vs. silenced plants. StNHX1 in StWRKY4 after 35 days was 9.7:7.5; 12.0:6.9 (100:200 mM) in non-silenced vs. transgenic silenced potato plants. This shows that the expression of StSOS1was upregulated in silenced StWRKY4 whereas the expression of StNHX1was downregulated in silenced plants after 100 and 200 mM salt stress as compared to silenced control potato plants after 35 days.
It was observed that StSOS1 in StWRKY56 showed fold change of 13:15; 11.5:16.5 (100:200 mM) after 31 days salt stress, whereas StNHX1 in StWRKY56 showed a fold change of 3.9:2.9; 3.1:2.2 (100:200 mM) after 21 days and 6.2:5.5; 8.1:4.9 (100:200 mM) after 35 days in non-silenced and silenced transgenic plants under salt stress (Figure 10). This shows that the expression of StSOS1 was significantly upregulated in silenced salt stressed plants, however the expression of StNHX1 was downregulated (Figure 9 and Figure 10).

4. Discussion

WRKY TFs family has been extensively investigated due to its numerous roles in plant development and various stress responses [46,47]. WRKY TFs regulate multiple biological functions and modify gene expressions by a combination of positive and negative regulation [48,49]. In the current study, StWRKY4 and StWRKY56 were evaluated for their salt stress responses in potato plant. Unique exon sequences of StWRKY4 and StWRKY56 from the potato WRKY family were used to create transgenic RNAi potato plants of Desiree variety (Figure 1). A phylogenetic tree based on StWRKY4 and StWRKY56 depicted the clustering of these WRKYs into two evolutionary claudes 1 and 2 [49]. StWRKY56 was closely grouped with tomato variants S. pennellii (SpWRKY45), S. lycopersicum (SlWRKY56) and distinctly with L. barbarum (LbWRKY56), C. chinense CcWRKY56. StWRKY4 was relatively closely grouped with LbWRKY4, SpWRKY4 and distinctly with SlWRKY4 (Figure 2).
In this study, silencing StWRKY4 and StWRKY56 had a differential effect on potato plants growth under salt stress. Based on morphological parameters, silenced StWRKY4 had reduced number of roots and root length as compared to control plants than silenced StWRKY56 under salt stress (Figure 3 and Figure 4). Overexpressed Gossypium hirsutum GhWRKY34 in Arabidopsis had higher number of green cotyledons and root length in transgenic lines [50]. Similarly to this, Huang et al. in 2022 showed OsWRKY54 CRISPR-Cas9 generated lines had reduced dry weight of root and shoot than wild-type plants under salt stress [51].
Our results showed that StWRKY4 and StWRKY56 silenced potato plants exhibited contrasting trends in chlorophyll content due to salt stress as compared to non-silenced plants (Figure 5 and Figure 6). StWRKY4 results are comparable to the findings reported by Hichri et al. in 2017, which indicated an increased chlorophyll content in SlWRKY3 overexpressed tomato plants in coping with salt stress [52]. Dendranthema grandiflora DgWRKY5 overexpressed transgenic lines were also found to possess a higher rate of photosynthesis than WT [53]. Different chlorophyll contents in StWRKY4 and StWRKY56 under salt stress are similarly reported in Abelmoschus esculentus AeWRKY32 and AeWRKY70 overexpressed plants [54].
Carotenoids work like antioxidants, scavenging reactive oxygen species (ROS) within plants as well as safeguarding chlorophyll content. Salt stress triggers carotenoids reduction as well as cellular membrane disruption along with macromolecules failure [55,56]. In this study, carotenoids exhibited a significantly lower trend in silenced StWRKY4 and StWRKY56. StWRKY4 results are consistent with a report on silenced stressed SlWRKY36 and SlWRKY51 tomato plants that had considerably lower chlorophyll-a, carotenoid and total chlorophyll content than silenced plants [25].
An adaptive measure to salt stress is the proline response within the plant species, assisting not only in osmotic adjustment but also in ROS detoxification [57]. Proline helps in maintaining turgor pressure, mitigating salt stress while carrying out fundamental life-sustaining activities such as photosynthesis [58]. Our outcomes demonstrated that proline increased in silenced StWRKY4 whereas it decreased in silenced StWRKY56 at 100 mM and 200 mM NaCl stress after 21 and 35 days compared to non-silenced plants under similar conditions (Figure 7 and Figure 8). He et al. in 2024 showed in Okra plants similar outcomes with higher proline content in AeWRKY70 and lower in AeWRKY32 overexpressed plants [54]. Soybean GmWRKY12 overexpressed in tomato plants and SlWRKY81 silenced in tomato plants showed tolerance to salt and drought, respectively, with an increased proline content [59,60].
Intercellular Na+ ions management and regulation are vital plant strategies for sustaining ionic balance and growth performance under salt stress. It was indicated that Na+ content increased in StWRKY4 and decreased in StWRKY56 at 100 and 200 mM after 35 days as compared to non-silenced, wild-type plants under similar conditions. Our results also demonstrated increased Na+/K+ ratios in StWRKY4 and StWRKY56 at 200 mM after 35 days of salt stress as compared to their non-silenced control plants; however, Na+/K+ ratio in StWRKY4 was significantly high (Figure 6 and Figure 7). StWRKY4 trend is similar to higher sodium [Na+] and lower potassium [K+] in transgenic knockout/overexpressed SlWRKY80 [60]. Thus, in contrast, total chlorophyll, proline and Na+ contents in silenced StWRKY4 and StWRKY56 show somewhat different mechanisms operating for these two WRKYs to alleviate salt stress.
