Next Article in Journal
Breaking the Cycle: Enhancing Cardiovascular Health in the Elderly Through Group Exercise
Previous Article in Journal
Bacterial Communities from the Copper Mine of Wettelrode (Germany)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Life
Volume 15
Issue 2
10.3390/life15020203
life-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Wild Emmer (Triticum turgidum ssp. dicoccoides) Diversity in Southern Turkey: Evaluation of SSR and Morphological Variations

by
Esra Çakır
1,*,
Ahmad Alsaleh
2,
Harun Bektas
3 and
Hakan Özkan
1,*
1
Department of Field Crops, Faculty of Agriculture, Çukurova University, 01330 Adana, Turkey
2
Department of Food and Agriculture, Institute of Hemp Research, Yozgat Bozok University, 66100 Yozgat, Turkey
3
Department of Agricultural Biotechnology, Faculty of Agriculture, Siirt University, 56100 Siirt, Turkey
*
Authors to whom correspondence should be addressed.
Life 2025, 15(2), 203; https://doi.org/10.3390/life15020203
Submission received: 24 December 2024 / Revised: 22 January 2025 / Accepted: 26 January 2025 / Published: 29 January 2025
(This article belongs to the Section Plant Science)
Browse Figures
Versions Notes

Abstract

:
Wild emmer wheat (Triticum turgidum ssp. dicoccoides) is the ancestral species of cultivated tetraploid wheat with BBAA genomes. Because of its full interfertility with domesticated emmer wheat, this wild species can serve as one of the most important genetic resources to improve durum and bread wheat. To clarify the magnitude of genetic diversity between and within populations of Turkish wild emmer wheat, 169 genotypes of ssp. dicoccoides selected from the 38 populations collected from the three sub-regions (East-1, West-1, and West-2) of the Southeast Anatolia Region of Turkey were molecularly and morphologically characterized. The populations showed significant variation in plant height, heading date, flag leaf area, spike length and number, spikelet, peduncle, lemma, palea, glume and anther lengths, glume hull thickness, anther width, and days to maturity. According to the results of nuclear-SSR analysis, the populations collected from the sub-regions East-1 and West-2 were the most genetically distant (0.539), while the populations collected from the sub-regions West-1 and West-2 were the most genetically similar (0.788) populations. According to the results of AMOVA, there was 84% similarity within the populations studied, while the variation between the populations of the three sub-regions was 16%. In the dendrogram obtained by using nuclear-SSR data, the populations formed two main groups. The populations from the sub-region East-1 were in the first group, and the populations from the sub-regions West-1 and West-2 were in the second group. From the dendrogram, it appears that the populations from the sub-region East-1 were genetically distant from the populations from the sub-regions West-1 and West-2. The results highlight the potential diversity in Southeast Anatolia for wild emmer discovery and utilization.

1. Introduction

Crop wild relatives are the primary sources of novel genetic diversity that is needed for crop improvement in all aspects [1]. A comprehensive evaluation of in situ and ex situ resources, as well as common cultivars, to mine new alleles is a continuously needed process for crop improvement and agricultural sustainability [2]. The utilization of genetic resources not only requires a clear understanding of the allelic constitution of such species [3] but also requires the successful introduction of this diversity into the domesticated gene pool [4].
Wild emmer wheat (Triticum turgidum ssp. dicoccoides), as one of the closest known wild relatives of the domesticated tetraploid wheat, holds significant potential for wheat improvement [5,6,7]. It is the most likely ancestral species of cultivated tetraploid wheat with a genome constitution of BBAA. The geographical distribution area of wild emmer covers the Fertile Crescent in South-west Asia, from Israel, Jordan, Lebanon, Syria, southern Turkey, and northern Iraq to south/southwest Iran [8,9]. Due to its full interfertility with domesticated emmer wheat (T. turgidum subsp. dicoccum (Schrank ex Schübl.) Thell.), it can serve as one of the most important genetic resources to improve durum (Triticum turgidum L. ssp. durum (Desf.) and bread wheat (Triticum aestivum L.). Wild emmer has been used for allele mining for many needs of wheat breeding, including, but not limited to, drought [10,11] and salinity tolerance [5,12], and for biotic stress factors such as fusarium head blight [13,14], stripe rust [15,16], root-lesion nematodes [17], and powdery mildew [18,19,20,21,22]. In addition to stress tolerance and resistance-related introductions from the wild emmer genome, there has been extensive usage of wild emmer in many aspects of wheat improvement, including vernalization genes [23], drought-related traits [24], avenin-like proteins [25], and many others [6,8,11,24,26]. However, there is a need for cautious assessment because of the risk of introduction of undesirable genes [27,28,29,30].
Due to its possible domestication in or near the Levant [6,9], there has been a high level of reports from Israel and the vicinity in the Jordan Valley [31,32,33]. There are only a few studies on the accessions of wild emmer wheat from some locations out of Turkey [9,34,35,36], but there is not any comprehensive evaluation of in situ or ex situ gene pools from Southeast Anatolia. On the other hand, since the early 20th century, there has been a significant number of reports on the diversity and distribution of wild emmer wheat from the Levant and Jordan Valley, mostly Israel and Lebanon [31,32,37,38,39,40,41,42,43,44,45,46,47]. This concentrated evaluation of a specific region for wild emmer continued in the following years [7,11,16,20,48,49,50,51,52,53,54,55,56,57,58,59,60]. The evaluation of the natural populations in the central Fertile Crescent, especially Southeast Anatolia, is neglected. Even though this region has recently been emphasized for its role in wheat domestication [9,61], there is no comprehensive report of the natural wild emmer diversity in this region and Turkey. Therefore, the purpose of this study was to document the phenotypic and genotypic diversity between and within 169 accessions of 38 in situ populations of wild emmer wheat collected from Southeast Anatolia.

2. Materials and Methods

In this study, 169 accessions of 38 wild emmer wheat populations recently collected from Southeast Anatolia were used (Table 1). A total of 17 populations were collected from the Karadağ region (8 populations from Karadağ/West1 and 9 populations from Karadağ/West2 regions), near Gaziantep, while rest of the populations (21 populations from Karacadağ/East) were collected from the Karacadağ region, 200 km east, near Diyarbakır, Turkey. This study was conducted in Adana, Turkey during the 2010–2011 growing season. The seeds from each population were grown at the experimental area of Çukurova University, Adana, Turkey, to study genotypic and phenotypic variation. Initially, ten seeds from each genotype were germinated in Petri dishes. Once the seedlings developed, they were transferred to small pots. Each seedling was then transplanted into a separate row, maintaining a spacing of 30 cm between and within the rows. To prevent damage from spike breakage and to ensure complete self-pollination while preserving seed purity, the main spikes of all wild emmer plants (Triticum turgidum subsp. dicoccoides) were bagged for self-pollination.
Total genomic DNA was isolated from young leaves according to the cetyltrimethylammonium bromide (CTAB) protocol [62] with some modifications reported by Ozkan et al. [63]. The extracted DNA was evaluated qualitatively in addition to quantitively, and measured by 0.8% agarose gel electrophoresis. Before using DNA for molecular analysis, the DNA was diluted to the required concentration of 10 ng/mL for SSR applications. Initially, 100 SSR primers mapped to the A and B genomes were first screened on eight wild emmer genotypes not only to detect their polymorphism level but also PCR amplification. After the screening, 16 SSR primers were selected for further work (Table 2). M13 tailed-primer PCR amplification of SSRs according to [64] was performed in a 12 µL PCR mix containing 1X buffer, 0.125 mM dNTPs, 0.4 pmol M13 sequences tailed forward primer, 0.3 pmol reverse primers, 3.0 pmol universal M13 primer labeled with one of four (6-FAM, VIC, NED or PET) fluorescent dyes, 0.12U Taq DNA polymerase, and approximately 50 ng genomic DNA. PCR amplification was performed with an initial denaturation at 94 °C for 5 min; 30 cycles of 94 °C for 1 min, 55 to 67 °C (annealing temperature depending on primers) for 1 min, and 72 °C for 1 min; followed by 8 cycles of 94 °C for 30 s, 53 °C for 45 s, and 72 °C for 45 s; and a final extension at 72 °C for 10 min. A set of four PCR products (1 μL each) labeled with a different dye was combined with 0.25 μL GeneScan-400 LIZ® size standards (Applied Biosystems, USA) and 9.86 µL Hi-Di™ Formamide (Applied Biosystems), denatured at 94 °C for 5 min, chilled on ice, and separated on an ABI 3130xl Genetic Analyzer (Applied Biosystems, USA). The SSR fragments were scored and checked twice using the Gene Mapper software v3.7 (Applied Biosystems, USA) as described in the user manual.
The SSR was scored as binary data (1/0), indicating the presence or absence of a marker in the genomic representation of each sample. Genetic distance was calculated using DARWin 6.0.13. Subsequently, these genetic distance data were used to construct a phylogenetic tree using the Neighbor-joining method in the MEGA11 software program. Several genetic diversity parameters were calculated for each locus and population using the GENALEX6.5 program [65]. Principal coordinate analysis (PCoA), used to explore multivariate relationships among inter-individual genetic distances within and among populations, was also performed with the GENALEX6.5 program.

3. Results

3.1. Agromorphological Variation in Wild Emmer Populations

A total of 169 accessions, collected as 38 populations from Southeast Anatolia, were evaluated for agromorphological and genetic-diversity-related traits. According to the variance analysis (ANOVA) based on three groups, there were significant (p < 0.05) differences between the evaluated panel of accessions for plant height, heading date, flag leaf area, spike length and number, spikelet, peduncle, lemma, palea, glume, and anther lengths, glume hull thickness, anther width, and days to maturity (Table 3).
Out of the 23 agromorphological parameters evaluated, the populations from Karacadag/EAST had the highest values in spike length (9.28 cm), spikelet number (20.69), glume hull thickness (0.26 mm), and anther width (0.59 mm). On the other hand, populations from the Karadag-1/WEST region had the highest agromorphological trait values in heading date (170.38 days), flag leaf area (17.76 cm2), auriculas width (5.68 mm), length of the uppermost awn in the spikelet (68.41 mm), spikelet length (16.13 mm), lemma length (13.95 mm), and palea length (12.88 mm). Finally, the populations from Karadag-2/WEST region had the highest values in plant height (128.31 cm), heading date (167.49 days), peduncle length (41.48 cm), auriculas length (4.65 mm), lemma width (2.62 mm), palea width (2.03 mm), glume length (12.61 mm), glume height (2.55 mm), anther length (4.10 mm), and maturation day (199.86 days). According to overall data, populations from the Karadag-2/WEST region had the maximum agromorphological diversity and the highest values in phenotypical traits (Table 4).

3.2. Genetic Diversity Within and Between the Populations and Sub-Regions

The genetic diversity of the evaluated accessions was assessed with analysis of molecular variance (AMOVA), and several diversity parameters including Nei genetic distance and identity values (Table 5 and Table 6). AMOVA was calculated to assess the variance within and between 38 populations of wild emmer wheat collected from three sub-regions of Southeast Anatolia (Table 5). There was a significant level of variation within the populations (84%), while the variation among the populations was 16%. Nei genetic distance and identity values for the three sub-regions are given in Table 5. According to the results, the regions with the most distance were Karacadag/EAST and Karadag-2/WEST (0.539), while the ones with the closest identity values were Karadag-1/WEST and Karadag-2/WEST (0.788). The lowest distance was seen between two Karacadağ west sub-regions (0.214), and the lowest identity was between Karacadag/EAST and Karadag-2/WEST regions (0.463).
We also calculated several genetic diversity parameters to estimate the variation within and between the populations. These parameters were the number of alleles per locus (Na), the number of effective alleles per locus (Ne), Shannon’s information index (I), expected heterozygosity (He), and unbiased heterozygosity (uHe). The highest number of alleles per locus was in the populations from the Karacadag/EAST region, while the lowest was in the populations from the Karadag-1/WEST region. Similarly, the populations from Karacadag/EAST region had the highest values in Ne, I, He, and uHe compared to the Karadag-1/WEST and Karadag-2/WEST populations (Table 7). In contrast, the lowest values in all parameters were obtained in the populations from the Karadag-1/WEST region. According to the above results, the maximum and minimum genetic diversity were obtained in the populations from Karacadag/EAST and Karadag-1/WEST regions, respectively.

3.3. PCoA and Neighbor-Joining Grouping Patterns in Wild Emmer Populations

The PCoA was applied to define the population interactions, and 169 accessions from 38 populations were separated into two major clusters without any mixture between Karacadag/EAST and both Karadag-1/WEST and Karadag-2/WEST regions. The distinction between East and West was quite sharp and there was no mixture (Figure 1) between these regions. Two sub-sets of Karadağ/WEST (1 and 2) were almost entirely mixed. So, it was not possible to separate them further into smaller sub-sets. Of the sub-cluster in Karacadag/EAST, there were several accessions located far away from the rest of the accessions.
The relationships within and between the three regional groups were also evaluated using Neighbor-joining analysis (Figure 2). Neighbor-joining tree dendrograms produced a similar distribution to PCoA clustering. Two main branches were formed with accessions from WEST and EAST. These two main clusters did not have any admixture. There were several sub-clusters on the main EAST and WEST clusters. There were several sub-clusters in the main WEST cluster, which were almost entirely constituted from the mixed accessions of WEST-1 and WEST-2. There were only a few sub-clusters (WEST-uppermost branch) with a clear divergence from the rest of the group. Even though there were mixtures over the entire main WEST cluster, each small sub-set was formed with at least several accessions from the same sub-region.

4. Discussion

Crop wild relatives are one of the main sources of allelic diversity and thus the hub for climate-resilient crop breeding. To “feed the billions” [66] and meet the pace of climate change and population increase, there is a continuous need for allele mining and germplasm screening [67,68,69,70,71]. Wild emmer wheat, one of the closest relatives of durum wheat [72], is a possible shortcut to the wide wild allelic gene pool in Triticum sp. [8,73,74,75]. As highlighted, there is a need for a “walk on the wild side” [68]. With this objective in mind, we characterized a set of in situ germplasm accessions from Southeast Anatolia, the home of Göbeklitepe, the oldest known temple, for genetic diversity assessment [76,77].

4.1. Agromorphological Diversity

As a result of germplasm collection from the three different sub-regions in Southeast Anatolia, 169 accessions within 38 populations were characterized. Agromorphological characterization and genetic variation assessment through SSR markers were utilized to estimate the natural population diversity of this region. Wild emmer is thought to be domesticated near the southern Levant [6,9], and there has been a growing intensity in the number of reports from the possible domestication center. However, it has a much wider species distribution [6,8,9] and the number of reports from other regions (Turkey and Iran) is quite limited [34,35,78]. In addition, none of the previous reports from Turkey built an in-depth agromorphological and/or genetic diversity evaluation among the natural (in situ) populations.
Here, we obtained significant agromorphological and genetic diversity among and within the subsets of wild emmer wheat collected (Table 3 and Table 4). The main components of the traits we evaluated were spike, plant growth, and phenological traits.
Even though there is a vast number of studies in relation to biotic stress tolerance, such as powdery mildew [20,79], fusarium head blight [13], and stripe rust [15] in wild emmer, we did not find any reports concerning spike and phenology traits within this region. The results highlight the potential of in situ populations and hidden gems in the wild [80] and show that several spike-related traits such as purple coleoptile, purple auricle, purple culm, hairy auricle, hairy rachilla, and the fragility of the spike were controlled by single dominant genes, making the transfer of such traits much more straightforward compared to quantitatively inherited traits. Further studies should try to utilize germplasm resources with novel allelic diversity in the common crops as candidates for abiotic and biotic stress tolerance, as well as yield- and growth-related traits [13,20,25,79,81].

4.2. Genetic Diversity of In situ Populations

To evaluate the genetic diversity within and between the populations, 16 specific SSR markers were applied (Table 2). According to the results of AMOVA and other genetic diversity parameters, there was significant diversity among the evaluated panel of in situ accession. There were 84% within- and 16% between-population diversity. The results were in a similar range to previous reports in tetraploid wheat. In similar studies, Negisho et al. [82] reported 19 and 81% within- and between-population diversity, while Teklu et al. [83] reported wider levels of diversity among 73 wild emmer accessions from 11 different geographic regions. Nei genetic distance values in this study ranged between 0.214 (between Karadag-1/WEST and Karadag-2/WEST) and 0.539 (between Karacadag/EAST and Karadag-2/WEST). The results showed a clear-cut separation between the EAST and WEST populations. The mountainous landscape of the region seems to reduce genetic drift and mixture even within a relatively close distance of about 200 km. The distance between the WEST-1 and WEST-2 populations was small, about 55 km, and their genetic distance was quite small, compared to the WEST–EAST distance (Table 5). According to Harlan and Zohary [84], Zohary and Hopf [85], and Ozkan et al. [9], wild emmer has a wide distribution from the Levant to Turkey and south/southwest Iran. The level of observed diversity between the Karadağ and the Karacadağ regions demonstrates the potential of this unexplored habitat for crop improvement [6,11,86]. When we examined the diversity for climate (sub-Mediterranean to inner dry climates), elevation (650 m to 1300 m), mountainous landscapes, and slope, we discovered that geological and morphological diversity may be influenced by these characteristics. A rapidly changing climate and other geographical conditions may have resulted in unique population developments in this relatively small study area.
The number of alleles per locus (Na) is an indicator of the diversity at the gene level [87]. Here, we observed a three-fold difference between three regional groups from 3.93 in Karadag-1/WEST to 9.93 in Karacadag/EAST. Since all accessions were from the same species within the same wider region, this level of difference may be due to unequal population size distribution among sub-sets or some other unknown reasons. Li et al. [51] evaluated the number of microsatellites among 105 individuals from the Yehudiyya region of Israel; the Na values they obtained were lower than those in the current study. In their follow-up study, the same group obtained 1.88, 3.86, and 5.89 Na values at the chromosome, genome, and genome × chromosome levels. In a similar study, on a different region, Li et al. [47] reported an average 7.1 Na value using 28 microsatellite markers among 155 individuals from two sub-regions of Tabigha, Israel. In our study, the number of effective alleles (Ne) followed the same trend with the Na values, which ranged between 2.75 and 5.50 per locus. The Ne values were higher than those of Arystanbekkyzy et al. [34], who reported an average 1.962 Ne value among 29 wild and 4 cultivated emmer wheat populations collected from different regions of Turkey.
We obtained a Shannon index (I) between 1.030 (Karadag-1/WEST) and 1.692 (Karacadag/EAST). Expected heterozygosity (He) was between 0.561 and 0.725. The I and He values we obtained were significantly higher compared to those of Dong et al. [7] and Fahima et al. [45], while these were in similar ranges compared to those of Fahima et al. [50]. A similar study [36] compared accessions from Israel and Turkey (Diyarbakır region) for genetic diversity using AFLP markers. The He values they reported were much lower compared to those of the current study. Ozbek et al. [88] evaluated a set of accessions (120) from Israel and reported lower He values compared to our results. Here, the Na, Ne, I, He, and uHe values we obtained show the genetic diversity of the natural wild emmer populations in the Karacadağ region.

4.3. PCoA and Neighbor-Joining Analysis

PCoA and neighbor-joining trees followed the same trend (Figure 1 and Figure 2). Both methods separated WEST and EAST populations and did not create any mixture zones. On the other hand, two sub-sets of WEST (1 and 2) were almost entirely mixed and it was not possible to make a distinction between these two. Neighbor-joining dendrograms and PCoA clustering were similar to our previous report with AFLP markers [9], which distributed EAST and WEST populations in two separate clusters. When we looked closely at the neighbor-joining dendrogram for branching and genotype positions (Figure 2), it was seen that most of the individuals from the specific populations were located closely on the same branch, with some exceptions that did not follow any trend.

5. Conclusions

Wild and domesticated emmer wheat are well-characterized and excessively utilized species for crop improvement, especially in biotic stress tolerance. Here, a panel of wild emmer wheat was characterized for agromorphological traits and genetic diversity. According to the genetic diversity values obtained, analyzed through PCoA and neighbor-joining dendrograms, two regional groups with a distance of approximately 200 km had significantly different characteristics in terms of allelic distribution and some phenotypic traits. The screening and utilization of in situ germplasm sources from this region would help widen the genetic diversity in durum and common wheat breeding.

Author Contributions

Conceptualization, E.Ç. and H.Ö.; methodology, E.Ç.; software, E.Ç.; formal analysis, E.Ç. and H.Ö.; investigation, E.Ç.; resources, H.Ö.; data curation, E.Ç. and H.Ö.; writing—original draft preparation, E.Ç. and H.Ö.; writing—review and editing, E.Ç., A.A., H.B. and H.Ö.; visualization, E.Ç.; supervision, H.Ö.; project administration, H.Ö.; funding acquisition, H.Ö. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in this article. Further inquiries can be directed to the corresponding authors.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Maccaferri, M.; Harris, N.S.; Twardziok, S.O.; Pasam, R.K.; Gundlach, H.; Spannagl, M.; Ormanbekova, D.; Lux, T.; Prade, V.M.; Milner, S.G.; et al. Durum wheat genome highlights past domestication signatures and future improvement targets. Nat. Genet. 2019, 51, 885–895. [Google Scholar] [CrossRef] [PubMed]
  2. Snowdon, R.J.; Wittkop, B.; Chen, T.-W.; Stahl, A. Crop adaptation to climate change as a consequence of long-term breeding. Theor. Appl. Genet. 2021, 134, 1613–1623. [Google Scholar] [CrossRef] [PubMed]
  3. Zhou, Y.; Bai, S.; Li, H.; Sun, G.; Zhang, D.; Ma, F.; Zhao, X.; Nie, F.; Li, J.; Chen, L.; et al. Introgressing the Aegilops tauschii genome into wheat as a basis for cereal improvement. Nat. Plants 2021, 7, 774–786. [Google Scholar] [CrossRef] [PubMed]
  4. Varshney, R.K.; Bohra, A.; Roorkiwal, M.; Barmukh, R.; Cowling, W.; Chitikineni, A.; Lam, H.-M.; Hickey, L.T.; Croser, J.; Edwards, D.; et al. Rapid delivery systems for future food security. Nat. Biotechnol. 2021, 39, 1179–1181. [Google Scholar] [CrossRef]
  5. Feng, K.W.; Nie, X.J.; Cui, L.C.; Deng, P.C.; Wang, M.X.; Song, W.N. Genome-Wide Identification and Characterization of Salinity Stress-Responsive miRNAs in Wild Emmer Wheat (Triticum turgidum ssp dicoccoides). Genes 2017, 8, 156. [Google Scholar] [CrossRef]
  6. Peng, J.H.; Sun, D.F.; Nevo, E. Wild emmer wheat, Triticum dicoccoides, occupies a pivotal position in wheat domestication process. Aust. J. Crop Sci. 2011, 5, 1127–1143. [Google Scholar]
  7. Dong, P.; Wei, Y.M.; Chen, G.Y.; Li, W.; Wang, J.R.; Nevo, E.; Zheng, Y.L. Sequence-related amplified polymorphism (SRAP) of wild emmer wheat (Triticum dicoccoides) in Israel and its ecological association. Biochem. Syst. Ecol. 2010, 38, 1–11. [Google Scholar] [CrossRef]
  8. Lack, H.W.; Van Slageren, M. The discovery, typification and rediscovery of wild emmer wheat, Triticum turgidum subsp. dicoccoides (Poaceae). Willdenowia 2020, 50, 207–216. [Google Scholar] [CrossRef]
  9. Ozkan, H.; Willcox, G.; Graner, A.; Salamini, F.; Kilian, B. Geographic distribution and domestication of wild emmer wheat (Triticum dicoccoides). Genet. Resour. Crop Evol. 2011, 58, 11–53. [Google Scholar] [CrossRef]
  10. Kantar, M.; Lucas, S.J.; Budak, H. miRNA expression patterns of Triticum dicoccoides in response to shock drought stress. Planta 2011, 233, 471–484. [Google Scholar] [CrossRef]
  11. Shavrukov, Y.; Langridge, P.; Tester, M.; Nevo, E. Wide genetic diversity of salinity tolerance, sodium exclusion and growth in wild emmer wheat, Triticum dicoccoides. Breed. Sci. 2010, 60, 426–435. [Google Scholar] [CrossRef]
  12. Feng, K.; Cui, L.; Lv, S.; Bian, J.; Wang, M.; Song, W.; Nie, X. Comprehensive evaluating of wild and cultivated emmer wheat (Triticum turgidum L.) genotypes response to salt stress. Plant Growth Regul. 2017, 84, 261–273. [Google Scholar] [CrossRef]
  13. Soresi, D.; Bagnaresi, P.; Crescente, J.M.; Diaz, M.; Cattivelli, L.; Vanzetti, L.; Carrera, A. Genetic Characterization of a Fusarium Head Blight Resistance QTL from Triticum turgidum ssp. dicoccoides. Plant Mol. Biol. Rep. 2020, 39, 710–726. [Google Scholar] [CrossRef]
  14. Soresi, D.; Zappacosta, D.; Garayalde, A.; Irigoyen, I.; Basualdo, J.; Carrera, A. A Valuable QTL for Fusarium Head Blight Resistance from Triticum turgidum L. ssp dicoccoides has a Stable Expression in Durum Wheat Cultivars. Cereal Res. Commun. 2017, 45, 234–247. [Google Scholar] [CrossRef]
  15. Zhang, H.; Zhang, L.; Wang, C.Y.; Wang, Y.J.; Zhou, X.L.; Lv, S.K.; Liu, X.L.; Kang, Z.S.; Ji, W.Q. Molecular mapping and marker development for the Triticum dicoccoides-derived stripe rust resistance gene YrSM139-1B in bread wheat cv. Shaanmai 139. Theor. Appl. Genet. 2016, 129, 369–376. [Google Scholar] [CrossRef]
  16. Sela, H.; Ezrati, S.; Ben-Yehuda, P.; Manisterski, J.; Akhunov, E.; Dvorak, J.; Breiman, A.; Korol, A. Linkage disequilibrium and association analysis of stripe rust resistance in wild emmer wheat (Triticum turgidum ssp. dicoccoides) population in Israel. Theor. Appl. Genet. 2014, 127, 2453–2463. [Google Scholar] [CrossRef]
  17. Toktay, H.; Imren, M.; Elekcioglu, I.H.; Dababat, A.A. Evaluation of Turkish wild Emmers (Triticum dicoccoides Koern.) and wheat varieties for resistance to the root lesion nematodes (Pratylenchus thornei and Pratylenchus neglectus). Turk. Entomoloji Derg.-Turk. J. Entomol. 2015, 39, 219–227. [Google Scholar] [CrossRef]
  18. Saidou, M.; Wang, C.Y.; Alam, M.A.; Chen, C.H.; Ji, W.Q. Genetic Analysis of Powdery Mildew Resistance Gene Using ssr Markers in Common Wheat Originated from Wild Emmer (Triticum dicoccoides Thell). Turk. J. Field Crops 2016, 21, 10–15. [Google Scholar] [CrossRef]
  19. Liang, Y.; Zhang, D.Y.; Ouyang, S.H.; Xie, J.Z.; Wu, Q.H.; Wang, Z.Z.; Cui, Y.; Lu, P.; Zhang, D.; Liu, Z.J.; et al. Dynamic evolution of resistance gene analogs in the orthologous genomic regions of powdery mildew resistance gene MlIW170 in Triticum dicoccoides and Aegilops tauschii. Theor. Appl. Genet. 2015, 128, 1617–1629. [Google Scholar] [CrossRef]
  20. Qiu, L.N.; Liu, N.N.; Wang, H.F.; Shi, X.H.; Li, F.; Zhang, Q.; Wang, W.D.; Guo, W.L.; Hu, Z.R.; Li, H.J.; et al. Fine mapping of a powdery mildew resistance gene MlIW39 derived from wild emmer wheat (Triticum turgidum ssp. dicoccoides). Theor. Appl. Genet. 2021, 134, 2469–2479. [Google Scholar] [CrossRef]
  21. Ouyang, S.H.; Zhang, D.; Han, J.; Zhao, X.J.; Cui, Y.; Song, W.; Huo, N.X.; Liang, Y.; Xie, J.Z.; Wang, Z.Z.; et al. Fine Physical and Genetic Mapping of Powdery Mildew Resistance Gene MlIW172 Originating from Wild Emmer (Triticum dicoccoides). PLoS ONE 2014, 9, e100160. [Google Scholar] [CrossRef] [PubMed]
  22. Xue, F.; Ji, W.Q.; Wang, C.Y.; Zhang, H.; Yang, B.J. High-density mapping and marker development for the powdery mildew resistance gene PmAS846 derived from wild emmer wheat (Triticum turgidum var. dicoccoides). Theor. Appl. Genet. 2012, 124, 1549–1560. [Google Scholar] [CrossRef] [PubMed]
  23. Strejčková, B.; Mazzucotelli, E.; Čegan, R.; Milec, Z.; Brus, J.; Çakır, E.; Mastrangelo, A.M.; Özkan, H.; Šafář, J. Wild emmer wheat, the progenitor of modern bread wheat, exhibits great diversity in the VERNALIZATION1 gene. Front. Plant Sci. 2023, 13, 1106164. [Google Scholar] [CrossRef] [PubMed]
  24. Suneja, Y.; Gupta, A.K.; Bains, N.S. Stress Adaptive Plasticity: Aegilops tauschii and Triticum dicoccoides as Potential Donors of Drought Associated Morpho-Physiological Traits in Wheat. Front. Plant Sci. 2019, 10, 211. [Google Scholar] [CrossRef]
  25. Zhang, Y.J.; Hu, X.; Islam, S.; She, M.Y.; Peng, Y.C.; Yu, Z.T.; Wylie, S.; Juhasz, A.; Dowla, M.; Yang, R.C.; et al. New insights into the evolution of wheat avenin-like proteins in wild emmer wheat (Triticum dicoccoides). Proc. Natl. Acad. Sci. USA 2018, 115, 13312–13317. [Google Scholar] [CrossRef]
  26. Tene, M.; Adhikari, E.; Cobo, N.; Jordan, K.W.; Matny, O.; del Blanco, I.A.; Roter, J.; Ezrati, S.; Govta, L.; Manisterski, J.; et al. GWAS for Stripe Rust Resistance in Wild Emmer Wheat (Triticum dicoccoides) Population: Obstacles and Solutions. Crops 2022, 2, 42–61. [Google Scholar] [CrossRef]
  27. Kilian, B.; Dempewolf, H.; Guarino, L.; Werner, P.; Coyne, C.; Warburton, M.L. Crop Science special issue: Adapting agriculture to climate change: A walk on the wild side. Crop Sci. 2021, 61, 32–36. [Google Scholar] [CrossRef]
  28. Bellil, I.; Hamdi, O.; Benbelkacem, A.; Khelifi, D. The Genetic Potential of a Germplasm of Interspecific Crosses between Durum Wheats (Triticum turgidum L. ssp. durum (Desf.) Husn.) and their Relatives (T. dicoccum Schubl. and T. polonicum L.) in Five Glutenin Loci. Cereal Res. Commun. 2019, 47, 678–688. [Google Scholar] [CrossRef]
  29. Rasheed, A.; Mujeeb-Kazi, A.; Ogbonnaya, F.C.; He, Z.; Rajaram, S. Wheat genetic resources in the post-genomics era: Promise and challenges. Ann. Bot. 2017, 121, 603–616. [Google Scholar] [CrossRef]
  30. Mujeeb-Kazi, A.; Kazi, A.G.; Dundas, I.; Rasheed, A.; Ogbonnaya, F.; Kishii, M.; Bonnett, D.; Wang, R.R.C.; Xu, S.; Chen, P.; et al. Chapter Four—Genetic Diversity for Wheat Improvement as a Conduit to Food Security. In Advances in Agronomy; Sparks, D.L., Ed.; Academic Press: Cambridge, MA, USA, 2013; Volume 122, pp. 179–257. [Google Scholar]
  31. Nevo, E.; Golenberg, E.; Beiles, A.; Brown, A.H.D.; Zohary, D. Genetic Diversity and Environmental Associations of Wild Wheat, Triticum-Dicoccoides, in Israel. Theor. Appl. Genet. 1982, 62, 241–254. [Google Scholar] [CrossRef]
  32. Poyarkova, H.; Gerechteramitai, Z.K.; Genizi, A. 2 Variants of Wild Emmer (Triticum dicoccoides) Native to Israel—Morphology and Distribution. Can. J. Bot. 1991, 69, 2772–2789. [Google Scholar] [CrossRef]
  33. Chandrasekhar, K.; Nashef, K.; Ben-David, R. Agronomic and genetic characterization of wild emmer wheat (Triticum turgidum subsp. dicoccoides) introgression lines in a bread wheat genetic background. Genet. Resour. Crop Evol. 2017, 64, 1917–1926. [Google Scholar] [CrossRef]
  34. Arystanbekkyzy, M.; Nadeem, M.A.; Aktas, H.; Yeken, M.Z.; Zencirci, N.; Nawaz, M.A.; Ali, F.; Haider, M.S.; Tunc, K.; Chung, G.; et al. Phylogenetic and Taxonomic Relationship of Turkish Wild and Cultivated Emmer (Triticum turgidum ssp. dicoccoides) Revealed by iPBS-Retrotransposons Markers. Int. J. Agric. Biol. 2019, 21, 155–163. [Google Scholar] [CrossRef]
  35. Shizuka, T.; Mori, N.; Ozkan, H.; Ohta, S. Chloroplast DNA haplotype variation within two natural populations of wild emmer wheat (Triticum turgidum ssp. dicoccoides) in southern Turkey. Biotechnol. Biotechnol. Equip. 2015, 29, 423–430. [Google Scholar] [CrossRef]
  36. Ozbek, O.; Millet, E.; Anikster, Y.; Arslan, O.; Feldman, M. Comparison of the genetic structure of populations of wild emmer wheat, Triticum turgidum ssp dicoccoides, from Israel and Turkey revealed by AFLP analysis. Genet. Resour. Crop Evol. 2007, 54, 1587–1598. [Google Scholar] [CrossRef]
  37. Gerechteramitai, Z.K.; Sharp, E.L.; Reinhold, M. Temperature Sensitive Genes for Stripe Rust Resistance in Triticum-Dicoccoides Indigenous to Israel. Phytopathology 1981, 71, 218. [Google Scholar]
  38. Gerechteramitai, Z.K.; Vansilfhout, C.H.; Grama, A.; Kleitman, F. YR15—A New Gene for Resistance to Puccinia-Striiformis in Triticum dicoccoides sel. G-25. Euphytica 1989, 43, 187–190. [Google Scholar] [CrossRef]
  39. Nevo, E.; Beiles, A.; Gutterman, Y.; Storch, N.; Kaplan, D. Genetic-Resources of Wild Cereals in Israel and Vicinity. I. Phenotypic Variation Within and Between Populations of Wild Wheat, Triticum dicoccoides. Euphytica 1984, 33, 717–735. [Google Scholar] [CrossRef]
  40. Silfhout, C.H.; Grama, A.; Gerechter-Amitai, Z.K.; Kleitman, F. Resistance to yellow rust in Triticum dicoccoides. I. Crosses with susceptible Triticum durum. Neth. J. Plant Pathol. 1989, 95, 73–78. [Google Scholar] [CrossRef]
  41. Poyarkova, H. Morphology, Geography and Infraspecific Taxonomics of Triticum dicoccoides Korn—A Retrospective of 80 Years of Research. Euphytica 1988, 38, 11–23. [Google Scholar] [CrossRef]
  42. Nevo, E.; Krugman, T.; Beiles, A. Genetic-Resources for Salt Tolerance in the Wild Progenitors of Wheat (Triticum dicoccoides) and Barley (Hordeum spontaneum) in Israel. Plant Breed. 1993, 110, 338–341. [Google Scholar] [CrossRef]
  43. Kato, K.; Mori, Y.; Beiles, A.; Nevo, E. Geographical variation in heading traits in wild emmer wheat, Triticum dicoccoides. I. Variation in vernalization response and ecological differentiation. Theor. Appl. Genet. 1997, 95, 546–552. [Google Scholar] [CrossRef]
  44. Kato, K.; Tanizoe, C.; Beiles, A.; Nevo, E. Geographical variation in heading traits in wild emmer wheat, Triticum dicoccoides. II. Variation in heading date and adaptation to diverse eco-geographical conditions. Hereditas 1998, 128, 33–39. [Google Scholar] [CrossRef]
  45. Fahima, T.; Sun, G.L.; Beharav, A.; Krugman, T.; Beiles, A.; Nevo, E. RAPD polymorphism of wild emmer wheat populations, Triticum dicoccoides, in Israel. Theor. Appl. Genet. 1999, 98, 434–447. [Google Scholar] [CrossRef]
  46. Belyayev, A.; Raskina, O.; Korol, A.; Nevo, E. Coevolution of A and B genomes in allotetraploid Triticum dicoccoides. Genome 2000, 43, 1021–1026. [Google Scholar] [CrossRef]
  47. Li, Y.C.; Fahima, T.; Peng, J.H.; Roder, M.S.; Kirzhner, V.M.; Beiles, A.; Korol, A.B.; Nevo, E. Edaphic microsatellite DNA divergence in wild emmer wheat, Triticum dicoccoides, at a microsite: Tabigha, Israel. Theor. Appl. Genet. 2000, 101, 1029–1038. [Google Scholar] [CrossRef]
  48. Peng, J.H.; Fahima, T.; Roder, M.S.; Huang, Q.Y.; Dahan, A.; Li, Y.C.; Grama, A.; Nevo, E. High-density molecular map of chromosome region harboring stripe-rust resistance genes YrH52 and Yr15 derived from wild emmer wheat, Triticum dicoccoides. Genetica 2000, 109, 199–210. [Google Scholar] [CrossRef]
  49. Li, Y.C.; Krugman, T.; Fahima, T.; Beiles, A.; Korol, A.B.; Nevo, E. Spatiotemporal allozyme divergence caused by aridity stress in a natural population of wild wheat, Triticum dicoccoides, at the Ammiad microsite, Israel. Theor. Appl. Genet. 2001, 102, 853–864. [Google Scholar] [CrossRef]
  50. Fahima, T.; Roder, M.S.; Wendehake, K.; Kirzhner, V.M.; Nevo, E. Microsatellite polymorphism in natural populations of wild emmer wheat, Triticum dicoccoides, in Israel. Theor. Appl. Genet. 2002, 104, 17–29. [Google Scholar] [CrossRef]
  51. Li, Y.C.; Roder, M.S.; Fahima, T.; Kirzhner, V.M.; Beiles, A.; Korol, A.B.; Nevo, E. Climatic effects on microsatellite diversity in wild emmer wheat (Triticum dicoccoides) at the Yehudiyya microsite, Israel. Heredity 2002, 89, 127–132. [Google Scholar] [CrossRef]
  52. Buerstmayr, H.; Stierschneider, M.; Steiner, B.; Lemmens, M.; Griesser, M.; Nevo, E.; Fahima, T. Variation for resistance to head blight caused by Fusarium graminearum in wild emmer (Triticum dicoccoides) originating from Israel. Euphytica 2003, 130, 17–23. [Google Scholar] [CrossRef]
  53. Li, Y.C.; Fahima, T.; Roder, M.S.; Kirzhner, V.M.; Beiles, A.; Korol, A.B.; Nevo, E. Genetic effects on microsatellite diversity in wild emmer wheat (Triticum dicoccoides) at the Yehudiyya microsite, Israel. Heredity 2003, 90, 150–156. [Google Scholar] [CrossRef]
  54. Xu, S.S.; Khan, K.; Klindworth, D.L.; Faris, J.D.; Nygard, G. Chromosomal location of genes for novel glutenin subunits and gliadins in wild emmer wheat (Triticum turgidum L. var. dicoccoides). Theor. Appl. Genet. 2004, 108, 1221–1228. [Google Scholar] [CrossRef]
  55. Anikster, Y.; Manisterski, J.; Long, D.L.; Leonard, K.J. Leaf rust and stem rust resistance in Triticum dicoccoides populations in Israel. Plant Dis. 2005, 89, 55–62. [Google Scholar] [CrossRef]
  56. Syouf, M.; Abu-Irmaileh, B.E.; Valkoun, J.; Bdour, S. Introgression from durum wheat landraces in wild emmer wheat (Triticum dicoccoides (Korn. ex Asch et Graebner) Schweinf). Genet. Resour. Crop Evol. 2006, 53, 1165–1172. [Google Scholar] [CrossRef]
  57. Hua, W.; Liu, Z.J.; Zhu, J.; Xie, C.J.; Yang, T.M.; Zhou, Y.L.; Duan, X.Y.; Sun, Q.X.; Liu, Z.Y. Identification and genetic mapping of pm42, a new recessive wheat powdery mildew resistance gene derived from wild emmer (Triticum turgidum var. dicoccoides). Theor. Appl. Genet. 2009, 119, 223–230. [Google Scholar] [CrossRef]
  58. Liu, Z.J.; Zhu, J.; Cui, Y.; Liang, Y.; Wu, H.B.; Song, W.; Liu, Q.; Yang, T.M.; Sun, Q.X.; Liu, Z.Y. Identification and comparative mapping of a powdery mildew resistance gene derived from wild emmer (Triticum turgidum var. dicoccoides) on chromosome 2BS. Theor. Appl. Genet. 2012, 124, 1041–1049. [Google Scholar] [CrossRef]
  59. Domb, K.; Keidar, D.; Yaakov, B.; Khasdan, V.; Kashkush, K. Transposable elements generate population-specific insertional patterns and allelic variation in genes of wild emmer wheat (Triticum turgidum ssp dicoccoides). BMC Plant Biol. 2017, 17, 175. [Google Scholar] [CrossRef]
  60. Vuorinen, A.L.; Kalendar, R.; Fahima, T.; Korpelainen, H.; Nevo, E.; Schulman, A.H. Retrotransposon-Based Genetic Diversity Assessment in Wild Emmer Wheat (Triticum turgidum ssp. dicoccoides). Agronomy 2018, 8, 107. [Google Scholar] [CrossRef]
  61. Salamini, F.; Ozkan, H.; Brandolini, A.; Schafer-Pregl, R.; Martin, W. Genetics and geography of wild cereal domestication in the near east. Nat. Rev. Genet. 2002, 3, 429–441. [Google Scholar] [CrossRef]
  62. Doyle, J.J.; Doyle, J.L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 1987, 19, 11–15. [Google Scholar]
  63. Ozkan, H.; Kafkas, S.; Sertac Ozer, M.; Brandolini, A. Genetic relationships among South-East Turkey wild barley populations and sampling strategies of Hordeum spontaneum. Theor. Appl. Genet. 2005, 112, 12–20. [Google Scholar] [CrossRef] [PubMed]
  64. Schuelke, M. An economic method for the fluorescent labeling of PCR fragments. Nat. Biotechnol. 2000, 18, 233–234. [Google Scholar] [CrossRef] [PubMed]
  65. Peakall, R.; Smouse, P.E. GENALEX 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2006, 6, 288–295. [Google Scholar] [CrossRef]
  66. Godfray, H.C.J.; Beddington, J.R.; Crute, I.R.; Haddad, L.; Lawrence, D.; Muir, J.F.; Pretty, J.; Robinson, S.; Thomas, S.M.; Toulmin, C. Food Security: The Challenge of Feeding 9 Billion People. Science 2010, 327, 812–818. [Google Scholar] [CrossRef]
  67. Gonzalez-Paleo, L.; Ravetta, D.A. Allocation patterns and phenology in wild and selected accessions of annual and perennial Physaria (Lesquerella, Brassicaceae). Euphytica 2012, 186, 289–302. [Google Scholar] [CrossRef]
  68. Feuillet, C.; Langridge, P.; Waugh, R. Cereal breeding takes a walk on the wild side. Trends Genet. 2007, 24, 24–32. [Google Scholar] [CrossRef]
  69. Ortiz, R.; Sayre, K.D.; Govaerts, B.; Gupta, R.; Subbarao, G.V.; Ban, T.; Hodson, D.; Dixon, J.A.; Ortiz-Monasterio, J.I.; Reynolds, M. Climate change: Can wheat beat the heat? Agric. Ecosyst. Environ. 2008, 126, 46–58. [Google Scholar] [CrossRef]
  70. El Haddad, N.; Kabbaj, H.; Zaïm, M.; El Hassouni, K.; Tidiane Sall, A.; Azouz, M.; Ortiz, R.; Baum, M.; Amri, A.; Gamba, F.; et al. Crop wild relatives in durum wheat breeding: Drift or thrift? Crop Sci. 2021, 61, 37–54. [Google Scholar] [CrossRef]
  71. Castaneda-Alvarez, N.P.; Khoury, C.K.; Achicanoy, H.A.; Bernau, V.; Dempewolf, H.; Eastwood, R.J.; Guarino, L.; Harker, R.H.; Jarvis, A.; Maxted, N.; et al. Global conservation priorities for crop wild relatives. Nat. Plants 2016, 2, 16022. [Google Scholar] [CrossRef]
  72. Harlan, J.R.; Wet, J.M.J. Toward a Rational Classification of Cultivated Plants. Taxon 1971, 20, 509–517. [Google Scholar] [CrossRef]
  73. Chhuneja, P.; Arora, J.K.; Kaur, P.; Kaur, S.; Singh, K. Characterization of wild emmer wheat Triticum dicoccoides germplasm for vernalization alleles. J. Plant Biochem. Biotechnol. 2015, 24, 249–253. [Google Scholar] [CrossRef]
  74. Peng, J.H.; Sun, D.; Nevo, E. Domestication evolution, genetics and genomics in wheat. Mol. Breed. 2011, 28, 281–301. [Google Scholar] [CrossRef]
  75. Nevo, E. Genetic resources of wild emmer, Triticum dicoccoides, for wheat improvement in the third millennium. Isr. J. Plant Sci. 2001, 49, S77–S91. [Google Scholar] [CrossRef]
  76. Schmidt, K. Göbekli Tepe; Arkeoloji ve Sanat Yayınları: Istanbul, Turkey, 2007. [Google Scholar]
  77. Dietrich, O.; Heun, M.; Notroff, J.; Schmidt, K.; Zarnkow, M. The role of cult and feasting in the emergence of Neolithic communities. New evidence from Göbekli Tepe, south-eastern Turkey. Antiquity 2012, 86, 674–695. [Google Scholar] [CrossRef]
  78. Jorgensen, C.; Luo, M.-C.; Ramasamy, R.; Dawson, M.; Gill, B.S.; Korol, A.B.; Distelfeld, A.; Dvorak, J. A High-Density Genetic Map of Wild Emmer Wheat from the Karaca Dağ Region Provides New Evidence on the Structure and Evolution of Wheat Chromosomes. Front. Plant Sci. 2017, 8, 1798. [Google Scholar] [CrossRef]
  79. Zhang, D.Y.; Zhu, K.Y.; Dong, L.L.; Liang, Y.; Li, G.Q.; Fang, T.L.; Guo, G.H.; Wu, Q.H.; Xie, J.Z.; Chen, Y.X.; et al. Wheat powdery mildew resistance gene Pm64 derived from wild emmer (Triticum turgidum var. dicoccoides) is tightly linked in repulsion with stripe rust resistance gene Yr5. Crop J. 2019, 7, 761–770. [Google Scholar] [CrossRef]
  80. Ahmadi, H.; Nazarian, F. The inheritance and chromosomal location of morphological traits in wild wheat, Triticum turgidum L. ssp. dicoccoides. Euphytica 2007, 158, 103–108. [Google Scholar] [CrossRef]
  81. Rawale, K.S.; Khan, M.A.; Gill, K.S. The novel function of the Ph1 gene to differentiate homologs from homoeologs evolved in Triticum turgidum ssp. dicoccoides via a dramatic meiosis-specific increase in the expression of the 5B copy of the C-Ph1 gene. Chromosoma 2019, 128, 561–570. [Google Scholar] [CrossRef]
  82. Negisho, K.; Shibru, S.; Pillen, K.; Ordon, F.; Wehner, G. Genetic diversity of Ethiopian durum wheat landraces. PLoS ONE 2021, 16, e0247016. [Google Scholar] [CrossRef]
  83. Teklu, Y.; Hammer, K.; Röder, M.S. Simple sequence repeats marker polymorphism in emmer wheat (Triticum dicoccon Schrank): Analysis of genetic diversity and differentiation. Genet. Resour. Crop Evol. 2007, 54, 543–554. [Google Scholar] [CrossRef]
  84. Harlan, J.R.; Zohary, D. Distribution of wild wheats and barley. Science 1966, 153, 1074–1080. [Google Scholar] [CrossRef] [PubMed]
  85. Zohary, D.; Hopf, M. Domestication of Plants in the Old World: The Origin and Spread of Cultivated Plants in West Asia, Europe and the Nile Valley; Oxford University Press: Oxford, UK, 2000. [Google Scholar]
  86. Hegde, S.G.; Valkoun, J.; Waines, J.G. Genetic diversity in wild wheats and goat grass. Theor. Appl. Genet. 2000, 101, 309–316. [Google Scholar] [CrossRef]
  87. Lu, H.; Bernardo, R. Molecular marker diversity among current and historical maize inbreds. Theor. Appl. Genet. 2001, 103, 613–617. [Google Scholar] [CrossRef]
  88. Ozbek, O.; Millet, E.; Anikster, Y.; Arslan, O.; Feldman, M. Spatio-temporal genetic variation in populations of wild emmer wheat, Triticum turgidum ssp dicoccoides, as revealed by AFLP analysis. Theor. Appl. Genet. 2007, 115, 19–26. [Google Scholar] [CrossRef]
Life 15 00203 g001
Figure 1. PCoA clustering of 38 Triticum turgidum ssp. dicoccoides populations collected from the Karacadağ region of Southeast Anatolia, central Fertile Crescent. Populations were Karacadag/EAST, Karadag-1/WEST, and Karadag-2/WEST.
Figure 1. PCoA clustering of 38 Triticum turgidum ssp. dicoccoides populations collected from the Karacadağ region of Southeast Anatolia, central Fertile Crescent. Populations were Karacadag/EAST, Karadag-1/WEST, and Karadag-2/WEST.
Life 15 00203 g001
Life 15 00203 g002
Figure 2. Neighbor-joining analysis was performed on 38 Triticum turgidum ssp. dicoccoides populations, comprising 169 accessions collected from Southeast Anatolia, within the central Fertile Crescent. The image uses different colors to represent these populations: black for Karacadag/EAST, green for Karadag-1/WEST, and blue for Karadag-2/WEST.
Figure 2. Neighbor-joining analysis was performed on 38 Triticum turgidum ssp. dicoccoides populations, comprising 169 accessions collected from Southeast Anatolia, within the central Fertile Crescent. The image uses different colors to represent these populations: black for Karacadag/EAST, green for Karadag-1/WEST, and blue for Karadag-2/WEST.
Life 15 00203 g002
Table 1. Collection site information about 38 wild emmer wheat (Triticum turgidum ssp. dicoccoides) populations.
Table 1. Collection site information about 38 wild emmer wheat (Triticum turgidum ssp. dicoccoides) populations.
Collection NoCollection LocalityZoneAltitude (m)Latitude (°N)Longitude (°E)
124.5 km SW from Diyarbakır to OvadagEast178037°47′38″40°12′14″
212.9 km NW from Ovadag to PirinçlikEast1100737°47′31″39°57′18″
318.5 km NW from Ovadag to PirinçlikEast192037°49′17″39°59′34″
420.1 km SW from PirinçlikEast1108037°52′02″39°51′05″
520 km SW from PirinçlikEast1126037°50′40″39°47′58″
62.9 km NE from Karabahçe to PirinçlikEast1130037°49′12″39°46′29″
741.2 km SW from PirinçlikEast1125037°46′42″39°44′50″
86.3 km N from Karabahçe (42.9 km W from Diyarbakır to Siverek)East1107037°50′21″39°43′23″
94.6 km SW from KarabahçeEast1118037°46′19″39°44′03″
1017.9 km SW from KarabahçeEast1116037°44′29″39°42′50″
1121.7 km SW from KarabahçeEast1123537°42′51″39°44′03″
1237.9 km SW from KarabahçeEast1117037°39′49″39°42′49″
1337.9 km SW from KarabahçeEast1118037°36′27″39°43′41″
1441.6 km SW from KarabahçeEast1117037°35′08″39°44′36″
1548.7 km SW from KarabahçeEast1103037°33′09″39°42′06″
1627.6 km SW from Karacadag (69.6 km SW from Karabahçe)East195037°37′40″39°33′40″
1730.2 km SW from Çermik to SiverekEast180038°00′56″39°22′11″
18Siverek Karakeçi Road Azemi VillageEast173337°36′51″39°20′12″
19Karakeçi roadEast173737°33′27″39°20′35″
20Karakeçi grasslandEast175837°32′22″39°21′52″
215 km from Siverek to Siverek Hilvan RoadEast164537°42′23″39°16′34″
2272 km SE from Turkoglu SE (W of Karadag)West1800(853)37°19′46″37°16′29″
2372 km SE from Turkoglu SE (W of Karadag)West1800(853)37°19′46″37°16′29″
2434 km ESE from Narlı (WSW of Karadag)West1840 (877)37°18′53″37°15′41″
2534 km ESE from Narlı (WSW of Karadag)West1780 (813)37°20′12″37°17′53″
2639 km ESE from Narlı (SW of Karadag)West1760 (793)37°17′06″37°17′39″
2739 km ESE from Narlı (SW of Karadag)West1760 (793)37°17′06″37°17′39″
28Between Kahramanmaraş Kelleş village and Yiğitce villageWest179137°20′25″37°17′54″
29Between Gaziantep Tekirsin village and Dundarlı villageWest188237°15′20″37°23′26″
3037 km NE from Kilis to GaziantepWest283037°20′19″37°16′50″
3139 km NE from Kilis to GaziantepWest292037°19′50″37°18′51″
3241 km NE from Kilis to GaziantepWest277037°24′23″37°25′47″
3342 km NE from Kilis to GaziantepWest275037°24′58″37°24′50″
3458 km NE from Kilis to GaziantepWest272037°16′01″37°30′52″
3559 km NE from Kilis to GaziantepWest277037°15′33″37°29′03″
3621 km NE from Kilis to GaziantepWest262036°45′52″37°15′04″
3724 km NE from Kilis to GaziantepWest270036°52′20″37°12′12″
3825 km NE from Kilis to GaziantepWest283036°33′25″37°11′57″
Table 2. List of SSR primers used in this study with respective repeat motifs and chromosome locations.
Table 2. List of SSR primers used in this study with respective repeat motifs and chromosome locations.
NameChMotifForward Primer SequenceReverse Primer Sequence
cfa22191A(GT)21TCTGCCGAGTCACTTCATTGGACAAGGCCAGTCCAAAAGA
wmc3121A(GA)10TGTGCCCGCTGGTGCGAAGCCGACGCAGGTGAGCGAAG
wmc6582A----CTCATCGTCCTCCTCCACTTTGGCCATCCGTTGACTTGAGGTTA
wmc3134A(CA)18GCAGTCTAATTATCTGCTGGCGGGGTCCTTGTCTACTCATGTCT
wmc1105A(GT)11GCAGATGAGTTGAGTTGGATTGGTACTTGGAAACTGTGTTTGGG
cfa21905A(TC)31CAGTCTGCAATCCACTTTGCAAAAGGAAACTAAAGCGATGGA
wmc6261B----AGCCCATAAACATCCAACACGGAGGTGGGCTTGGTTACGCTCTC
gwm4981B----GGTGGTATGGACTATGGACACTGGTGGTATGGACTATGGACACT
wmc1281B(GA)10CGGACAGCTACTGCTCTCCTTACTGTTGCTTGCTCTGCACCCTT
wmc1492B(CT)24ACAGACTTGGTTGGTGCCGAGCATGGGCGGGGGTGTAGAGTTTG
wmc3322B(CT)12CATTTACAAAGCGCATGAAGCCGAAAACTTTGGGAACAAGAGCA
gwm3355B---CGTACTCCACTCCACACGG CGGTCCAAGTGCTACCTTTC
gwm6306B(GT)16GTGCCTGTGCCATCGTCCGAAAGTAACAGCGCAGTGA
gwm1467B---CCAAAAAAACTGCCTGCATGCTCTGGCATTGCTCCTTGG
wmc767B(GT)19CTTCAGAGCCTCTTTCTCTACACTGCTTCACTTGCTGATCTTTG
gwm3337B(GA)19GCCCGGTCATGTAAAACGTTTCAGTTTGCGTTAAGCTTTG
Table 3. Results of analysis of variance on studied traits.
Table 3. Results of analysis of variance on studied traits.
TraitsSum of SquaresMean Square
Plant height990.53 495.269 *
Heading date750.785 375.393 ***
Peduncle length1155.930 577.695 ***
Flag leaf area262.141 131.071 ****
Auriculas length0.927 0.463 ns
Auriculas width2444.0 1222.0 ns
Spike length5387.0 2694.0 *
Spike number137.496 68.748 ****
Length of the uppermost awn in the spikelet822.418 411.209 ns
Awn length in the fourth flower1474.411 737.205 ns
Length of the lowermost awn in the spikelet1236.780 618.390 ns
Spikelet length13.883 6941.0 *
Spikelet width2467.0 1233.0 ns
Lemma length18.152 9076.0 **
Lemma width0.2630.132 ns
Palea length7100.03550.0 *
Palea width0.2390.119 ns
Glume length 7473.0 3736.0 *
Glume hull thickness 6745.0 3373.0 *
Glume height 0.481 0.240 ns
Anther length 4556.0 2278.0 ****
Anther width 0.068 0.034 *
Maturation 673.340 366.670 *
****, ***, **, * Significantly different at the p < 0.0001, p < 0.001, p < 0.01, and p < 0.05 levels, respectively. n.s. = not significant.
Table 4. Mean values of agromorphological traits of wild emmer wheat (Triticum turgidum ssp. dicoccoides) genotypes sampled from three different sub-regions of Southeast Anatolia.
Table 4. Mean values of agromorphological traits of wild emmer wheat (Triticum turgidum ssp. dicoccoides) genotypes sampled from three different sub-regions of Southeast Anatolia.
TraitsWhole CollectionsKaracadag/EASTKaradag-1/WESTKaradag-2/WEST
Plant height (cm)126.95 ±18.45126.35 ± 19.68127.64 ± 16.27128.31 ± 16.28
Heading date (day)166.06 ± 8.36164.37 ± 9.12170.38 ± 7.08167.49 ± 4.58
Peduncle length(cm)38.95 ± 6.8539.17 ± 6.8335.09 ± 7.0941.48 ± 5.26
Flag leaf area (cm2)16.38 ± 6.1815.66 ± 6.3317.76 ± 5.7617.55 ± 4.65
Auriculas length (mm)4.52 ± 0.644.50 ± 0.684.45 ± 0.394.65 ± 0.65
Auriculas width(mm)5.42 ± 0.905.43 ± 0.885.68 ± 0.875.19 ± 0.91
Spike length (cm)9.18 ± 1.169.28 ± 1.239.11 ± 0.918.91 ± 1.08
Spikelet number20.02 ± 2.4920.69 ± 2.6218.89 ± 1.7518.80 ± 1.67
Length of the uppermost awn in the spikelet (mm) 76.37 ± 18.8474.91 ± 19.5680.76 ± 15.7877.40 ± 18.71
Awn length in the fourth flower(mm)95.97 ± 19.7393.68 ± 20.45100.23 ± 17.3498.85 ± 18.51
Length of the lowermost awn in the spikelet (mm)59.49 ± 22.2156.35 ± 22.7268.41 ± 18.7562.11 ± 21.37
Spikelet length (mm)15.72 ± 1.4415.50 ± 1.4716.13 ± 1.4916.07 ± 1.17
Spikelet width (mm)4.67 ± 0.824.74 ± 0.864.38 ± 0.684.71 ± 0.72
Lemma length (mm)13.46 ± 1.6613.26 ± 1.8713.95 ± 1.3013.71 ± 0.91
Lemma width (mm)2.53 ± 0.352.50 ± 0.352.51 ± 0.352.62 ± 0.37
Palea length (mm)12.49 ± 1.1212.32 ± 1.1912.88 ± 1.0212.70 ± 0.86
Palea width (mm)1.81 ± 0.511.77 ± 0.261.73 ± 0.262.03 ± 1.01
Glume length (mm)12.27 ± 1.1212.09 ± 1.1412.59 ± 1.0412.61 ± 1.04
Glume hull thickness (mm)0.24 ± 0.090.26 ± 0.090.22 ± 0.090.20 ± 0.06
Glume height (mm)2.45 ± 0.352.43 ± 0.332.45 ± 0.352.55 ± 0.40
Anther length (mm)3.73 ± 0.503.62 ± 0.503.80 ± 0.434.10 ± 0.42
Anther width (mm)0.58 ± 0.100.59 ± 0.100.53 ± 0.090.58 ± 0.11
Maturation (day)198.12 ± 4.5697.18 ± 4.97199.48 ± 4.03199.86 ± 2.48
Table 5. Analysis of molecular variance (AMOVA) summary for the variation within and between populations of Triticum turgidum ssp. dicoccoides.
Table 5. Analysis of molecular variance (AMOVA) summary for the variation within and between populations of Triticum turgidum ssp. dicoccoides.
SourcedfSSMSEst. Var.%
Among Pops2 439.551 219.776 4.429 16
Within Pops166 3803.206 22.911 22.911 84
Total168 4242.757 27.340 100
Table 6. Nei genetic distance (above diagonal) and Nei identity (below diagonal) values among 38 Triticum turgidum ssp. dicoccoides populations.
Table 6. Nei genetic distance (above diagonal) and Nei identity (below diagonal) values among 38 Triticum turgidum ssp. dicoccoides populations.
PopulationKaracadag/EASTKaradag-1/WESTKaradag-2/WEST
Karacadag/EAST---0.5180.539
Karadag-1/WEST0.484---0.214
Karadag-2/WEST0.4630.788---
Table 7. Summary statistics of genetic variation among three different regions, Karacadag/EAST, Karadag-1/WEST, and Karadag-2/WEST. The number of alleles per locus (Na), number of effective alleles per locus (Ne), Shannon’s information index (I), expected heterozygosity (He), and unbiased heterozygosity (uHe) of 38 Triticum turgidum ssp. dicoccoides populations.
Table 7. Summary statistics of genetic variation among three different regions, Karacadag/EAST, Karadag-1/WEST, and Karadag-2/WEST. The number of alleles per locus (Na), number of effective alleles per locus (Ne), Shannon’s information index (I), expected heterozygosity (He), and unbiased heterozygosity (uHe) of 38 Triticum turgidum ssp. dicoccoides populations.
PopsNNaNeIHeuHe
Karacadag/EAST1089.938 ± 1.8715.470 ± 0.8691.692 ± 0.1770.725 ± 0.0460.729± 0.046
Karadag-1/WEST283.938 ± 0.4702.747 ± 0.3081.030 ± 0.1180.561 ± 0.0510.572 ± 0.052
Karadag-2/WEST336.125 ± 0.8614.135 ± 0.6441.348 ± 0.1810.621 ± 0.0700.632 ± 0.071
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Çakır, E.; Alsaleh, A.; Bektas, H.; Özkan, H. Wild Emmer (Triticum turgidum ssp. dicoccoides) Diversity in Southern Turkey: Evaluation of SSR and Morphological Variations. Life 2025, 15, 203. https://doi.org/10.3390/life15020203

AMA Style

Çakır E, Alsaleh A, Bektas H, Özkan H. Wild Emmer (Triticum turgidum ssp. dicoccoides) Diversity in Southern Turkey: Evaluation of SSR and Morphological Variations. Life. 2025; 15(2):203. https://doi.org/10.3390/life15020203

Chicago/Turabian Style

Çakır, Esra, Ahmad Alsaleh, Harun Bektas, and Hakan Özkan. 2025. "Wild Emmer (Triticum turgidum ssp. dicoccoides) Diversity in Southern Turkey: Evaluation of SSR and Morphological Variations" Life 15, no. 2: 203. https://doi.org/10.3390/life15020203

APA Style

Çakır, E., Alsaleh, A., Bektas, H., & Özkan, H. (2025). Wild Emmer (Triticum turgidum ssp. dicoccoides) Diversity in Southern Turkey: Evaluation of SSR and Morphological Variations. Life, 15(2), 203. https://doi.org/10.3390/life15020203

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop