Selection and Effect of Plant Growth-Promoting Bacteria on Pine Seedlings (Pinus montezumae and Pinus patula)
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacterial Strains
2.2. Characterization of the Isolated Bacteria Based on Their Mechanisms of Action
2.2.1. Indole Acetic Acid Production and Biosynthetic Pathway
2.2.2. Quantitative Testing of Phosphate Solubilization
2.2.3. Acetylene Reduction Assay (ARA)
2.2.4. Siderophore Production
2.2.5. Amplification of ACC Deaminase and Some Antimicrobial Compounds’ Genes
| Gene | Primer | Primer Sequence | Melting Temp (°C) | Putative Gene Function | Amplicon Size (bp) | Reference |
|---|---|---|---|---|---|---|
| prnD | PRND1 | GGGCGGGCCGTGGTGAT | 65 | Pyrrolnitrin biosynthesis enzyme | 786 | [65] |
| PRND2 | GGACGCSGCCTGYCTGGTCTG | |||||
| phlD | B2BF | ACCCACCGCGCATCGTTTATGAGC | 66.5 | Polyketide synthase III immediate precursor to 2,4-diacetylphloroglucinol | 629 | [64] |
| BPR4 | CCGCCGGTATGGAAGATGAAAAAGTC | |||||
| phzF | Ps_up 1 | ATCTTCACCCCGGTCAACG | 57 | Phenazine biosynthesis enzyme | 427 | [67] |
| Ps_low 1 | CCRTAGGCCGGTGAGAAC | |||||
| pltC | PLTC1 | AACGATCGCCCCGGTACAGAACG | 58 | Polyketide synthase I (Pyoluteorines) | 438 | [65] |
| PLTC2 | AGGCCCGGACACTCAAGAAACTCG | |||||
| acdS | F1936f | GCTCCTACTCTGTCACCTATCGHGAMGACTGCAAYWSYGGC | 50 | Gene encoding ACC deaminase | 792 | [68] |
| F1938r | CTGTCGCTCTGGCTGTCACATVCCVTGCATBGAYTT |
2.3. Phylogenetic Analysis
2.4. Selection of Bacterial Strains for Bioassay and Preliminary Screening
2.5. Adherence Assay
2.6. Speed Germination Assay
2.7. Seedlings Inoculation
3. Results
3.1. Isolation of Bacterial Strains and Assessment of Seedling and Soil Conditions
3.2. Detected Growth-Promoting Mechanisms in Bacterial Isolates
Amplification of ACC Deaminase and Antimicrobial Compounds Genes
3.3. Molecular Identification of Strains and Their Phylogenetic Comparison
3.4. Effect of Plant Growth-Promoting Bacteria on Biomass and Root Structure of Pine Seedlings
3.4.1. Adherence and Colonization Assays
3.4.2. PGPB Effect on Pines Seedlings
4. Discussion
| Reference | Strains | Total Treatments | Forestry Species | Height Range (cm) | Root Length Range (cm) | Root Diameter Range (mm) | Duration of Trials (Months) |
|---|---|---|---|---|---|---|---|
| [47] | Serratia marcescens, Bacillus subtilis, Paenibacillus macerans, Bacillus pumilus, Bacillus sphaericus | 12 | Pinus taeda L. and Pinus elliottii (Engelm.) | 13–14.8 | 15.6–17.9 | 3 | |
| [128] | Enterobacter intermedius, Pseudomonas fluorescens, Chryseobacterium balustinum, Phosphorobacillus latus | 4 | Quercus ilex ssp. Ballota and Pinus pinea | 17.52–19.72 | 4 | ||
| [127] | Bacillus sp., Curtobacterium sp., Arthrobacter sp., Staphylococcus sp., Burkholderia sp. | 10 | Pinus pinea | 20–26 | 5 | ||
| [39] | Pseudomonas sp., Bacillus macerans., Enterobacter agglomerans., Suillus luteus., A. chroococcum. | 11 | Pinus patula | 7.3–18.7 | 12 | ||
| [17] | Cupriavidus basilensis., Rhodococcus qingshengii., Pseudomonas spp., Pseudomonas gessardii., Stenotrophomonas rhizophila., Rhodococcus erythropolis., Cohnella sp. | 10 | Pinus pseudostrobus (Lindl.). | 4.6–6.6 | 5 | ||
| This study | Serratia sp., Buttiauxella sp., Bacillus sp. | 16 | Pinus montezumae and Pinus patula | 7.7–14.5 | 17.5–29.5 | 1–2 | 4 |
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Rosete-Vergés, F.A.; Pérez-Damián, J.L.; Villalobos-Delgado, M.; Navarro-Salas, E.N.; Salinas-Chávez, E.; Remond-Noa, R. El avance de la deforestación en México 1976–2007. Madera Bosques 2014, 20, 21–35. Available online: http://www.scielo.org.mx/scielo.php?script=sci_arttext&pid=S1405-04712014000100003&lng=es&nrm=iso (accessed on 12 December 2017). [CrossRef] [Scilit]
- FAO; PNUMA. El Estado de los Bosques del Mundo 2020, 2020th ed.; Organización de las Naciones Unidas para la Alimentación y la Agricultura, Programa de las Naciones Unidas para el Medio Ambiente, Eds.; FAO; UNEP: Rome, Italy, 2020; pp. 1–224. Available online: https://openknowledge.fao.org/handle/20.500.14283/ca8642es (accessed on 4 July 2021).
- Stanturf, J.A.; Palik, B.J.; Williams, M.I.; Dumroese, R.K.; Madsen, P. Forest restoration paradigms. J. Sustain. Forest 2014, 33 (Suppl. 1), 161–194. [Google Scholar] [CrossRef] [Scilit]
- Stanturf, J.A.; Kleine, M.; Mansourian, S.; Parrotta, J.; Madsen, P.; Kant, P.; Burns, J.; Bolte, A. Implementing forest landscape restoration under the Bonn Challenge: A systematic approach. Ann. For. Sci. 2019, 76, 50. [Google Scholar] [CrossRef] [Scilit]
- Gilby, B.L.; Olds, A.D.; Duncan, C.K.; Ortodossi, N.L.; Henderson, C.J.; Schlacher, T.A. Identifying restoration hotspots that deliver multiple ecological benefits. Restor. Ecol. 2020, 28, 222–232. [Google Scholar] [CrossRef] [Scilit]
- Flores García, A.; Romero-Sánchez, M.E.; Pérez-Miranda, R.; Moreno-Sánchez, F. Potencial de restauración de bosques de coníferas en zonas de movimiento de germoplasma en México. Rev. Mex. Cienc. For. 2020, 12, 4–27. [Google Scholar] [CrossRef] [Scilit]
- Salamanca, Á.E. Mitigación del cambio climático en el sector forestal. Foresta 2017, 69, 34–41. Available online: https://www.researchgate.net/profile/Alvaro-Enriquez-De-Salamanca/publication/321874644_Mitigacion_del_cambio_climatico_en_el_sector_forestal/links/5a3775260f7e9b10d848b585/Mitigacion-del-cambio-climatico-en-el-sector-forestal.pdf (accessed on 6 March 2023).
- Ramalho, Q.; Tourinho, L.; Almeida-Gomes, M.; Vale, M.M.; Prevedello, J.A. Reforestation can compensate negative effects of climate change on amphibians. Biol. Conserv. 2021, 260, 109187. [Google Scholar] [CrossRef] [Scilit]
- Castillo-Argüero, S.; Martínez-Orea, Y.; Barajas-Guzmán, G. Establecimiento de tres especies arbóreas en la cuenca del río Magdalena, México. Bot. Sci. 2014, 92, 309–317. Available online: https://www.scielo.org.mx/scielo.php?script=sci_arttext&pid=S2007-42982014000200014 (accessed on 19 March 2021). [CrossRef] [Scilit]
- Moreno-Valencia, F.D.; Plascencia-Espinosa, M.Á.; Muñoz-Rojas, J. Isolation and screening of plant growth promoting bacteria for their application in forest species. Mex. J. Biotechnol. 2018, 3, 36–53. [Google Scholar] [CrossRef] [Scilit]
- Mejía Bojórquez, J.M.; García Rodríguez, J.L.; Muñoz Flores, H.J. Evaluación de plantaciones de cuatro especies forestales en el estado de Durango. Reaxion 2015, 2, 8–28. Available online: http://reaxion.utleon.edu.mx/Reaxion_a2_numero_2.pdf (accessed on 2 August 2024).
- Secretaría de Medio Ambiente y Recursos Naturales (Semarnat). Anuarios Estadísticos de la Producción Forestal. México, D.F., México 2021. pp. 1–176. Available online: https://www.gob.mx/semarnat/documentos/anuarios-estadisticos-forestales (accessed on 17 April 2023).
- Moctezuma López, G.; Flores, A. Importancia económica del pino (Pinus spp.) como recurso natural en México. Rev. Mex. De Cienc. For. 2020, 11, 161–185. [Google Scholar] [CrossRef] [Scilit]
- Romero-Arenas, O.; Damián, M.A.; Hernández, I.; Parraguirre, C.; Márquez, M.; Huerta, M. Evaluación económica de cáscara de nuez como sustrato para producción de plántulas de Pinus patula Schl. et Cham. en vivero. Av. En Investig. Agropecu. 2013, 17, 23–40. Available online: https://www.redalyc.org/journal/837/83726339001/html/ (accessed on 11 February 2020).
- Pérez Miranda, R.; Moreno Sánchez, F.; González Hernández, A.; Arreola Padilla, V. Escenarios de la distribución potencial de Pinus patula Schltdl. et Cham. y Pinus pseudostrobus Lindl. con modelos de cambio climático en el Estado de México. Rev. Mex. Cien. For. 2013, 4, 73–86. Available online: http://www.scielo.org.mx/scielo.php?script=sci_arttext&pid=S2007-11322013000100006&lng=es&tlng=es (accessed on 5 August 2024).
- Guerra-De la Cruz, V.; Islas-Gutiérrez, F.; Flores-Ayala, E.; Acosta-Mireles, M.; Buendía-Rodríguez, E.; Carrillo-Anzures, F.; Tamarit Urias, J.C.; Pineda-Ojeda, T. Modelos locales altura-diámetro para Pinus montezumae Lamb. y Pinus teocote Schiede ex Schltdl. en Nanacamilpa, Tlaxcala. Rev. Mex. De Cienc. For. 2019, 10, 133–156. [Google Scholar] [CrossRef] [Scilit]
- Heredia-Acuña, C.; Almaraz-Suarez, J.J.; Arteaga-Garibay, R.; Ferrera-Cerrato, R.; Pineda-Mendoza, D.Y. Isolation, characterization and effect of plant-growth-promoting rhizobacteria on pine seedlings (Pinus pseudostrobus Lindl.). J. For. Res. 2019, 30, 1727–1734. [Google Scholar] [CrossRef] [Scilit]
- Backer, R.; Rokem, J.S.; Ilangumaran, G.; Lamont, J.; Praslickova, D.; Ricci, E.; Subramanian, S.; Smith, D.L. Plant growth-promoting rhizobacteria: Context, mechanisms of action, and roadmap to commercialization of biostimulants for sustainable agriculture. Front. Plant Sci. 2018, 9, 1473. [Google Scholar] [CrossRef] [Scilit]
- Gray, E.J.; Smith, D.L. Intracellular and extracellular PGPR: Commonalities and distinctions in the plant–bacterium signaling processes. Soil Biol. Biochem. 2005, 37, 395–412. [Google Scholar] [CrossRef] [Scilit]
- Sukul, P.; Kumar, J.; Rani, A.; Abdillahi, A.; Rakesh, R.B.; Kumar, M.H. Functioning of plant growth promoting rhizobacteria (PGPR) and their mode of actions: An overview from chemistry point of view. Plant Arch. 2021, 21, 628–634. [Google Scholar] [CrossRef] [Scilit]
- Etesami, H.; Adl, S.M. Plant growth-promoting rhizobacteria (PGPR) and their action mechanisms in availability of nutrients to plants. In Phyto-Microbiome in Stress Regulation; Environmental and Microbial Biotechnology; Kumar, M., Kumar, V., Prasad, R., Eds.; Springer: Singapore, 2020. [Google Scholar] [CrossRef] [Scilit]
- Nazari, M.; Smith, D.L. A PGPR-produced bacteriocin for sustainable agriculture: A review of thuricin 17 characteristics and applications. Front. Plant Sci. 2020, 11, 916. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.; Liu, R.; You, M.P.; Barbetti, M.J.; Chen, Y. Pathogen biocontrol using plant growth-promoting bacteria (PGPR): Role of bacterial diversity. Microorganisms 2021, 9, 1988. [Google Scholar] [CrossRef] [Scilit]
- Verma, A.; Verma, S.; Singh, M.; Mudila, H.; Saini, J.K. Ecology and mechanisms of plant growth promoting rhizobacteria. In Sustainable Agriculture Reviews; Singh, N., Chattopadhyay, A., Lichtfouse, E., Eds.; Springer: Cham, Switzerland, 2023; Volume 60. [Google Scholar] [CrossRef] [Scilit]
- Mushtaq, Z. PGPR: Present role, mechanism of action and future prospects along bottlenecks in commercialization. EQA 2021, 41, 9–15. [Google Scholar]
- Santoyo, G.; Urtis-Flores, C.A.; Loeza-Lara, P.D.; Orozco-Mosqueda, M.d.C.; Glick, B.R. Rhizosphere colonization determinants by plant growth-promoting rhizobacteria (PGPR). Biology 2021, 10, 475. [Google Scholar] [CrossRef] [Scilit]
- Basu, A.; Prasad, P.; Das, S.N.; Kalam, S.; Sayyed, R.Z.; Reddy, M.S.; El Enshasy, H. Plant growth promoting rhizobacteria (PGPR) as green bioinoculants: Recent developments, constraints, and prospects. Sustainability 2021, 13, 1140. [Google Scholar] [CrossRef] [Scilit]
- Figueiredo, M.d.V.B.; Bonifacio, A.; Rodrigues, A.C.; de Araujo, F.F. Plant growth-promoting rhizobacteria: Key mechanisms of action. In Microbial-Mediated Induced Systemic Resistance in Plants; Choudhary, D.K., Varma, A., Eds.; Springer: Singapore, 2016. [Google Scholar] [CrossRef] [Scilit]
- Orozco-Mosqueda, M.C.; Glick, B.R.; Santoyo, G. ACC deaminase in plant growth-promoting bacteria (PGPB): An efficient mechanism to counter salt stress in crops. Microbiol. Res. 2020, 235, 126439. [Google Scholar] [CrossRef] [Scilit]
- Murali, M.; Gowtham, H.G.; Singh, S.B.; Shilpa, N.; Aiyaz, M.; Niranjana, S.R.; Amruthesh, K.N. Bio-prospecting of ACC deaminase producing Rhizobacteria towards sustainable agriculture: A special emphasis on abiotic stress in plants. Appl. Soil Ecol. 2021, 168, 104142. [Google Scholar] [CrossRef] [Scilit]
- Al-Turki, A.; Murali, M.; Omar, A.F.; Rehan, M.; Sayyed, R.Z. Recent advances in PGPR-mediated resilience toward interactive effects of drought and salt stress in plants. Front. Microbiol. 2023, 14, 1214845. [Google Scholar] [CrossRef] [Scilit]
- Vocciante, M.; Grifoni, M.; Fusini, D.; Petruzzelli, G.; Franchi, E. The role of plant growth-promoting rhizobacteria (PGPR) in mitigating plant’s environmental stresses. Appl. Sci. 2022, 12, 1231. [Google Scholar] [CrossRef] [Scilit]
- Gupta, P.; Diwan, B. Bacterial exopolysaccharide mediated heavy metal removal: A review on biosynthesis, mechanism and remediation strategies. Biotechnol. Rep. 2017, 13, 58–71. [Google Scholar] [CrossRef] [Scilit]
- Ghosh, A.; Sah, D.; Chakraborty, M.; Rai, J.P.N. Mechanism and application of bacterial exopolysaccharides: An advanced approach for sustainable heavy metal abolition from soil. Carbohydrate Res. 2024, 544, 109247. [Google Scholar] [CrossRef] [Scilit]
- Lahiri, D.; Nag, M.; Sayyed, R.Z.; Gafur, A.; Ansari, M.J.; Ray, R.R. PGPR in biofilm formation and antibiotic production. In Antifungal Metabolites of Rhizobacteria for Sustainable Agriculture; Fungal Biology; Sayyed, R., Singh, A., Ilyas, N., Eds.; Springer: Cham, Switzerland, 2022. [Google Scholar] [CrossRef] [Scilit]
- Shultana, R.; Zuan, A.T.K.; Naher, U.A.; Islam, A.K.M.M.; Rana, M.M.; Rashid, M.H.; Irin, I.J.; Islam, S.S.; Rim, A.A.; Hasan, A.K. The PGPR mechanisms of salt stress adaptation and plant growth promotion. Agronomy 2022, 12, 2266. [Google Scholar] [CrossRef] [Scilit]
- Bashan, Y.; de-Bashan, L.E.; Prabhu, S.R.; Hernandez, J.P. Advances in plant growth-promoting bacterial inoculant technology: Formulations and practical perspectives (1998–2013). Plant Soil 2014, 378, 1–33. [Google Scholar] [CrossRef] [Scilit]
- Baez-Rogelio, A.; Morales-García, Y.E.; Quintero-Hernández, V.; Muñoz-Rojas, J. Next generation of microbial inoculants for agriculture and bioremediation. Microb. Biotechnol. 2017, 10, 19–21. [Google Scholar] [CrossRef] [Scilit]
- Orozco-Jaramillo, C.; Martínez-Nieto, P. Evaluación de la inoculación con microorganismos fijadores de nitrógeno asimbióticos aislados de la rizósfera de Pinus patula en Colombia. BOSQUE 2009, 30, 70–77. [Google Scholar] [CrossRef] [Scilit]
- Brader, G.; Compant, S.; Mitter, B.; Trognitz, F.; Sessitsch, A. Metabolic potential of endophytic bacteria. Curr. Opin. Biotechnol. 2014, 27, 30–37. [Google Scholar] [CrossRef] [Scilit]
- Rojas, J.M.; Molina-Romero, D.; Bustillos-Cristales, M.d.R.; Rodríguez-Andrade, O.; Morales-García, Y.E.; Saenz, Y.S.; Lucio, M.C. Mecanismos de fitoestimulación por rizobacterias, aislamientos en América y potencial biotecnológico. Biológicas 2015, 17, 24–34. Available online: https://www.biologicas.umich.mx/index.php?journal=biologicas&page=article&op=view&path%5B%5D=207 (accessed on 11 February 2020).
- Su, P.; Tan, X.; Li, C.; Zhang, D.; Cheng, J.; Zhang, S.; Zhou, X.; Yan, Q.; Peng, J.; Zhang, Z.; et al. Photosynthetic bacterium Rhodopseudomonas palustris GJ-22 induces systemic resistance against viruses. Microb. Biotechnol. 2017, 10, 612–624. [Google Scholar] [CrossRef] [Scilit]
- Lucy, M.; Reed, E.; Glick, B.R. Applications of free living plant growth-promoting rhizobacteria. Antonie Van Leeuwenhoek 2004, 86, 1–25. [Google Scholar] [CrossRef] [Scilit]
- Yaish, M.W.; Antony, I.; Glick, B.R. Isolation and characterization of endophytic plant growth-promoting bacteria from date palm tree (Phoenix dactylifera L.) and their potential role in salinity tolerance. Antonie Van Leeuwenhoek 2015, 107, 1519–1532. [Google Scholar] [CrossRef] [Scilit]
- Marupakula, S.; Mahmood, S.; Finlay, R.D. Analysis of single root tip microbiomes suggests that distinctive bacterial communities are selected by Pinus sylvestris roots colonized by different ectomycorrhizal fungi. Environ. Microbiol. 2016, 18, 1470–1483. [Google Scholar] [CrossRef] [Scilit]
- Méndez-Bravo, A.; Cortazar-Murillo, E.M.; Guevara-Avendaño, E.; Ceballos-Luna, O.; Rodríguez-Haas, B.; Kiel-Martínez, A.L.; Hernández-Cristóbal, O.; Guerrero-Analco, J.A.; Reverchon, F. Plant growth-promoting rhizobacteria associated with avocado display antagonistic activity against Phytophthora cinnamomi through volatile emissions. PLoS ONE 2018, 13, e0194665. [Google Scholar] [CrossRef] [Scilit]
- Enebak, S.A.; Wei, G.; Kloepper, J.W. Effects of plant growth-promoting rhizobacteria on loblolly and slash pine seedlings. For. Sci. 1998, 44, 139–144. [Google Scholar] [CrossRef] [Scilit]
- Glick, B.R. Introduction to plant growth-promoting bacteria. In Beneficial Plant-Bacterial Interactions; Springer International Publishing: Cham, Switzerland, 2015; pp. 1–26. Available online: https://link.springer.com/content/pdf/10.1007/978-3-030-44368-9.pdf (accessed on 22 August 2017).
- Santoyo, G.G.; Moreno-Hagelsieb, M.C.; Orozco-Mosqueda, M.d.C.; Glick, B.R. Plant growth-promoting bacterial endophytes. Microbiol. Res. 2016, 183, 92–99. [Google Scholar] [CrossRef] [Scilit]
- Holguin, G.; Bashan, Y.; Ferrera-Cerrato, R. Interacciones entre plantas y microorganismos benéficos: III. Procedimientos para el aislamiento y caracterización de hongos micorrízicos y rizobacterias promotoras de crecimiento en plantas. Terra 1996, 14, 211–227. Available online: https://www.terralatinoamericana.org.mx/index.php/terra/issue/view/102/47 (accessed on 8 April 2016).
- Corral-Lugo, A.; Morales-García, Y.E.; Pazos-Rojas, L.A.; Ramírez-Valverde, A.; Martínez-Contreras, R.D.; Muñoz-Rojas, J. Cuantificación de bacterias cultivables mediante el método de “goteo en placa por sellado (o estampado) masivo”. Rev. Colomb. Biotecnol. 2012, 14, 147–156. Available online: http://www.scielo.org.co/scielo.php?script=sci_arttext&pid=S0123-34752012000200016&lng=en (accessed on 9 August 2017).
- Morales-García, Y.E.; de la Torre-Zuñiga, J.; Duque de Oliva, E.; Pérez y Terrón, R.; Martínez Contreras, R.D.; Muñoz-Rojas, J. Aspectos críticos a considerar para el aislamiento de bacterias benéficas. Saberes Compart. Rev. Investig. Cient. Tecnol. Hum. 2013, 11, 54–62. Available online: https://www.academiajournals.com/revista-concytep (accessed on 13 December 2017).
- Ahmad, F.; Ahmad, I.; Khan, M.S. Screening of free-living rhizospheric bacteria for their multiple plant growth promoting activities. Microbiol. Res. 2008, 163, 173–181. [Google Scholar] [CrossRef] [Scilit]
- Poole, E.J.; Bending, G.D.; Whipps, J.M.; Read, D.J. Bacteria associated with Pinus sylvestris—Lactarius rufus ectomycorrhizas and their effects on mycorrhiza formation in vitro. New Phytol. 2001, 151, 743–751. [Google Scholar] [CrossRef] [Scilit]
- Matsuda, F.; Miyazawa, H.; Wakasa, K.; Miyagawa, H. Quantification of indole-3-acetic acid and amino acid conjugates in rice by liquid chromatography. Biosci. Biotechnol. Biochem. 2005, 69, 778–783. [Google Scholar] [CrossRef] [Scilit]
- Aguilar-Piedras, J.J.; Xiqui-Vásquez, M.L.; García-García, S.; Baca, B.E. Producción del ácido indol-3-acético en Azospirillum. Rev. Latinoam. Microbiol. 2008, 50, 29–37. Available online: https://www.researchgate.net/publication/287473721 (accessed on 20 January 2018).
- Nautiyal, C.S.; Bhadauria, S.; Kumar, P.; Lal, H.; Mondal, R.; Verma, D. Stress induced phosphate solubilization in bacteria isolated from alkaline soils. FEMS Microbiol. Lett. 2000, 182, 291–296. [Google Scholar] [CrossRef]
- Mehta, S.; Nautiyal, C.S. An efficient method for qualitative screening of phosphate-solubilizing bacteria. Curr. Microbiol. 2001, 43, 51–56. [Google Scholar] [CrossRef] [Scilit]
- Van Reeuwijk, L. Procedures for Soil Analysis, 6th ed.; International Soil Reference and Information Centre: Wageningen, The Netherlands, 2002; 119p, Available online: https://www.isric.org/documents/document-type/technical-paper-09-procedures-soil-analysis-6th-edition (accessed on 4 April 2020).
- Illmer, P.; Schinner, F. Solubilization of inorganic phosphates by microorganisms isolated from forest soils. Soil Biol. Biochem. 1992, 24, 389–395. [Google Scholar] [CrossRef] [Scilit]
- Kifle, M.H.; Laing, M.D. Isolation and screening of bacteria for their diazotrophic potential and their influence on growth promotion of maize seedlings in greenhouses. Front. Plant Sci. 2015, 6, 1225. [Google Scholar] [CrossRef] [Scilit]
- Alexander, D.B.; Zuberer, D.A. Use of chrome azurol S reagents to evaluate siderophore production by rhizosphere bacteria. Biol. Fertil. Soils 1991, 12, 39–45. [Google Scholar] [CrossRef] [Scilit]
- Schwyn, B.; Neilands, J.B. Universal chemical assay for the detection and determination of siderophores. Anal. Biochem. 1987, 160, 47–56. [Google Scholar] [CrossRef] [Scilit]
- McSpadden-Gardener, B.B.; Mavrodi, D.V.; Thomashow, L.S.; Weller, D.M. A rapid polymerase chain reaction-based assay characterizing rhizosphere populations of 2,4-diacetylphloroglucinol-producing bacteria. Phytopathology 2001, 91, 44–54. [Google Scholar] [CrossRef] [Scilit]
- De Souza, J.T.; Raaijmakers, J.M. Polymorphisms within the prnD and pltC genes from pyrrolnitrin and pyoluteorin-producing Pseudomonas and Burkholderia spp. FEMS Microbiol. Ecol. 2003, 43, 21–34. [Google Scholar] [CrossRef] [Scilit]
- Mulet, M.; Bennasar, A.; Lalucat, J.; García-Valdés, E. An rpoD-based PCR procedure for the identification of Pseudomonas species and for their detection in environmental samples. Mol. Cell. Probes 2009, 23, 140–147. [Google Scholar] [CrossRef] [Scilit]
- Mavrodi, D.V.; Peever, T.L.; Mavrodi, O.V.; Parejko, J.A.; Raaijmakers, J.M.; Lemanceau, P.; Mazurier, S.; Heide, L.; Blankenfeldt, W.; Weller, D.M.; et al. Diversity and evolution of the phenazine biosynthesis pathway. Appl. Environ. Microbiol. 2010, 76, 866–879. [Google Scholar] [CrossRef] [Scilit]
- Wang, X.; Mavrodi, D.V.; Ke, L.; Mavrodi, O.V.; Yang, M.; Thomashow, L.S.; Zheng, N.; Weller, D.M.; Zhang, J. Biocontrol and plant growth-promoting activity of rhizobacteria from Chinese fields with contaminated soils. Microb. Biotechnol. 2015, 8, 404–418. [Google Scholar] [CrossRef] [Scilit]
- Morales-García, Y.E.; Juárez-Hernández, D.; Aragón-Hernández, C.; Mascarua-Esparza, M.A.; Bustillos-Cristales, M.R.; Fuentes-Ramírez, L.E.; Martinez-Contreras, R.D.; Munoz-Rojas, J. Growth response of maize plantlets inoculated with Enterobacter spp., as a model for alternative agriculture. Rev. Argent Microbiol. 2011, 43, 287–293. Available online: https://www.redalyc.org/articulo.oa?id=213021188009 (accessed on 11 February 2020).
- Anisimova, M.; Gascuel, O. Approximate likelihood-ratio test for branches: A fast, accurate, and powerful alternative. Syst. Biol. 2006, 55, 539–552. [Google Scholar] [CrossRef] [Scilit]
- Castresana, J. Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol. Biol. Evol. 2000, 17, 540–552. [Google Scholar] [CrossRef] [Scilit]
- Dereeper, A.; Guignon, V.; Blanc, G.; Audic, S.; Buffet, S.; Chevenet, F.; Dufayard, J.F.; Guindon, S.; Lefort, V.; Lescot, M.; et al. Phylogeny.fr: Robust phylogenetic analysis for the non-specialist. Nucleic Acids Res. 2008, 36 (Suppl. 2), W465–W469. [Google Scholar] [CrossRef] [Scilit]
- Guindon, S.; Dufayard, J.F.; Lefort, V.; Anisimova, M.; Hordijk, W.; Gascuel, O. New algorithms and methods to estimate maximum-likelihood phylogenies: Assessing the performance of PhyML 3.0. Syst. Biol. 2010, 59, 307–321. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Z.; Schwartz, S.; Wagner, L.; Miller, W. A greedy algorithm for aligning DNA sequences. J. Comput. Biol. 2000, 7, 203–214. [Google Scholar] [CrossRef] [Scilit]
- Estes, B.L.; Enebak, S.A.; Chappelka, A.H. Loblolly pine seedling growth after inoculation with plant growth-promoting rhizobacteria and ozone exposure. Can. J. For. Res. 2004, 34, 1410–1416. [Google Scholar] [CrossRef] [Scilit]
- Molina-Romero, D.; Morales-García, Y.E.; Hernández-Tenorio, A.L.; Castañeda-Lucio, M.; Netzahuatl-Muñoz, A.R.; Muñoz-Rojas, J. Pseudomonas putida estimula el crecimiento de maíz en función de la temperatura. Rev. Iberoam. De Cienc. 2017, 4, 80–88. Available online: http://reibci.org/publicados/2017/feb/2100115.pdf (accessed on 11 April 2018).
- Figueiredo, M.d.V.B.; Seldin, L.; de Araujo, F.F.; Mariano, R.d.L.R. Plant growth promoting rhizobacteria: Fundamentals and applications. In Plant Growth and Health Promoting Bacteria; Microbiology Monographs; Maheshwari, D., Ed.; Springer: Berlin/Heidelberg, Germany, 2010; Volume 18, pp. 21–43. [Google Scholar] [CrossRef] [Scilit]
- Kumar, R.; Shamet, G.S.; Alam, N.M.; Jana, C. Influence of growing medium and seed size on germination and seedling growth of Pinus gerardiana Wall. Compost Sci. Util. 2016, 24, 98–104. [Google Scholar] [CrossRef] [Scilit]
- Di Rienzo, J.A.; Casanoves, F.; González, L.A.; Tablada, E.M.; Díaz, M.d.P.; Robledo, C.W. Estadística para las Ciencias Agropecuarias; Editorial Brujas: Córdoba, Argentina, 2009; 372p, Available online: https://www.researchgate.net/publication/319875258_Estad'isticas_para_las_ciencias_agropecuarias (accessed on 28 February 2019).
- Patten, C.L.; Blakney, A.J.C.; Coulson, T.J.D. Activity, distribution and function of indole-3-acetic acid biosynthetic pathways in bacteria. Crit. Rev. Microbiol. 2013, 39, 395–415. [Google Scholar] [CrossRef] [Scilit]
- Oleńska, E.; Małek, W.; Wójcik, M.; Swiecicka, I.; Thijs, S.; Vangronsveld, J. Beneficial features of plant growth-promoting rhizobacteria for improving plant growth and health in challenging conditions: A methodical review. Sci. Total Environ. 2020, 743, 140682. [Google Scholar] [CrossRef] [Scilit]
- Cassán, F.; Vanderleyden, J.; Spaepen, S. Physiological and agronomical aspects of phytohormone production by model Plant-Growth-Promoting Rhizobacteria (PGPR) belonging to the genus Azospirillum. J. Plant Growth Regul. 2014, 33, 440–459. [Google Scholar] [CrossRef] [Scilit]
- Lambrecht, M.; Okon, Y.; Vande Broek, A.; Vanderleyden, J. Indole-3-acetic acid: A reciprocal signalling molecule in bacteria-plant interactions. Trends Microbiol. 2000, 8, 298–300. [Google Scholar] [CrossRef] [Scilit]
- Vega-Celedón, P.; Canchignia Martínez, H.; González, M.; Seeger, M. Biosíntesis de ácido indol-3-acético y promoción del crecimiento de plantas por bacterias. Cultiv. Trop. 2016, 37 (Suppl. 1), 33–39. Available online: http://scielo.sld.cu/scielo.php?script=sci_arttext&pid=S0258-59362016000500005&lng=es&tlng=en (accessed on 7 November 2022).
- Idris, E.E.; Iglesias, D.J.; Talon, M.; Borriss, R. Tryptophan-dependent production of indole-3-acetic acid (IAA) affects level of plant growth promotion by Bacillus amyloliquefaciens FZB42. Mol. Plant Microbe Interact. 2007, 20, 619–626. [Google Scholar] [CrossRef] [Scilit]
- Barriuso, J.; Pereyra, M.T.; Lucas García, J.A.; Megías, M.; Gutierrez Mañero, F.J.; Ramos, B. Screening for putative PGPR to improve establishment of the symbiosis Lactarius deliciosus-Pinus sp. Microb. Ecol. 2005, 50, 82–89. [Google Scholar] [CrossRef] [Scilit]
- Pedraza, R.O.; Ramírez-Mata, A.; Xiqui, M.L.; Baca, B.E. Aromatic amino acid aminotransferase activity and indole-3-acetic acid production by associative nitrogen-fixing bacteria. FEMS Microbiol. Lett. 2004, 233, 15–21. [Google Scholar] [CrossRef] [Scilit]
- Duca, D.; Lorv, J.; Patten, C.L.; Rose, D.; Glick, B.R. Indole-3-acetic acid in plant–microbe interactions. Antonie Van Leeuwenhoek 2014, 106, 85–125. [Google Scholar] [CrossRef] [Scilit]
- Batista, B.D.; Dourado, M.N.; Figueredo, E.F.; Hortencio, R.O.; Marques, J.P.R.; Piotto, F.A.; Bonatelli, M.L.; Settles, M.L.; Azevedo, J.L.; Quecine, M.C. The auxin-producing Bacillus thuringiensis RZ2MS9 promotes the growth and modifies the root architecture of tomato (Solanum lycopersicum cv. Micro-Tom). Arch. Microbiol. 2021, 203, 3869–3882. [Google Scholar] [CrossRef] [Scilit]
- Chaudhary, T.; Gera, R.; Shukla, P. Deciphering the potential of Rhizobium pusense mb-17a, a plant growth-promoting root endophyte, and functional annotation of the genes involved in the metabolic pathway. Front. Bioeng. Biotechnol. 2021, 8, 617034. [Google Scholar] [CrossRef] [Scilit]
- Gumiere, T.; Ribeiro, C.M.; Vasconcellos, R.L.F.; Cardoso, E.J. Indole-3-acetic acid producing root-associated bacteria on growth of Brazil Pine (Araucaria angustifolia) and Slash Pine (Pinus elliottii). Antonie Van Leeuwenhoek 2014, 105, 663–669. [Google Scholar] [CrossRef] [Scilit]
- Puri, A.; Padda, K.P.; Chanway, C.P. Sustaining the growth of Pinaceae trees under nutrient-limited edaphic conditions via plant-beneficial bacteria. PLoS ONE 2020, 15, e0238055. [Google Scholar] [CrossRef] [Scilit]
- Padda, K.P.; Puri, A.; Chanway, C.P. Isolation and identification of endophytic diazotrophs from lodgepole pine trees growing at unreclaimed gravel mining pits in central interior British Columbia, Canada. Can. J. For. Res. 2018, 48, 1601–1606. [Google Scholar] [CrossRef] [Scilit]
- Proença, D.N.; Grass, G.; Morais, P.V. Understanding pine wilt disease: Roles of the pine endophytic bacteria and of the bacteria carried by the disease-causing pinewood nematode. Microbiologyopen 2017, 6, e415. [Google Scholar] [CrossRef] [Scilit]
- Morales-García, Y.E.; Baez, A.; Quintero-Hernández, V.; Molina-Romero, D.; Rivera-Urbalejo, A.P.; Pazos-Rojas, L.A.; Muñoz-Rojas, J. Bacterial mixtures, the future generation of inoculants for sustainable crop production. In Field Crops: Sustainable Management by PGPR; Sustainable Development and Biodiversity; Maheshwari, D., Dheeman, S., Eds.; Springer: Cham, Switzerland, 2019; Volume 23, pp. 11–44. [Google Scholar] [CrossRef] [Scilit]
- Sarmah, R.; Sarma, A.K. Phosphate solubilizing microorganisms: A review. Commun. Soil Sci. Plant Anal. 2023, 54, 1306–1315. [Google Scholar] [CrossRef] [Scilit]
- Alori, E.T.; Glick, B.R.; Babalola, O.O. Microbial phosphorus solubilization and its potential for use in sustainable agriculture. Front. Microbiol. 2017, 8, 971. [Google Scholar] [CrossRef] [Scilit]
- Rawat, P.; Das, S.; Shankhdhar, D.; Shankhdhar, S.C. Phosphate-solubilizing microorganisms: Mechanism and their role in phosphate solubilization and uptake. J. Soil Sci. Plant Nutr. 2021, 21, 49–68. [Google Scholar] [CrossRef] [Scilit]
- Cesa-Luna, C.; Baez, A.; Aguayo-Acosta, A.; Llano-Villarreal, R.C.; Juárez-González, V.R.; Gaytán, P.; Bustillos-Cristales, M.D.R.; Rivera-Urbalejo, A.; Muñoz-Rojas, J.; Quintero-Hernández, V. Growth inhibition of pathogenic microorganisms by Pseudomonas protegens EMM-1 and partial characterization of inhibitory substances. PLoS ONE. 2020, 15, e0240545. [Google Scholar] [CrossRef] [Scilit]
- Ferreira, M.J.; Silva, H.; Cunha, A. Siderophore-producing rhizobacteria as a promising tool for empowering plants to cope with iron limitation in saline soils: A review. Pedosphere 2019, 29, 409–420. [Google Scholar] [CrossRef] [Scilit]
- Louden, B.C.; Haarmann, D.; Lynne, A.M. Use of blue agar CAS assay for siderophore detection. J. Microbiol. Biol. Educ. 2011, 12, 51–53. [Google Scholar] [CrossRef] [Scilit]
- Guerrieri, M.C.; Fiorini, A.; Fanfoni, E.; Tabaglio, V.; Cocconcelli, P.S.; Trevisan, M.; Puglisi, E. Integrated genomic and greenhouse assessment of a novel Plant Growth-Promoting Rhizobacterium for tomato plant. Front. Plant Sci. 2021, 12, 660620. [Google Scholar] [CrossRef] [Scilit]
- Esquivel-Cote, R.; Gavilanes-Ruiz, M.; Cruz-Ortega, R.; Huante, P. Importancia agrobiotecnológica de la enzima ACC desaminasa en rizobacterias, una revisión. Rev. Fitotec. Mex. 2013, 36, 251–258. Available online: https://www.scielo.org.mx/scielo.php?pid=S0187-73802013000300010&script=sci_arttext (accessed on 9 August 2017). [CrossRef] [Scilit]
- Glick, B.R.; Cheng, Z.; Czarny, J.; Duan, J. Promotion of plant growth by ACC deaminase-producing soil bacteria. In New Perspectives and Approaches in Plant Growth-Promoting Rhizobacteria Research; Bakker, P.A.H.M., Raaijmakers, J.M., Bloemberg, G., Höfte, M., Lemanceau, P., Cooke, B.M., Eds.; Springer: Dordrecht, The Netherlands, 2007; pp. 329–339. [Google Scholar]
- Prigent-Combaret, C.; Blaha, D.; Pothier, J.F.; Vial, L.; Poirier, M.A.; Wisniewski-Dyé, F.; Moënne-Loccoz, Y. Physical organization and phylogenetic analysis of acdR as leucine-responsive regulator of the 1-aminocyclopropane-1-carboxylate deaminase gene acdS in phytobeneficial Azospirillum lipoferum 4B and other Proteobacteria. FEMS Microbiol. Ecol. 2008, 65, 202–219. [Google Scholar] [CrossRef] [Scilit]
- Blaha, D.; Prigent-Combaret, C.; Mirza, M.S.; Moënne-Loccoz, Y. Phylogeny of the 1-aminocyclopropane-1-carboxylic acid deaminase-encoding gene acdS in phytobeneficial and pathogenic Proteobacteria and relation with strain biogeography. FEMS Microbiol. Ecol. 2006, 56, 455–470. [Google Scholar] [CrossRef] [Scilit]
- Glick, B.R. Bacteria with ACC deaminase can promote plant growth and help to feed the world. Microbiol. Res. 2014, 169, 30–39. [Google Scholar] [CrossRef] [Scilit]
- Fernando, W.G.D.; Nakkeeran, S.; Zhang, Y. Biosynthesis of antibiotics by PGPR and its relation in biocontrol of plant diseases BT—PGPR: Biocontrol and Biofertilization. In PGPR: Biocontrol and Biofertilization; Siddiqui, Z.A., Ed.; Springer: Dordrecht, The Netherlands, 2006; pp. 67–109. [Google Scholar] [CrossRef] [Scilit]
- Jagtap, R.R.; Mali, G.V.; Waghmare, S.R.; Nadaf, N.H.; Nimbalkar, M.S.; Sonawane, K.D. Impact of plant growth promoting rhizobacteria Serratia nematodiphila RGK and Pseudomonas plecoglossicida RGK on secondary metabolites of turmeric rhizome. Biocatal. Agric. Biotechnol. 2023, 47, 102622. [Google Scholar] [CrossRef] [Scilit]
- Zhang, C.; Yu, Z.; Zhang, M.; Li, X.; Wang, M.; Li, L.; Li, X.; Ding, Z.; Tian, H. Serratia marcescens PLR enhances lateral root formation through supplying PLR-derived auxin and enhancing auxin biosynthesis in Arabidopsis. J. Exp. Bot. 2022, 73, 3711–3725. [Google Scholar] [CrossRef] [Scilit]
- Kshetri, L.; Naseem, F.; Pandey, P. Role of Serratia sp. as biocontrol agent and plant growth stimulator, with prospects of biotic stress management in plant. In Plant Growth Promoting Rhizobacteria for Sustainable Stress Management; Microorganisms for Sustainability; Sayyed, R., Ed.; Springer: Singapore, 2019; Volume 13, pp. 169–200. [Google Scholar]
- Martínez, O.A.; Encina, C.; Tomckowiack, C.; Droppelmann, F.; Jara, R.W.; Maldonado, C.; Muñoz, O.; Garcia-Fraile, P.; Rivas, R. Serratia strains isolated from the rhizosphere of raulí (Nothofagus alpina) in volcanic soils harbour PGPR mechanisms and promote raulí plantlet growth. J. Soil Sci. Plant Nutr. 2018, 18, 804–819. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Kang, S.; Li, F.; Zhang, F.; Li, Z.; Zhang, J. Effects of alternate partial root-zone irrigation on soil microorganism and maize growth. Plant Soil 2008, 302, 45–52. [Google Scholar] [CrossRef] [Scilit]
- Khan, A.; Singh, A.V. Multifarious effect of ACC deaminase and EPS producing Pseudomonas sp. and Serratia marcescens to augment drought stress tolerance and nutrient status of wheat. World J. Microbiol. Biotechnol. 2021, 37, 198. [Google Scholar] [CrossRef] [Scilit]
- Nordstedt, N.P.; Jones, M.L. Genomic analysis of Serratia plymuthica MBSA-MJ1: A plant growth promoting rhizobacteria that improves water stress tolerance in greenhouse ornamentals. Front. Microbiol. 2021, 12, 653556. [Google Scholar] [CrossRef] [Scilit]
- Bhandari, V.; Ahmod, N.Z.; Shah, H.N.; Gupta, R.S. Molecular signatures for Bacillus species: Demarcation of the Bacillus subtilis and Bacillus cereus clades in molecular terms and proposal to limit the placement of new species into the genus Bacillus. Int. J. Syst. Evol. Microbiol. 2013, 63 Pt 7, 2712–2726. [Google Scholar] [CrossRef] [Scilit]
- Vriezen, J.A.C.; de Bruijn, F.J.; Nüsslein, K. Desiccation responses and survival of Sinorhizobium meliloti USDA 1021 in relation to growth phase, temperature, chloride and sulfate availability. Lett. Appl. Microbiol. 2006, 42, 172–178. [Google Scholar] [CrossRef] [Scilit]
- Kumar, A.; Maurya, B.R.; Raghuwanshi, R. Isolation and characterization of PGPR and their effect on growth, yield and nutrient content in wheat (Triticum aestivum L.). Biocatal. Agric. Biotechnol. 2014, 3, 121–128. [Google Scholar] [CrossRef] [Scilit]
- Wu, K.; Luo, J.; Li, J.; An, Q.; Yang, X.; Liang, Y.; Li, T. Endophytic bacterium Buttiauxella sp. SaSR13 improves plant growth and cadmium accumulation of hyperaccumulator Sedum alfredii. Environ. Sci. Pollut. Res. 2018, 25, 21844–21854. [Google Scholar] [CrossRef] [Scilit]
- Liang, Y.; Xu, Z.; Xu, Q.; Zhao, X.; Niu, S.; Yin, X. Isolation of inorganic phosphorus-solubilizing bacteria from the rhizosphere of Festuca arundinacea Schreb. Geomicrobiol. J. 2023, 40, 538–546. [Google Scholar] [CrossRef] [Scilit]
- Wang, M.; Sun, H.; Xu, Z. Analysis of blueberry plant rhizosphere bacterial diversity and selection of Plant Growth Promoting Rhizobacteria. Curr. Microbiol. 2022, 79, 331. [Google Scholar] [CrossRef] [Scilit]
- Díaz Vélez, M.C.; Ferreras, A.E.; Silva, W.R.; Galetto, L. Does avian gut passage favour seed germination of woody species of the Chaco Serrano Woodland in Argentina? Botany 2017, 95, 493–501. [Google Scholar] [CrossRef] [Scilit]
- Lal, S.; Kumar, R.; Ahmad, S.; Dixit, V.K.; Berta, G. Exploring the survival tactics and plant growth promising traits of root-associated bacterial strains under Cd and Pb stress: A modelling based approach. Ecotoxicol. Environ. Saf. 2019, 170, 267–277. [Google Scholar] [CrossRef] [Scilit]
- Reed, R.C.; Bradford, K.J.; Khanday, I. Seed germination and vigor: Ensuring crop sustainability in a changing climate. Heredity 2022, 128, 450–459. [Google Scholar] [CrossRef] [Scilit]
- Topacoglu, O.; Sevik, H.; Akkuzu, E. Effects of water stress on germination of Pinus nigra Arnold. seeds. Pak. J. Bot. 2016, 48, 447–453. Available online: https://www.pakbs.org/pjbot/PDFs/48%282%29/04.pdf (accessed on 23 November 2023).
- Han, C.; Yang, P. Studies on the molecular mechanisms of seed germination. Proteomic 2015, 15, 1671–1679. [Google Scholar] [CrossRef] [Scilit]
- Barriuso, J.; Ramos Solano, B.; Santamaría, C.; Daza, A.; Gutiérrez Mañero, F.J. Effect of inoculation with putative plant growth-promoting rhizobacteria isolated from Pinus spp. on Pinus pinea growth, mycorrhization and rhizosphere microbial communities. J. Appl. Microbiol. 2008, 105, 1298–1309. [Google Scholar] [CrossRef] [Scilit]
- Lucas García, J.A.; Domenech, J.; Santamaría, C.; Camacho, M.; Daza, A.; Gutiérrez Mañero, F.J. Growth of forest plants (pine and holm-oak) inoculated with rhizobacteria: Relationship with microbial community structure and biological activity of its rhizosphere. Environ. Exp. Bot. 2004, 52, 239–251. [Google Scholar] [CrossRef] [Scilit]
- Grobelak, A.; Napora, A.; Kacprzak, M.J.E.E. Using plant growth-promoting rhizobacteria (PGPR) to improve plant growth. Ecol. Eng. 2015, 84, 22–28. [Google Scholar] [CrossRef] [Scilit]
- Domínguez-Castillo, C.; Alatorre-Cruz, J.M.; Castañeda-Antonio, D.; Munive, J.A.; Guo, X.; López-Olguín, J.F.; Fuentes-Ramírez, L.E.; Carreño-López, R. Potential seed germination-enhancing plant growth-promoting rhizobacteria for restoration of Pinus chiapensis ecosystems. J. For. Res. 2021, 32, 2143–2153. [Google Scholar] [CrossRef] [Scilit]


| Tree Sample | Tree Species | Height (cm) | Soil Moisture % | Altitudinal Profile (masl) | Sampling Coordinates | Forested Region | Number of Isolated Strains |
|---|---|---|---|---|---|---|---|
| 1 | P. montezumae | 20 | 60 | 2885 | 19°14′49″ N; 98°05′44″ O | Malinche National Park | 4 |
| 2 | P. montezumae | 25 | 63 | 2962 | 19°15′02″ N; 98°05′22″ O | 5 | |
| 3 | P. montezumae | 26 | 68 | 3030 | 19°15′03″ N; 98°05′2″ O | 6 | |
| 4 | P. montezumae | 30 | 56 | 3077 | 19°15′04″ N; 98°05′21″ O | 5 | |
| 5 | P. montezumae | 46 | 61 | 2896 | 19°15′01″ N; 98°05′20″ O | 3 | |
| 6 | P. montezumae | 32 | 54 | 3061 | 19°15′17″ N; 98°04′55″ O | 4 | |
| 7 | P. montezumae | 56 | 53 | 2931 | 19°15′51″ N; 98°05′23″ O | 3 | |
| 8 | P. patula | 35 | 53 | 2923 | 19°41′31″ N; 98°04′43″ O | Sierra de Tlaxco-Caldera-Huamantla | 22 |
| 9 | P. patula | 58 | 51 | 2853 | 19°41′35″ N; 98°04′44″ O | 16 | |
| 10 | P. patula | 26 | 54 | 2903 | 19°41′34″ N; 98°04′43″ O | 19 |
| Indole Test | ||||||
|---|---|---|---|---|---|---|
| Strain | µg/mL Intracelular | Metabolic Pathway | Siderophores | P Solubilizing | ARA % | Substrate |
| C1MPm | 137 | IPyA | + | - | - | R |
| C13MPm | 1 | IPyA | - | 1.5 | 13 | R |
| C16MPm | 186 | IPyA | + | 1.5 | - | R |
| C18MPm | 285 | IPyA | + | 1.7 | - | R |
| C25MPm | 4 | IPyA | + | 0.4 | - | R |
| C28MPm | 189 | IPyA | - | - | - | E |
| C38STPp | 4 | IPyA | + | 0.9 | - | E |
| C39STPp | 82 | IPyA | + | 2 | - | R |
| C52STPp | 78 | IPyA | + | - | - | R |
| C54STPp | 305 | IPyA | + | 2.6 | - | R |
| C59STPp | 88 | IPyA | + | - | - | R |
| C63STPp | 1 | TAM IAM | - | 0.7 | - | R |
| C65STPp | 2 | IPyA | + | - | 15 | R |
| C68STPp | 2 | IPyA | + | - | - | R |
| C74STPp | 110 | IPyA | + | - | 74 | R |
| C99STPp | 95 | IPyA | - | - | - | E |
| Strain | Genus | prnD | phlD | phzF | pltC | acdS | Substrate |
|---|---|---|---|---|---|---|---|
| C1MPm | Serratia sp. | - | - | - | - | - | R |
| C13MPm | N/D | + | - | - | - | - | R |
| C16MPm | Serratia sp. | - | - | - | - | - | R |
| C18MPm | Serratia sp. | - | - | - | - | - | R |
| C25MPm | Serratia sp. | - | - | - | - | + | R |
| C28MPm | Buttiauxella sp. | + | - | - | - | - | E |
| C38STPp | N/D | + | - | - | - | - | E |
| C39STPp | N/D | - | - | - | - | - | R |
| C52STPp | Serratia sp. | - | - | - | - | - | R |
| C54STPp | Serratia sp. | - | - | - | - | - | R |
| C59STPp | Serratia sp. | - | - | - | - | - | R |
| C63STPp | Bacillus sp. | - | - | - | - | - | R |
| C65STPp | N/D | - | - | - | - | - | R |
| C68STPp | N/D | - | - | - | - | - | R |
| C74STPp | N/D | - | - | - | - | - | R |
| C99STPp | Bacillus cereus | - | - | - | - | - | E |
| Treatment | UFC/mL Inoculate | UFC/Seed | Germination Speed Index (GSI) | Germinated Seeds | ||
|---|---|---|---|---|---|---|
| P. montezumae | P. patula | P. montezumae | P. patula | |||
| C1MPm | 6 × 109 | 2 × 108 | 0.306 | 0.264 | 3 ± 0.25 | 4 ± 0 |
| C13MPm | 6 × 109 | 2 × 107 | 0.278 | 0.278 | 3 ± 0.25 | 4 ± 0 |
| C16MPm | 6 × 109 | 2 × 108 | 0.472 | 0.278 | 4 ± 0 | 4 ± 0 |
| C18MPm | 6 × 109 | 2 × 108 | 0.556 | 0.417 | 4 ± 0 | 4 ± 0 |
| C25MPm | 6 × 109 | 2 × 107 | 0.194 | 0.389 | 3 ± 0.25 | 4 ± 0 |
| C28MPm | 6 × 109 | 2 × 109 | 0.306 | 0.264 | 4 ± 0 | 4 ± 0 |
| C38STPp | 6 × 109 | 2 × 109 | 0.306 | 0.306 | 3 ± 0.25 | 4 ± 0 |
| C39STPp | 6 × 109 | 2 × 108 | 0.417 | 0.389 | 4 ± 0 | 4 ± 0 |
| C52STPp | 6 × 109 | 2 × 107 | 0.417 | 0.333 | 4 ± 0 | 4 ± 0 |
| C54STPp | 6 × 109 | 2 × 107 | 0.250 | 0.278 | 3 ± 0.25 | 4 ± 0 |
| C59STPp | 6 × 109 | 2 × 109 | 0.250 | 0.194 | 3 ± 0.25 | 3 ± 0.25 |
| C63STPp | 6 × 109 | 2 × 108 | 0.417 | 0.250 | 4 ± 0 | 4 ± 0 |
| C65STPp | 6 × 109 | 2 × 106 | 0.306 | 0.264 | 4 ± 0 | 4 ± 0 |
| C68STPp | 6 × 109 | 2 × 107 | 0.306 | 0.306 | 3 ± 0.25 | 4 ± 0 |
| C74STPp | 6 × 109 | 2 × 109 | 0.500 | 0.361 | 4 ± 0 | 4 ± 0 |
| C99STPp | 6 × 109 | 2 × 107 | 0.417 | 0.417 | 4 ± 0 | 4 ± 0 |
| Control | - | - | 0.097 | 0.097 | 2 ± 0.3 | 2 ± 0.3 |
| Strain | Height (cm) | Root Length (cm) | Root Diameter (mm) | Number of Roots | ||||
|---|---|---|---|---|---|---|---|---|
| P. montezumae | P. patula | P. montezumae | P. patula | P. montezumae | P. patula | P. montezumae | P. patula | |
| C1MPm | 12.6 ± 0.9 abc | 27.7 ± 0.9 a | 1 ± 0.02 bc | 8 ± 0.5 bcde | ||||
| C13MPm | 10.8 ± 0.9 bc | 23.5 ± 0.9 a | 1 ± 0.02 abc | 7 ± 0.6 cdef | ||||
| C16MPm | 9.7 ± 0.7 ab | 10.8 ± 0.6 bc | 23.7 ± 0.9 abc | 25.1 ± 0.9 a | 1 ± 0.03 ab | 2 ± 0.01 ab | 9 ± 0.6 abcd | 9 ± 0.5 abcde |
| C18MPm | 11.6 ± 0.8 a | 11.1 ± 0.9 abc | 32.1 ± 0.9 bc | 26.2 ± 0.9 a | 1 ± 0.01 ab | 2 ± 0.02 ab | 10 ± 0.3 ab | 6 ± 0.9 def |
| C25MPm | 9.6 ± 0.6 bcd | 9.0 ± 0.7 bcd | 17.5 ± 0.9 c | 22.9 ± 0.9 a | 1 ± 0.01 ab | 1 ± 0.02 bc | 7 ± 0.9 abcd | 7 ± 0.3 cdef |
| C28MPm | 10.1 ± 0.4 ab | 10.2 ± 0.9 bc | 29.5 ± 0.9 ab | 27.0 ± 0.9 a | 1 ± 0 ab | 1 ± 0.02 abc | 9 ± 0.9 abcd | 9 ± 0.7 abcde |
| C38STPp | 13.6 ± 0.6 ab | 23.2 ± 0.9 a | 2 ± 0.01 ab | 11 ± 0.7 ab | ||||
| C39STPp | 9.4 ± 0.4 b | 13.2 ± 0.6 abc | 24.8 ± 0.9 abc | 21.8 ± 0.9 a | 1 ± 0.01 ab | 2 ± 0.02 ab | 9 ± 0.5 abc | 11 ± 0.6 abc |
| C52STPp | 10.7 ± 0.9 ab | 9 ± 0.8 bcd | 19.9 ± 0.9 bc | 26.4 ± 0.9 a | 2 ± 0.03 a | 2 ± 0.01 ab | 9 ± 0.5 abcd | 6 ± 0.3 ef |
| C54STPp | 10.8 ± 0.5 ab | 13.3 ± 0.9 abc | 26.1 ± 0.9 abc | 22.1 ± 0.9 a | 2 ± 0.02 a | 2 ± 0.02 ab | 6 ± 0.5 abcd | 10 ± 0.5 abcd |
| C59STPp | 10.4 ± 0.4 ab | 19.7 ± 0.9 bc | 2 ± 0.03 a | 6 ± 0.8 bcd | ||||
| C63STPp | 10.3 ± 0.05 ab | 8.7 ± 0.4 cd | 26.3 ± 0.9 abc | 23.0 ± 0.9 ab | 2 ± 0.02 ab | 2 ± 0.01 ab | 6 ± 0.4 abcd | 9 ± 0.3 ef |
| C65STPp | 9 ± 0.9 bcd | 30.6 ± 0.9 a | 2 ± 0.01 ab | 11 ± 0.3 abc | ||||
| C68STPp | 10.3 ± 0.8 ab | 9 ± 0.6 bcd | 25.2 ± 0.9 abc | 24.3 ± 0.9 a | 2 ± 0.02 a | 1 ± 0.01 abc | 8 ± 0.9 abcd | 6 ± 0.4 abcde |
| C74STPp | 11.7 ± 0.8 a | 16.7 ± 0.9 a | 28.7 ± 0.9 abc | 27.7 ± 0.9 a | 2 ± 0.04 a | 2 ± 0.01 a | 10 ± 0.9 a | 11 ± 0.6 a |
| C99STPp | 11.0 ± 0.4 ab | 13.3 ± 0.7 abc | 22.3 ± 0.9 abc | 23.5 ± 0.9 a | 2 ± 0.02 a | 2 ± 0.01 ab | 9 ± 0.8 abcd | 10 ± 0.6 abc |
| Control | 5.1 ± 0.6 c | 5 ± 0.8 d | 5.9 ± 0.9 d | 6.4 ± 0.8 b | 0.6 ± 0.01 b | 0.8 ± 0.03 c | 2 ± 0.8 e | 4 ± 0.9 fg |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Moreno-Valencia, F.D.; Plascencia-Espinosa, M.Á.; Morales-García, Y.E.; Muñoz-Rojas, J. Selection and Effect of Plant Growth-Promoting Bacteria on Pine Seedlings (Pinus montezumae and Pinus patula). Life 2024, 14, 1320. https://doi.org/10.3390/life14101320
Moreno-Valencia FD, Plascencia-Espinosa MÁ, Morales-García YE, Muñoz-Rojas J. Selection and Effect of Plant Growth-Promoting Bacteria on Pine Seedlings (Pinus montezumae and Pinus patula). Life. 2024; 14(10):1320. https://doi.org/10.3390/life14101320
Chicago/Turabian StyleMoreno-Valencia, Francisco David, Miguel Ángel Plascencia-Espinosa, Yolanda Elizabeth Morales-García, and Jesús Muñoz-Rojas. 2024. "Selection and Effect of Plant Growth-Promoting Bacteria on Pine Seedlings (Pinus montezumae and Pinus patula)" Life 14, no. 10: 1320. https://doi.org/10.3390/life14101320
APA StyleMoreno-Valencia, F. D., Plascencia-Espinosa, M. Á., Morales-García, Y. E., & Muñoz-Rojas, J. (2024). Selection and Effect of Plant Growth-Promoting Bacteria on Pine Seedlings (Pinus montezumae and Pinus patula). Life, 14(10), 1320. https://doi.org/10.3390/life14101320