In this study, StSOS1 exhibited increased expression levels at 100 and 200 mM salt stress in StWRKY56 and StWRKY4 after 21 and 35 days as compared to their respective control non-silenced plants (Figure 8 and Figure 9). This indicated that the SOS system is the canonical essential regulatory node for ion homeostasis operating in potato plant. Liang et al. in 2023 showed SOS1 used in this study increased expression under salt stress [42]. Conversely to StSOS1s, StNHX3s expression decreased in StWRKY56 and StWRKY4 under similar conditions (Figure 9 and Figure 10) [43]. Lower HKT1and NHX4 means less Na+ in shoot and less sequestering in vacuole, respectively. Thus, in our study, StSOS1s and StNHX3s operated differentially under salt stress conditions.
In another study, Medicago sativa MsWRKY33 TF rapidly accumulated under 200 mM salt stress after 2 weeks. The fresh biomass, dry weight and chlorophyll content of overexpressed MsWRKY33 transgenic plants were significantly higher than those of control plants. MsWRKY33 interacted with MsCaMBP25 showing that it is involved in Ca2+ signal transduction. Additionally, MsWRKY33 was also shown to directly bind to the promoter of MsERF5 and activating ROS scavenging pathway for high salt tolerance [61]. Similarly, it was found that WRKY45 in Arabidopsis played a vital role in salinity and osmotic stress by binding to W-box cis elements of responsive-to-desiccation RD29A promoter and activating ROS and stress-related genes expression [62]. Chen et al. in 2010 showed Arabidopsis AtWRKY18 and AtWRKY60 as positive regulators while AtWRKY40 as negative regulator of ABA-induced abiotic stress [63]. It was found that AtWRKY60 promoter W-boxes were recognized by AtWRKY18 and AtWRKY40 and both AtWRKY18 and AtWRKY40 activated AtWRKY60 [63]. With ABA stress, AtWRKY18 and AtWRKY40 either as homodimers or heterodimers could bind to the W-boxes in AtWRKY60 promoter, indicating an intricate relationship between negative and positive WRKY regulators in abiotic stress tolerance. Li et al. in 2025 recently indicated direct binding of rice OsWRKY72 to Shoot K+ concentration 1 (SKC1), a HKT1 promoter containing W-box regulating Na+/K+ ion homeostasis under salt stress [64]. Similarly, Pyrus betulaefolia PbWRKY40 was found to bind the W-box element in the promoter region of the Vacuolar-type-H+-ATPase (VHA-B) and positively regulated salt stress tolerance [65]. Huang et al. in 2022 and Yu et al. in 2023 showed OsWRKY54 and OsWRKY53 directly binding to the promoter of HKT1 in rice, respectively [51,66]. Based on this, it seems that WRKYs are involved in salt stress tolerance by directly binding to genes involved in ion homeostasis and ROS signaling/balancing. It therefore seems plausible that StWRKY3 and StWRKY45 may bind directly to salt stress-responsive genes and work as homo- or heterodimers with other interacting StWRKYs for salt stress tolerance.

5. Conclusions

Our findings demonstrated significant roles of StWRKY4 and StWRKY56 in potato salt stress tolerance. StWRKY4 and StWRKY56 silenced transgenic lines showed similar trend in number of leaves, carotenoids, K+ and Na+/K+ ratios under salt stress. Shoot length, number of roots, root length, total chlorophyll, chlorophyll-a, Na+ and proline contents showed opposite roles in StWRKY4 and StWRKY56 at 200 mM NaCl after 35 days. Based on our results, it appears that StWRKY4 and StWRKY56 play opposite roles in salt stress tolerance in potato plants.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/life15091389/s1, Figure S1: PCR confirmation of (a) StWRKY56 and (b) StWRKY4 and Agrobacterium tumefaciens colonies (c) StWRKY4 and (d) StWRKY56; Figure S2: (a,b) StWRKY4 on MS selection media containing Cefotaxime, Kanamycin and BAP: IAA; (c) Lane 1 represents 100 bp DNA ladder; Lane 2 represents no band amplification with Kanamycin NPTII primers from wild type; Lane 3 represents PCR in transgenic StWRKY4 with Kanamycin NPTII primers; (d,e) StWRKY56 on MS selection media containing cefotaxime, Kanamycin and BAP: IAA; (f) Lane 1 represents no band amplification with Kanamycin NPTII primers from wild type; Lane 2 represents PCR in StWRKY56 with Kanamycin NPTII primers; Lane 3 represents 100 bp DNA ladder; Figure S3: Wild type (StWT), transgenic plants StWRKY4 and StWRKY56 grown on MS media were transferred to constantly aerated pots with Hoagland solution in hydroponics. (a) StWT control plants, StWRKY4 and StWRKY56 transgenic lines in MS media; (b) StWT wild type plants at 0, 100 and 200 mM salt stress for 0 hour, 21 and 35 days; (c) StWRKY4 under 0, 100 and 200 mM salt stress salt stress treatments for 0 hour, 21 and 35 days; (d) StWRKY56 transgenic RNAi lines with 0, 100 and 200 mM salt stress treatment for 0 hour, 21 and 35 days. This assay was repeated and data was recorded based on treatment ± SD with p < 0.05 Duncan multiple range test; Figure S4: Wild type, transgenic StWRKY4 and transgenic StWRKY56 were grown for 1 month in the growth chamber in pots containing sterilized sand and soil mix in 1:1 ratio at 25 °C for 16 h photoperiod for 4 weeks and later shifted to hydroponic setup. After 35 days, ~27 wild type and ~27 transgenic plants each for StWRKY4 and StWRKY56 were treated with 0, 100, and 200 mm NaCl for further analysis at 0 hour, 21 and 35 days. All experiments were performed in biological triplicates; Table S1: Effect of salt stress on the growth, chlorophyll content, Proline, Na+/K+ ratio, SOS1 and NHX3 expressions of StWRKY4 and StWRKY56. Different letters indicate a significant difference at p < 0.05 among six different treatments at three different time points according to the Duncans Multiple range test. Values are means ± SD.

Author Contributions

Conceptualization, A.B.; Methodology, I.S. and A.B.; Software, S.B. and X.S.; Validation, H.Z. and R.A.; Formal analysis, M.S., H.Z. and J.H.; Investigation, N.G.; Resources, R.A.; Data curation, S.B., M.S. and J.H.; Writing—original draft, N.G.; Writing—review and editing, I.S. and S.K. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Acknowledgments

The authors are thankful to Hazara Agriculture Research Station for providing potato plants for this study and National Agriculture Research Centre for providing bacterial strain.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Çalışkan, M.E.; Yousaf, M.F.; Yavuz, C.; Zia, M.A.B.; Çalışkan, S. History, production, current trends, and future prospects. In Potato Production Worldwide; Academic Press: Cambridge, MA, USA, 2023; pp. 1–18. [Google Scholar]
  2. Devaux, A.; Goffart, J.P.; Kromann, P.; Andrade-Piedra, J.; Polar, V.; Hareau, G. The potato of the future, opportunities and challenges in sustainable agri-food systems. Potato Res. 2021, 64, 681–720. [Google Scholar] [CrossRef]
  3. Mir, B.A.; John, A.; Rahayu, F.; Martasari, C.; Husni, A.; Sukmadjaja, D.; Wani, A.K. Potato stress resilience: Unraveling the role of signalling molecules and phytohormones. Plant Gene 2024, 38, 100456. [Google Scholar] [CrossRef]
  4. Van Zelm, E.; Zhang, Y.; Testerink, C. Salt tolerance mechanisms of plants. Annu. Rev. Plant Biol. 2020, 71, 403–433. [Google Scholar] [CrossRef] [PubMed]
  5. Liu, L.; Wang, B. Protection of halophytes and their uses for cultivation of saline-alkali soil in China. Biology 2021, 10, 353. [Google Scholar] [CrossRef] [PubMed]
  6. Food and Agricultural Organization of the United Nations. FAOSTAT. 2024. Available online: https://www.fao.org/faostat/en/#home (accessed on 11 March 2025).
  7. Yokoi, S.; Quintero, F.J.; Cubero, B.; Ruiz, M.T.; Bressan, R.A.; Hasegawa, P.M.; Pardo, J.M. Differential expression and function of Arabidopsis thaliana NHX Na+/H+ antiporters in the salt stress response. Plant J. 2002, 30, 529–539. [Google Scholar] [CrossRef] [PubMed]
  8. Kikuchi, A.; Huynh, H.D.; Endo, T.; Watanabe, K. Review of recent transgenic studies on abiotic stress tolerance and future molecular breeding in potato. Breed. Sci. 2015, 65, 85–102. [Google Scholar] [CrossRef]
  9. Qu, L.; Huang, X.; Su, X.; Zhu, G.; Zheng, L.; Lin, J.; Xue, H. Potato: From functional genomics to genetic improvement. Mol. Hortic. 2024, 4, 34. [Google Scholar] [CrossRef]
  10. Dzinyela, R.; Alhassan, A.R.; Suglo, P.; Movahedi, A. Advanced study of functional proteins involved in salt stress regulatory pathways in plants. S. Afr. J. Bot. 2023, 159, 425–438. [Google Scholar] [CrossRef]
  11. Chi, Y.; Yang, Y.; Zhou, Y.; Zhou, J.; Fan, B.; Yu, J.Q.; Chen, Z. Protein–protein interactions in the regulation of WRKY transcription factors. Mol. Plant 2013, 6, 287–300. [Google Scholar] [CrossRef]
  12. Villano, C.; Esposito, S.; D’Amelia, V.; Garramone, R.; Alioto, D.; Zoina, A.; Carputo, D. WRKY genes family study reveals tissue-specific and stress-responsive TFs in wild potato species. Sci. Rep. 2020, 10, 7196. [Google Scholar] [CrossRef]
  13. Shahzad, R.; Harlina, P.W.; Cong-hua, X.; Ewas, M.; Nishawy, E.; Zhenyuan, P.; Foly, M.M. Overexpression of potato transcription factor (StWRKY1) conferred resistance to Phytophthora infestans and improved tolerance to water stress. Plant Omics 2016, 9, 149–158. [Google Scholar] [CrossRef]
  14. Shahzad, R.; Ewas, M.; Harlina, P.W.; Nishawy, E.; Ayaad, M.; Manan, A.; Khames, E. Multiple stress responsive WRKY transcription factor, StWRKY2, enhances drought and late blight resistance in transgenic potato. Int. J. Agric. Biol. 2020, 24, 154–164. [Google Scholar]
  15. Dai, W.; Wang, M.; Gong, X.; Liu, J.H. The transcription factor FcWRKY 40 of Fortunella crassifolia functions positively in salt tolerance through modulation of ion homeostasis and proline biosynthesis by directly regulating SOS2 and P5CS1 homologs. New Phytol. 2018, 219, 972–989. [Google Scholar] [CrossRef] [PubMed]
  16. Li, P.; Song, A.; Gao, C.; Wang, L.; Wang, Y.; Sun, J.; Chen, S. Chrysanthemum WRKY gene CmWRKY17 negatively regulates salt stress tolerance in transgenic chrysanthemum and Arabidopsis plants. Plant Cell Rep. 2015, 34, 1365–1378. [Google Scholar] [CrossRef]
  17. Gao, H.; Wang, Y.; Xu, P.; Zhang, Z. Overexpression of a WRKY transcription factor TaWRKY2 enhances drought stress tolerance in transgenic wheat. Front. Plant Sci. 2018, 9, 997. [Google Scholar] [CrossRef]
  18. Qin, Y.; Tian, Y.; Liu, X. A wheat salinity-induced WRKY transcription factor TaWRKY93 confers multiple abiotic stress tolerance in Arabidopsis thaliana. Biochem. Biophys. Res. Commun. 2015, 464, 428–433. [Google Scholar] [CrossRef]
  19. Yu, Y.; He, L.; Wu, Y. Wheat WRKY transcription factor TaWRKY24 confers drought and salt tolerance in transgenic plants. Plant Physiol. Biochem. 2023, 205, 108137. [Google Scholar] [CrossRef]
  20. Zheng, L.; Liu, G.; Meng, X.; Liu, Y.; Ji, X.; Li, Y.; Wang, Y. A WRKY gene from Tamarix hispida, ThWRKY4, mediates abiotic stress responses by modulating reactive oxygen species and expression of stress-responsive genes. Plant Mol. Biol. 2013, 82, 303–320. [Google Scholar] [CrossRef]
  21. Liu, Y.; Cao, Y. Overexpression of GmWRKY17, a class IIb WRKY transcription factor from Glycine max, enhances drought tolerance in Arabidopsis plants. Plant Growth Regul. 2024, 104, 253–265. [Google Scholar] [CrossRef]
  22. Duan, D.; Yi, R.; Ma, Y.; Dong, Q.; Mao, K.; Ma, F. Apple WRKY transcription factor MdWRKY56 positively modulates drought stress tolerance. Environ. Exp. Bot. 2023, 212, 105400. [Google Scholar] [CrossRef]
  23. Zhao, K.; Zhang, D.; Lv, K.; Zhang, X.; Cheng, Z.; Li, R.; Jiang, T. Functional characterization of popular WRKY75 in salt and osmotic tolerance. Plant Sci. 2019, 289, 110259. [Google Scholar] [CrossRef]
  24. Waqas, M.; Azhar, M.T.; Rana, I.A.; Azeem, F.; Ali, M.A.; Nawaz, M.A.; Atif, R.M. Genome-wide identification and expression analyses of WRKY transcription factor family members from chickpea (Cicer arietinum L.) reveal their role in abiotic stress-responses. Genes Genom. 2019, 41, 467–481. [Google Scholar] [CrossRef]
  25. Khan, I.; Lubna, B.S.; Abdelbacki, A.M.; Kang, S.M.; AL-Harrasi, A.; Lee, I.J. Genome-wide and transcriptome analysis of PdWRKY transcription factors in date palm (Phoenix dactylifera) revealing insights into heat and drought stress tolerance. BMC Genom. 2025, 26, 589. [Google Scholar] [CrossRef]
  26. Jiang, D.; Huang, W.; Liu, J. Phylogenetic relationship of WRKY transcription factors in Solanum and potato genes in response to hormonal and biotic stresses. Plant Signal. Behav. 2025, 20, e249146. [Google Scholar] [CrossRef]
  27. Murashige, T.; Skoog, F. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant. 1962, 15, 473–497. [Google Scholar] [CrossRef]
  28. Mehboob, I.; Baig, S.; Siddique, M.; Shan, X.; Baig, A.; Shah, M.M.; Khalid, S. Deciphering the role of SlWRKY36 and SlWRKY51 in salt stress tolerance via modulating ion homeostasis and proline biosynthesis. Curr. Plant Biol. 2024, 39, 100380. [Google Scholar] [CrossRef]
  29. Camacho, C.; Boratyn, G.M.; Joukov, V.; Vera Alvarez, R.; Madden, T.L. Elastic BLAST: Accelerating sequence search via cloud computing. BMC Bioinform. 2023, 24, 117. [Google Scholar] [CrossRef] [PubMed]
  30. Hoang, D.T.; Chernomor, O.; Von Haeseler, A.; Minh, B.Q.; Vinh, L.S. UFBoot2: Improving the ultrafast bootstrap approximation. Mol. Biol. Evol. 2018, 35, 518–522. [Google Scholar] [CrossRef]
  31. Lanfear, R.; Frandsen, P.B.; Wright, A.M.; Senfeld, T.; Calcott, B. PartitionFinder 2: New methods for selecting partitioned models of evolution for molecular and morphological phylogenetic analyses. Mol. Biol. Evol. 2017, 34, 772–773. [Google Scholar] [CrossRef]
  32. Minh, B.Q.; Schmidt, H.A.; Chernomor, O.; Schrempf, D.; Woodhams, M.D.; Von Haeseler, A.; Lanfear, R. IQ-TREE 2: New models and efficient methods for phylogenetic inference in the genomic era. Mol. Biol. Evol. 2020, 37, 1530–1534. [Google Scholar] [CrossRef]
  33. Rozewicki, J.; Li, S.; Amada, K.M.; Standley, D.M.; Katoh, K. MAFFT-DASH: Integrated protein sequence and structural alignment. Nucleic Acids Res. 2019, 47, W5–W10. [Google Scholar] [CrossRef] [PubMed]
  34. Zhang, D.; Gao, F.; Jakovlić, I.; Zou, H.; Zhang, J.; Li, W.X.; Wang, G.T. PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Mol. Ecol. Resour. 2020, 20, 348–355. [Google Scholar] [CrossRef] [PubMed]
  35. Rashid, S.; Saad, M.; Baig, S.; Shah, M.M.; Nawaz, I.; Baig, A. Effective regeneration and transformation of potato variety Desiree with nucleotide diphosphate kinase 2 using IAA and BAP. Pak. J. Bot. 2021, 53, 89–96. [Google Scholar] [CrossRef] [PubMed]
  36. Richter, J.A.; Erban, A.; Kopka, J.; Zörb, C. Metabolic contribution to salt stress in two maize hybrids with contrasting resistance. Plant Sci. 2015, 233, 107–115. [Google Scholar] [CrossRef]
  37. Lichtenthaler, H.K.; Buschmann, C. Extraction of photosynthetic tissues: Chlorophylls and Carotenoids. Curr. Protoc. Food Anal. Chem. 2001, 1, F4.2.1–F4.2.6. [Google Scholar] [CrossRef]
  38. Bates, L.S.; Waldren, R.P.A.; Teare, I.D. Rapid determination of free proline for water-stress studies. Plant Soil 1973, 39, 205–207. [Google Scholar] [CrossRef]
  39. Ali, S.G.; Rab, A.; Khan, N.U.; Nawab, K. Enhanced proline synthesis may determine resistance to salt stress in tomato cultivars. Pak. J. Bot. 2011, 43, 2707–2710. [Google Scholar]
  40. Qadir, A.; Khan, S.A.; Ahmad, R.; Masood, S.; Irshad, M.; Kaleem, F.; Shahzad, M. Exogenous Ca2SiO4 enrichment reduces the leaf apoplastic Na+ and increases the growth of okra (Abelmoschus esculentus L.) under salt stress. Sci. Hortic. 2017, 214, 1–8. [Google Scholar] [CrossRef]
  41. Barbier, F.F.; Chabikwa, T.G.; Ahsan, M.U.; Cook, S.E.; Powell, R.; Tanurdzic, M.; Beveridge, C.A. A phenol/chloroform-free method to extract nucleic acids from recalcitrant, woody tropical species for gene expression and sequencing. Plant Methods 2019, 15, 62. [Google Scholar] [CrossRef]
  42. Liang, L.; Guo, L.; Zhai, Y.; Hou, Z.; Wu, W.; Zhang, X.; Liu, W. Genome-wide characterization of SOS1 gene family in potato (Solanum tuberosum) and expression analyses under salt and hormone stress. Front. Plant Sci. 2023, 14, 1201730. [Google Scholar] [CrossRef]
  43. Jaarsma, R.; De Boer, A.H. Salinity tolerance of two potato cultivars (Solanum tuberosum) correlates with differences in vacuolar transport activity. Front. Plant Sci. 2018, 9, 737. [Google Scholar] [CrossRef] [PubMed]
  44. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  45. R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2025. [Google Scholar]
  46. Agarwal, P.; Reddy, M.P.; Chikara, J. WRKY: Its structure, evolutionary relationship, DNA-binding selectivity, role in stress tolerance and development of plants. Mol. Biol. Rep. 2011, 38, 3883–3896. [Google Scholar] [CrossRef] [PubMed]
  47. Song, H.; Wang, P.; Hou, L.; Zhao, S.; Zhao, C.; Xia, H.; Wang, X. Global analysis of WRKY genes and their response to dehydration and salt stress in soybean. Front. Plant Sci. 2016, 7, 9. [Google Scholar] [CrossRef] [PubMed]
  48. Liu, X.; Song, Y.; Xing, F.; Wang, N.; Wen, F.; Zhu, C. GhWRKY25, a group I WRKY gene from cotton, confers differential tolerance to abiotic and biotic stresses in transgenic Nicotiana benthamiana. Protoplasma 2016, 253, 1265–1281. [Google Scholar] [CrossRef]
  49. Zhao, X.; Qi, G.; Liu, J.; Chen, K.; Miao, X.; Hussain, J.; Ren, H. Genome-wide identification of WRKY transcription factors in Casuarina equisetifolia and the function analysis of CeqWRKY11 in response to NaCl/NaHCO3 stresses. BMC Plant Biol. 2024, 24, 376. [Google Scholar] [CrossRef]
  50. Zhou, L.; Wang, N.N.; Gong, S.Y.; Lu, R.; Li, Y.; Li, X.B. Overexpression of a cotton (Gossypium hirsutum) WRKY gene, GhWRKY34, in Arabidopsis enhances salt-tolerance of the transgenic plants. Plant Physiol. Biochem. 2015, 96, 311–320. [Google Scholar] [CrossRef]
  51. Huang, J.; Liu, F.; Chao, D.; Xin, B.; Liu, K.; Cao, S.; Xia, J. The WRKY transcription factor OsWRKY54 is involved in salt tolerance in rice. Int. J. Mol. Sci. 2022, 23, 11999. [Google Scholar] [CrossRef]
  52. Hichri, I.; Muhovski, Y.; Žižková, E.; Dobrev, P.I.; Gharbi, E.; Franco-Zorrilla, J.M.; Lutts, S. The Solanum lycopersicum WRKY3 transcription factor SlWRKY3 is involved in salt stress tolerance in tomato. Front. Plant Sci. 2017, 8, 1343. [Google Scholar] [CrossRef]
  53. Liang, Q.Y.; Wu, Y.H.; Wang, K.; Bai, Z.Y.; Liu, Q.L.; Pan, Y.Z.; Jiang, B.B. Chrysanthemum WRKY gene DgWRKY5 enhances tolerance to salt stress in transgenic chrysanthemum. Sci. Rep. 2017, 7, 4799. [Google Scholar] [CrossRef]
  54. Yuan, Y.; Ren, S.; Liu, X.; Su, L.; Wu, Y.; Zhang, W.; Zhang, Y. SlWRKY35 positively regulates carotenoid biosynthesis by activating the MEP pathway in tomato fruit. New Phytol. 2022, 234, 164–178. [Google Scholar] [CrossRef]
  55. Ruiz-Sola, M.Á.; Arbona, V.; Gomez-Cadenas, A.; Rodriguez-Concepcion, M.; Rodriguez-Villalon, A. A root specific induction of carotenoid biosynthesis contributes to ABA production upon salt stress in Arabidopsis. PLoS ONE 2014, 9, e90765. [Google Scholar] [CrossRef] [PubMed]
  56. Nicolas, M.; Bouma, J.; Venema, J.H.; van der Schoot, H.; Verstappen, F.; de Zeeuw, T.; Karlova, R. Potato cultivars use distinct mechanisms for salt stress acclimation. Plant Stress 2025, 15, 100798. [Google Scholar] [CrossRef]
  57. Mansour, M.M.F.; Ali, E.F. Evaluation of proline functions in saline conditions. Phytochemistry 2017, 140, 52–68. [Google Scholar] [CrossRef] [PubMed]
  58. He, J.; Chen, S.; Chen, R.; Li, X.; Wu, J.; Zheng, Y.; Zhan, Y. Okra WRKY transcription factors AeWRKY32 and AeWRKY70 are involved in salt stress response. Int. J. Mol. Sci. 2024, 25, 12820. [Google Scholar] [CrossRef] [PubMed]
  59. Shi, W.Y.; Du, Y.T.; Ma, J.; Min, D.H.; Jin, L.G.; Chen, J.; Zhang, X.H. The WRKY transcription factor GmWRKY12 confers drought and salt tolerance in soybeans. Int. J. Mol. Sci. 2018, 19, 4087. [Google Scholar] [CrossRef]
  60. Ahammed, G.J.; Li, X.; Wan, H.; Zhou, G.; Cheng, Y. SlWRKY81 reduces drought tolerance by attenuating proline biosynthesis in tomato. Sci. Hortic. 2020, 270, 109444. [Google Scholar] [CrossRef]
  61. Ma, L.; Li, X.; Zhang, J.; Yi, D.; Li, F.; Wen, H.; Wang, X. MsWRKY33 increases alfalfa (Medicago sativa L.) salt stress tolerance through altering the ROS scavenger via activating MsERF5 transcription. Plant Cell Environ. 2023, 46, 3887–3901. [Google Scholar] [CrossRef]
  62. Zhou, X.; Sun, Z.; Huang, Y.; He, D.; Lu, L.; Wei, M.; Jiang, Z. WRKY45 positively regulates salinity and osmotic stress responses in Arabidopsis. Plant Physiol. Biochem. 2025, 219, 109408. [Google Scholar] [CrossRef]
  63. Chen, H.; Lai, Z.; Shi, J.; Xiao, Y.; Chen, Z.; Xu, X. Roles of Arabidopsis WRKY18, WRKY40 and WRKY60 transcription factors in plant responses to abscisic acid and abiotic stress. BMC Plant Biol. 2010, 10, 281. [Google Scholar] [CrossRef]
  64. Li, C.; Guan, J.; Liang, W.H.; Yao, S.; He, L.; Wei, X.D.; Zhao, L.; Zhuo, L.H.; Zhao, C.F.; Zhao, Q.Y.; et al. OsWRKY72 enhances salt tolerance in rice via SKC1-mediated Na+ regulation. Plant Stress 2025, 17, 100962. [Google Scholar] [CrossRef]
  65. Lin, L.; Yuan, K.; Huang, Y.; Dong, H.; Qiao, Q.; Xing, C.; Zhang, S. A WRKY transcription factor PbWRKY40 from Pyrus betulaefolia functions positively in salt tolerance and modulating organic acid accumulation by regulating PbVHA-B1 expression. Environ. Exp. Bot. 2022, 196, 104782. [Google Scholar] [CrossRef]
  66. Yu, J.; Zhu, C.; Xuan, W.; An, H.; Tian, Y.; Wang, B.; Wan, J. Genome-wide association studies identify OsWRKY53 as a key regulator of salt tolerance in rice. Nat. Commun. 2023, 14, 3550. [Google Scholar] [CrossRef]
Life 15 01389 g001
Figure 1. StWRKY4 and StWRKY4 expression analyses in transgenic and wild-type potato plants. (a) StWT:StWRKY4 and (b) StWT:StWRKY56. Data are presented as relative fold change with mean values ±SD. Means with different letters were significantly different at p ≥ 0.05.
Figure 1. StWRKY4 and StWRKY4 expression analyses in transgenic and wild-type potato plants. (a) StWT:StWRKY4 and (b) StWT:StWRKY56. Data are presented as relative fold change with mean values ±SD. Means with different letters were significantly different at p ≥ 0.05.
Life 15 01389 g001
Life 15 01389 g002
Figure 2. Phylogenetic tree based on WRKY protein sequences, illustrating the evolutionary relationships of StWRKY4 and StWRKY56 (marked with red stars) along with Arabidopsis thaliana (thale cress), Solanum pennellii (wild tomato), Solanum lycopersicum (tomato), Lycium barbarum (Goji berry) and Capsicum chinense (Chinese pepper) with AtWRKY11 used as an outgroup. The phylogenetic tree was inferred using IQ-TREE v2.2.0 with the maximum likelihood method. The tree robustness was assessed with 20,000 ultrafast bootstraps and the Shimodaira–Hasegawa-like approximate likelihood-ratio test.
Figure 2. Phylogenetic tree based on WRKY protein sequences, illustrating the evolutionary relationships of StWRKY4 and StWRKY56 (marked with red stars) along with Arabidopsis thaliana (thale cress), Solanum pennellii (wild tomato), Solanum lycopersicum (tomato), Lycium barbarum (Goji berry) and Capsicum chinense (Chinese pepper) with AtWRKY11 used as an outgroup. The phylogenetic tree was inferred using IQ-TREE v2.2.0 with the maximum likelihood method. The tree robustness was assessed with 20,000 ultrafast bootstraps and the Shimodaira–Hasegawa-like approximate likelihood-ratio test.
Life 15 01389 g002
Life 15 01389 g003
Figure 3. Effect of silencing of StWRKY4 on plant growth in response to salt stress. (a) Number of leaves; (b) number of roots; (c) shoot length; and (d) root length in five-week-old Solanum tuberosum (St) wild-type (StWT), StWT at 100 and 200 mM, silenced StWRKY4, silenced StWRKY4 at 100 and 200 mM were evaluated for salt stress. Data were observed after 0 h, 21 days and 35 days for each treatment. Duncan’s multiple range test was applied with different letters on bars and shows significantly different means at p < 0.05. Data are represented by means ± SD with three replicates.
Figure 3. Effect of silencing of StWRKY4 on plant growth in response to salt stress. (a) Number of leaves; (b) number of roots; (c) shoot length; and (d) root length in five-week-old Solanum tuberosum (St) wild-type (StWT), StWT at 100 and 200 mM, silenced StWRKY4, silenced StWRKY4 at 100 and 200 mM were evaluated for salt stress. Data were observed after 0 h, 21 days and 35 days for each treatment. Duncan’s multiple range test was applied with different letters on bars and shows significantly different means at p < 0.05. Data are represented by means ± SD with three replicates.
Life 15 01389 g003
Life 15 01389 g004
Figure 4. Effect of silencing of StWRKY56 on plant growth in response to salt stress. (a) Number of leaves; (b) number of roots; (c) shoot length; and (d) root length of five-week-old Solanum tuberosum (St) wild-type (WT), WT with 100 and 200 mM, silenced StWRKY56 and silenced StWRKY56 with 100 and 200 mM were evaluated for salt stress. Data were recorded after 0 h, 21 days and 35 days for each treatment. Duncan’s multiple range test was applied with different letters on bars and shows significantly different means at p < 0.05. Data are represented by means ± SD with three replicates.
Figure 4. Effect of silencing of StWRKY56 on plant growth in response to salt stress. (a) Number of leaves; (b) number of roots; (c) shoot length; and (d) root length of five-week-old Solanum tuberosum (St) wild-type (WT), WT with 100 and 200 mM, silenced StWRKY56 and silenced StWRKY56 with 100 and 200 mM were evaluated for salt stress. Data were recorded after 0 h, 21 days and 35 days for each treatment. Duncan’s multiple range test was applied with different letters on bars and shows significantly different means at p < 0.05. Data are represented by means ± SD with three replicates.
Life 15 01389 g004
Life 15 01389 g005
Figure 5. Effect of silencing of StWRKY4 on plant pigments in response to salt stress. (a) Chlorophyll-a; (b) Chlorophyll-b; (c) Carotenoid; (d) Total chlorophyll in five weeks old Solanum tuberosum (St) wild-type (StWT), StWT at 100 and 200 mM, silenced StWRKY4, silenced StWRKY4 at 100 and 200 mM were evaluated for salt stress. Data were recorded after 0 h, 21 days and 35 days for each treatment. Duncan’s multiple range test was applied with different letters on bars and shows significantly different means at p < 0.05. Data are represented by means ± SD with three replicates.
Figure 5. Effect of silencing of StWRKY4 on plant pigments in response to salt stress. (a) Chlorophyll-a; (b) Chlorophyll-b; (c) Carotenoid; (d) Total chlorophyll in five weeks old Solanum tuberosum (St) wild-type (StWT), StWT at 100 and 200 mM, silenced StWRKY4, silenced StWRKY4 at 100 and 200 mM were evaluated for salt stress. Data were recorded after 0 h, 21 days and 35 days for each treatment. Duncan’s multiple range test was applied with different letters on bars and shows significantly different means at p < 0.05. Data are represented by means ± SD with three replicates.
Life 15 01389 g005
Life 15 01389 g006
Figure 6. Effect of silencing of StWRKY56 on plant pigments in response to salt stress. (a) Chlorophyll-a; (b) chlorophyll-b; (c) carotenoid; (d) total chlorophyll in five-week-old Solanum tuberosum (St) wild-type (StWT), StWT at 100 and 200 mM, silenced StWRKY56, silenced StWRKY56 at 100 and 200 mM were evaluated for salt stress. Data were recorded after 0 h, 21 days and 35 days for each treatment. Duncan’s multiple range test was applied with different letters on bars and shows significantly different means at p < 0.05. Data are represented by means ± SD with three replicates.
Figure 6. Effect of silencing of StWRKY56 on plant pigments in response to salt stress. (a) Chlorophyll-a; (b) chlorophyll-b; (c) carotenoid; (d) total chlorophyll in five-week-old Solanum tuberosum (St) wild-type (StWT), StWT at 100 and 200 mM, silenced StWRKY56, silenced StWRKY56 at 100 and 200 mM were evaluated for salt stress. Data were recorded after 0 h, 21 days and 35 days for each treatment. Duncan’s multiple range test was applied with different letters on bars and shows significantly different means at p < 0.05. Data are represented by means ± SD with three replicates.
Life 15 01389 g006
Life 15 01389 g007
Figure 7. Silenced StWRKY4 potato plants in response to salt stress. (a) Proline; (b) Na+ content; (c) K+ content; and (d) Na+/K+ ratio in five-week-old Solanum tuberosum (St) wild-type (StWT), StWT at 100 and 200 mM, silenced StWRKY4, silenced StWRKY4 at 100 and 200 mM were evaluated for salt stress. Data were recorded after 0 h, 21 days and 35 days for each treatment. Duncan’s multiple range test was applied with different letters on bars and shows significantly different means at p < 0.05. Data are represented by means ± SD with three replicates.
Figure 7. Silenced StWRKY4 potato plants in response to salt stress. (a) Proline; (b) Na+ content; (c) K+ content; and (d) Na+/K+ ratio in five-week-old Solanum tuberosum (St) wild-type (StWT), StWT at 100 and 200 mM, silenced StWRKY4, silenced StWRKY4 at 100 and 200 mM were evaluated for salt stress. Data were recorded after 0 h, 21 days and 35 days for each treatment. Duncan’s multiple range test was applied with different letters on bars and shows significantly different means at p < 0.05. Data are represented by means ± SD with three replicates.
Life 15 01389 g007
Life 15 01389 g008
Figure 8. Silenced StWRKY56 potato plants in response to salt stress. (a) Proline; (b) Na+ content; (c) K+ content; and (d) Na+/K+ ratio in five-week-old Solanum tuberosum (St) wild-type (StWT), StWT at 100 and 200 mM, silenced StWRKY56, silenced StWRKY56 at 100 and 200 mM were evaluated for salt stress. Data were recorded after 0 h, 21 days and 35 days for each treatment. Duncan’s multiple range test was applied with different letters on bars and shows significantly different means at p < 0.05. Data are represented by means ± SD with three replicates.
Figure 8. Silenced StWRKY56 potato plants in response to salt stress. (a) Proline; (b) Na+ content; (c) K+ content; and (d) Na+/K+ ratio in five-week-old Solanum tuberosum (St) wild-type (StWT), StWT at 100 and 200 mM, silenced StWRKY56, silenced StWRKY56 at 100 and 200 mM were evaluated for salt stress. Data were recorded after 0 h, 21 days and 35 days for each treatment. Duncan’s multiple range test was applied with different letters on bars and shows significantly different means at p < 0.05. Data are represented by means ± SD with three replicates.
Life 15 01389 g008
Life 15 01389 g009
Figure 9. Expression analyses qRT-PCR of silenced StWRKY4 potato plants. (a) StSOS1 and (b) StNHX3. Five-week-old potato plants were treated with 100 and 200 mM salt concentrations. Leaves of control, treated control, silenced and treated silenced potato plants were harvested at 0 h, 21 and 35 days. Transcripts showed fold change after normalization with the internal control StActin. Significance letters of transcript fold change relative to control treatments with means ± SD with two replicates for each treatment were determined by Duncan’s multiple range test at p < 0.05.
Figure 9. Expression analyses qRT-PCR of silenced StWRKY4 potato plants. (a) StSOS1 and (b) StNHX3. Five-week-old potato plants were treated with 100 and 200 mM salt concentrations. Leaves of control, treated control, silenced and treated silenced potato plants were harvested at 0 h, 21 and 35 days. Transcripts showed fold change after normalization with the internal control StActin. Significance letters of transcript fold change relative to control treatments with means ± SD with two replicates for each treatment were determined by Duncan’s multiple range test at p < 0.05.
Life 15 01389 g009
Life 15 01389 g010
Figure 10. Expression analyses qRT-PCR of silenced StWRKY56 potato plants. (a) StSOS1 and (b) StNHX3. Five-week-old potato plants were treated with 100 and 200 mM salt concentrations. Leaves of control, treated control, silenced and treated silenced potato plants were harvested at 0 h, 21 and 35 days. Transcripts showed fold change after normalization with the internal control StActin. Significance letters of transcript fold change relative to control treatments with means ± SD with two replicates for each treatment were determined by Duncan’s multiple range test at p < 0.05.
Figure 10. Expression analyses qRT-PCR of silenced StWRKY56 potato plants. (a) StSOS1 and (b) StNHX3. Five-week-old potato plants were treated with 100 and 200 mM salt concentrations. Leaves of control, treated control, silenced and treated silenced potato plants were harvested at 0 h, 21 and 35 days. Transcripts showed fold change after normalization with the internal control StActin. Significance letters of transcript fold change relative to control treatments with means ± SD with two replicates for each treatment were determined by Duncan’s multiple range test at p < 0.05.
Life 15 01389 g010
Table 1. Primers used for StWRKY4, StWRKY56, StNHX3, StSOS1 and StActin.
Table 1. Primers used for StWRKY4, StWRKY56, StNHX3, StSOS1 and StActin.
PrimersForward SequenceReverse Sequence
StWRKY45′ GCTCCACCAACTCTACATTCCC 3′5′ CAGAATGAGCAACAAGAGCCCC 3′
StWRKY565′ CCCTTGTGAAAAGCTAATGGAG 3′5′ GCATGTGTGATGTGTACATCG 3′
StNHX35′ TTGGCACAGACGTGAACCTA 3′5′ GTGGCTTCTGACCAGTGACA 3′
StSOS15′ TCCTGGAGACGGTAGCCAAA 3′5′ ATTCCACCAATGGCAGCAGA 3′
StActin5′ ATGAAGCTGTCCTTTTCACTTGTTTT 3′5′ CTACATAGTATGCATGTCCGTATTT 3′
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Gul, N.; Baig, S.; Shan, X.; Shahzadi, I.; Siddique, M.; Zhao, H.; Ahmad, R.; Hussain, J.; Khalid, S.; Baig, A. Exploring Different Roles of StWRKY4 and StWRKY56 in Transgenic Potato Against Salt Stress. Life 2025, 15, 1389. https://doi.org/10.3390/life15091389

AMA Style

Gul N, Baig S, Shan X, Shahzadi I, Siddique M, Zhao H, Ahmad R, Hussain J, Khalid S, Baig A. Exploring Different Roles of StWRKY4 and StWRKY56 in Transgenic Potato Against Salt Stress. Life. 2025; 15(9):1389. https://doi.org/10.3390/life15091389

Chicago/Turabian Style

Gul, Nadia, Sofia Baig, Xiaoliang Shan, Irum Shahzadi, Maria Siddique, Hongwei Zhao, Raza Ahmad, Jamshaid Hussain, Samina Khalid, and Ayesha Baig. 2025. "Exploring Different Roles of StWRKY4 and StWRKY56 in Transgenic Potato Against Salt Stress" Life 15, no. 9: 1389. https://doi.org/10.3390/life15091389

APA Style

Gul, N., Baig, S., Shan, X., Shahzadi, I., Siddique, M., Zhao, H., Ahmad, R., Hussain, J., Khalid, S., & Baig, A. (2025). Exploring Different Roles of StWRKY4 and StWRKY56 in Transgenic Potato Against Salt Stress. Life, 15(9), 1389. https://doi.org/10.3390/life15091389

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop