Resistance Evaluation for Native Potato Accessions against Late Blight Disease and Potato Cyst Nematodes by Molecular Markers and Phenotypic Screening in India
Abstract
:1. Introduction
2. Materials and Methods
2.1. Plant Materials
2.2. Molecular Marker Analysis
2.3. Late Blight Resistance Assay
2.4. Potato Cyst Nematode Assay
3. Results
3.1. Development of an Indian Native Potato Collection
3.2. Marker-Based Screening for Late Blight and PCN Resistance Genes
3.3. Phenotypic Screening for Late Blight and PCN Resistance
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Hawkes, J.G. The Potato: Evolution, Biodiversity and Genetic Resources; Belhaven Press: Washington, DC, USA, 1990. [Google Scholar]
- Spooner, D.M.; Ghislain, M.; Simon, R.; Jansky, S.H.; Gavrilenko, T. Systematics, diversity, genetics, and evolution of wild and cultivated potatoes. Bot. Rev. 2014, 80, 283–383. [Google Scholar] [CrossRef]
- Chakrabarti, S.K.; Conghua, X.; Tiwari, J.K. The Potato Genome; Springer: Cham, Switzerland, 2017. [Google Scholar]
- Pushkarnath. Potato in India-Varieties; Indian Council of Agricultural Research: New Delhi, India, 1969; p. 493. [Google Scholar]
- Tiwari, J.K.; Sundaresha, S.; Singh, B.P.; Kaushik, S.K.; Chakrabarti, S.K.; Bhardwaj, V.; Chandel, P. Molecular markers for late blight resistance breeding of potato: An update. Plant Breed. 2013, 132, 237–245. [Google Scholar] [CrossRef]
- Luthra, S.K.; Gupta, V.K.; Tiwari, J.K.; Kumar, V.; Bhardwaj, V.; Sood, S.; Dalamu; Kaur, R.P.; Kumar, R.; Vanishree, G.; et al. Potato Breeding in India-Editors: Potato Breeding in India; CPRI Technical Bulletin No 74 (revised); ICAR-Central Potato Research Institute: Shimla, India, 2020; p. 214. [Google Scholar]
- Dalamu; Bhardwaj, V.; Umamaheshwari, R.; Sharma, R.; Kaushik, S.K.; Joseph, T.A.; Singh, B.P.; Gebhardt, C. Potato cyst nematode (PCN) resistance: Genes, genotypes and markers–an update. SABRAO J. Breed. Genet. 2012, 44, 202–228. [Google Scholar]
- Bradshaw, J.E.; Bryan, G.J.; Ramsay, G. Genetic resources (including wild and cultivated Solanum species) and progress in their utilisation in potato breeding. Potato Res. 2006, 49, 49–65. [Google Scholar] [CrossRef]
- Murashige, T.; Skoog, F. A revised medium for rapid growth and bioassays with tobacco tissue culture. Physiol. Plant 1962, 15, 473–497. [Google Scholar] [CrossRef]
- Tiwari, J.K.; Chandel, P.; Gupta, S.; Gopal, J.; Singh, B.P.; Bhardwaj, V. Analysis of genetic stability of in vitro propagated potato microtubers using DNA markers. Physiol. Mol. Biol. Plants 2013, 19, 587–595. [Google Scholar] [CrossRef] [Green Version]
- Tiwari, J.K.; Devi, S.; Sharma, S.; Chandel, P.; Rawat, S.; Singh, B.P. Allele mining in Solanum germplasm: Cloning and characterization of RB-homologous gene fragments from late blight resistant wild potato species. Plant Mol. Biol. Rep. 2015, 33, 1584–1598. [Google Scholar] [CrossRef]
- Gebhardt, C.; Ballvora, A.; Walkemeier, B.; Oberhagemann, P.; Schüler, K. Assessing genetic potential in germplasm collections of crop plants by marker-trait association: A case study for potatoes with quantitative variation of resistance to late blight and maturity type. Mol Breed. 2004, 13, 93–102. [Google Scholar] [CrossRef] [Green Version]
- Kim, H.-J.; Lee, H.-R.; Jo, K.-R.; Mortazavian, S.M.M.; Huigen, D.J.; Evenhuis, B.; Kessel, G.; Visser, R.G.F.; Jacobsen, E.; Vossen, J.H. Broad spectrum late blight resistance in potato differential set plants MaR8 and MaR9 is conferred by multiple stacked R genes. Theor. Appl. Genet. 2012, 124, 923–935. [Google Scholar] [CrossRef] [Green Version]
- Sokolova, E.; Pankin, A.; Beketova, M.; Kuznetsova, M.; Spiglazova, S.; Rogozina, E.; Yashina, I.; Khavkin, E. SCAR markers of the R-genes and germplasm of wild Solanum species for breeding late blight-resistant potato cultivars. Plant Genet. Resour. 2011, 9, 309–312. [Google Scholar] [CrossRef]
- Galek, R.; Rurek, M.; De Jong, W.; Pietkiewicz, G.; Augustyniak, H.; Sawicka-Sienkiewicz, E. Application of DNA markers linked to the potato H1 gene conferring resistance to pathotype Ro1 of Globodera rostochiensis. J. Appl. Genet. 2011, 52, 407–411. [Google Scholar] [CrossRef]
- Schultz, L.; Cogan, N.O.I.; Mclean, K.; Dale, M.F.B.; Bryan, G.J.; Forster, J.W.; Slater, A.T. Evaluation and implementation of a potential diagnostic molecular marker for H1-conferred potato cyst nematode resistance in potato (S. tuberosum L.). Plant Breed. 2012, 131, 315–321. [Google Scholar] [CrossRef]
- Asano, K.; Kobayashi, A.; Tsuda, S.; Nishinaka, M.; Tamiya, S. DNA marker-assisted evaluation of potato genotypes for potential resistance to potato cyst nematode pathotypes not yet invading into Japan. Breed. Sci. 2012, 62, 142–150. [Google Scholar] [CrossRef] [Green Version]
- Sattarzadeh, A.; Achenbach, U.; Lübeck, J.; Strahwald, J.; Tacke, E.; Hofferbert, H.R.; Rothsteyn, T.; Gebhardt, C. Single nucleotide polymorphism (SNP) genotyping as bases for developing a PCR-based marker highly diagnostic for potato varieties with high resistance to Globodera pallida pathotype Pa2/3. Mol. Breed. 2006, 18, 301–312. [Google Scholar] [CrossRef] [Green Version]
- Bryan, G.J.; Bradshaw, J.E.; De Jong, W.; Phillips, M.; Castelli, L.; Waugh, R. Mapping QTLs for resistance to the cyst nematode Globodera pallida derived from the wild potato species Solanum vernei. Theor. Appl. Genet. 2002, 105, 68–77. [Google Scholar] [CrossRef]
- Shaner, G.; Finney, R.E. The effect of nitrogen fertilization on the expression of slow mildewing resistance in Knox wheat. Phytopathology 1977, 67, 1051–1056. [Google Scholar] [CrossRef] [Green Version]
- Singh, B.P.; Bhattacharyya, S.K. Field resistance to late blight of four Indian potato cultivars. Potato Res. 1995, 38, 171–178. [Google Scholar] [CrossRef]
- Krishna Prasad, K.S. Potato Cyst Nematodes and Their Management in Nilgiris; TechBull CPRI: Shimla, India, 2006; p. 20. [Google Scholar]
- Milczarek, D.; Flis, B.; Przetakiewicz, A. Suitability of molecular markers for selection of potatoes resistant to Globodera spp. Am. J. Potato Res. 2011, 88, 245–255. [Google Scholar] [CrossRef]
- Sharma, R.; Bhardwaj, V.; Dalamu, D.; Kaushik, S.K.; Singh, B.P.; Sharma, S.; Umamaheshwari, R.; Baswaraj, R.; Kumar, V.; Gebhardt, C. Identification of elite potato genotypes possessing multiple disease resistance genes through molecular approaches. Sci. Hortic. 2014, 179, 204–211. [Google Scholar] [CrossRef]
- Limantseva, L.; Mironenko, N.; Shuvalov, O.; Antonova, O.; Khiutti, A.; Novikova, L.; Afanasenko, O.; Spooner, D.; Gavrilenko, T. Characterization of resistance to Globodera rostochiensis pathotype Ro1 in cultivated and wild potato species accessions from the Vavilov Institute of Plant Industry. Plant Breed. 2014, 133, 660–665. [Google Scholar] [CrossRef]
- Lopez-Pardo, R.; Barandalla, L.; Ritter, E.; Galarreta, R. Validation of molecular markers for pathogen resistance in potato. Plant Breed. 2013, 132, 246–251. [Google Scholar] [CrossRef]
- Tiwari, J.K.; Buckseth, T.; Zinta, R.; Bhatia, N.; Dalamu, D.; Naik, S.; Poonia, A.K.; Kardile, H.B.; Challam, C.; Singh, R.K.; et al. Germplasm, breeding, and genomics in potato improvement of biotic and abiotic stresses tolerance. Front. Plant Sci. 2022, 13, 805671. [Google Scholar] [CrossRef] [PubMed]
- Sudha, R.; Venkatasalam, E.P.; Bairwa, A.; Bhardwaj, V.; Dalamuj; Sharma, R. Identification of potato cyst nematode resistant genotypes using molecular markers. Sci. Hort. 2016, 198, 21–26. [Google Scholar] [CrossRef]
- Bhardwaj, V.; Salej, S.; Ashwani, K.; Vanishree, G.; Sanjeev, S.; Sundaresha, S. Efficiency and reliability of marker assisted selection for resistance to major biotic stresses in potato. Potato J. 2019, 46, 56–66. [Google Scholar]
Disease | Marker | Gene | Primer Sequence (5′→3′) | Annealing Temperature (°C) | Size (bp) (Resistant) | References |
---|---|---|---|---|---|---|
Late blight (Phytophthora infestans) | CosA | R1 | F: CTCATTCAAAATCAGTTTTGATC R: GAATGTTGAATCTTTTTGTGAAGG | 55 | 210 | Gebhardt et al. [12] |
R2 | Rpi-abpt | F: GCTCCTGATACGATCCATG R: ACGGCTTCTTGAATGAA | 55 | 686 | Kim et al. [13] | |
R3-1380 | R3 | F: GCTTCCGACATGTATTGATCTCCC R: GGCAGCCACTTCAGCTTCTTACAG | 60 | 1380 | Sokolova et al. [14] | |
Potato cyst nematode G. rostochiensis/ G. pallida) | TG689 | H1 (Ro1, 4) | F: TAAAACTCTTGGTTATAGCCTAT R: CAATAGAATGTGTTGTTTCACCAA | 55 | 141 | Galek et al. [15] |
57R | H1 (Ro1, 4) | F: TGCCTGCCTCTCCGATTTCT R: GGTTCAGCAAAAGCAAGGACGTG | 62 | 452 | Schultz et al. [16] | |
BCH | H1 (Ro1, 4) | F: CATGACATAGTTTGAATTTTGAGTC R: CGTTTGGCGCTGCCGTAAGTT | 55 | 290 | Galeket al. [15] | |
Gro1-4-1 | Gro1-4 (Ro1) | F: AAGCCACAACTCTACTGGAG R: GATATAGTACGTAATCATGCC | 62 | 602 | Asano et al. [17] | |
HC | GpaVvrn_QTL (Pa2/3) | F: ACACCACCTGTTTGATAAAAAACT R: GCCTTACTTCCCTGCTGAAG | 60 | 276 | Sattarzadeh et al. [18] | |
SPUD1636 | Gpa5_QTL (Pa2,3) | F: GTGCGCACAGGGTAAAACC R: ACCTTAGCGGATGAAAGCC | 60 | - | Bryan et al. [19] |
Sr. No. | Accession | Late Blight | Potato Cyst Nematode | ||||||
---|---|---|---|---|---|---|---|---|---|
G. rostochiensis (Ro1, 4) | G. pallida (Pa2,3) | ||||||||
Marker (CosA210) | Phenotype Assay | Marker (TG689141) | Marker (57R452) | Marker (Gro1-4-1602) | Phenotype Assay | Marker (HC276) | Phenotype Assay | ||
1. | Aber Chaibi | − | S | − | − | − | S | + | S |
2. | AGR/56 | − | HS | − | − | − | S | + | HS |
3. | Alpha | − | S | − | − | − | S | − | S |
4. | Aruconia | + | S | − | − | − | S | + | S |
5. | Assamia Aloo | + | HS | − | − | − | HS | + | MR |
6. | Australian White | + | MR | − | − | − | HS | + | HS |
7. | Badami Aloo | − | S | − | − | − | S | + | S |
8. | Bareilly Red | − | HS | − | − | − | HS | − | HS |
9. | Beeta | − | S | − | − | − | HS | + | S |
10. | Bengal Jyoti | − | HS | − | − | − | HS | − | S |
11. | Bhura Aloo | − | HS | − | − | − | HS | + | S |
12. | Brondiar Slave | − | S | − | − | − | HS | + | S |
13. | Burma Special | − | HS | − | − | − | S | + | MR |
14. | C-9-Patna | − | S | − | − | − | HS | − | HS |
15. | Champaran Lal | − | HS | − | − | − | HS | + | MR |
16. | Clone 1 | − | S | − | − | − | HS | + | HS |
17. | Dehati Aloo | − | S | − | − | − | HS | + | MR |
18. | Deshla Lal | − | HS | − | − | − | S | + | S |
19. | Desi Aloo | − | R | − | − | − | HS | − | S |
20. | Desi No. 1 | − | S | − | − | − | HS | + | S |
21. | Desi No. 2 | − | HS | − | − | − | HS | − | HS |
22. | Dhankri or Tumri | − | HS | − | − | − | HS | + | HS |
23. | DRR Blue | − | HS | − | − | − | HS | + | HS |
24. | Dwarf Culture | − | HS | − | − | − | HS | − | S |
25. | G-4 | − | MR | − | − | − | HS | + | S |
26. | Garlentic | − | HS | − | + | − | HR | + | HR |
27. | Gulabia | − | HS | − | − | − | S | + | MR |
28. | Gulmarg Special | − | HS | − | − | − | S | − | MR |
29. | Hamraj Hatti | − | HS | − | − | − | S | − | MR |
30. | Hyb-3 | − | HS | − | − | − | HS | − | MR |
31. | Jalandhar | − | S | − | − | − | S | − | S |
32. | Jeevan Jyoti | − | HS | + | + | − | HR | + | HR |
33. | JG 12 | − | S | − | − | − | S | + | MR |
34. | JG-1 | − | HR | + | + | + | HR | − | HR |
35. | JG-22 | − | S | − | − | − | HS | + | S |
36. | JG-25 | − | HS | − | − | − | MR | + | MR |
37. | JG-27 | − | S | − | − | − | S | + | S |
38. | JG-56 | − | S | − | − | − | HS | + | HS |
39. | K-22 | − | HS | − | − | − | HS | − | HS |
40. | Kacha Bhutia | − | HS | − | − | − | S | + | S |
41. | Kala Aloo | − | HS | − | − | − | S | + | S |
42. | Kanpuria Safed | − | HR | − | − | − | HS | + | HS |
43. | KP/PC-292 | − | HS | − | − | − | HS | + | MR |
44. | Lah Arpor | − | HS | − | − | − | HS | − | S |
45. | Lah Ipon | − | S | − | − | − | HS | + | HS |
46. | Lah Polin | − | S | − | − | − | S | + | MR |
47. | Lah Sarkari | − | HS | − | − | − | MR | + | S |
48. | Lah Saw | − | HS | − | − | − | HS | − | MR |
49. | Lah Saw Khasi | − | HS | − | − | − | MR | − | MR |
50. | Lah Saw Smit | − | HS | − | − | − | HS | + | S |
51. | Lah Synthiew | − | S | − | − | − | S | + | MR |
52. | Lah Tora | − | HS | − | − | − | S | + | S |
53. | Lal Ankh | − | HS | − | − | − | HS | − | HS |
54. | Lal Gulab | + | S | − | − | − | HS | + | MR |
55. | Lal Laukar | − | HS | − | − | − | S | + | MR |
56. | Lal Mitti 1 | − | HS | − | − | − | HS | − | HS |
57. | Lal Mitti 2 | − | HS | − | − | − | HS | − | HS |
58. | Nainital | − | HS | − | − | − | HS | + | HS |
59. | NJ-12 | + | S | − | − | − | HS | + | HS |
60. | NJ-130 | − | S | − | − | − | HS | + | S |
61. | NJ-23 | − | S | − | − | − | HS | + | HS |
62. | NJ-2303 | − | S | − | − | − | HS | + | HS |
63. | NJ-42 | − | HS | − | − | − | MR | + | MR |
64. | NJ-47 | + | MR | − | + | − | S | + | MR |
65. | NJ-56 | − | S | − | − | − | S | + | MR |
66. | NJ-62 | + | MR | − | − | − | S | + | MR |
67. | NJ-75 | − | HS | − | − | − | HS | − | HS |
68. | NJ-78 | + | HS | − | − | − | S | + | S |
69. | NJ-84 | − | HS | − | − | − | S | + | MR |
70. | ON-1645 | − | HS | − | − | − | HS | − | S |
71. | PH/C-11 | − | S | − | − | − | S | − | MR |
72. | Phulwa Red | − | HS | − | − | − | MR | + | R |
73. | Phulwa Red Splashed | − | HS | − | − | − | S | + | MR |
74. | Phulwa White | + | HS | − | − | − | HS | + | HS |
75. | Pimpernell | − | HS | − | − | − | HS | + | HS |
76. | PS-4904 | − | HS | − | − | − | HS | − | MR |
77. | PSK-76 | − | HS | − | − | − | HS | + | HS |
78. | R-1 | − | HS | − | − | − | S | + | MR |
79. | R-2 | − | HS | − | − | − | HS | − | S |
80. | R-3 | − | S | − | − | − | S | + | S |
81. | Rangpuria | − | HR | + | + | − | S | + | HS |
82. | Red Flesh | − | HS | − | − | − | S | + | MR |
83. | Sathoo | − | S | − | − | − | S | + | S |
84. | Sisa Pani | − | HS | − | − | − | MR | + | MR |
85. | Ultimus | − | HS | − | − | − | HS | − | R |
86. | UP to Date | − | S | − | − | − | HS | + | HS |
87. | V2-2912 | − | S | − | − | − | HS | − | S |
88. | Var 3797 | + | HS | − | − | − | HS | + | HS |
89. | VB-8 | − | HS | − | − | − | S | − | S |
90. | VK/JG-1 | − | HS | − | − | − | HS | + | HS |
91. | VK/JG-2 | + | MR | − | − | − | HS | + | MR |
92. | 1001 | − | HS | − | − | − | HS | − | HS |
93. | 1007 | − | HS | − | − | − | HS | − | HS |
94. | 1591/11 | − | HS | − | − | − | HS | − | HS |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dalamu; Tiwari, J.K.; Bairwa, A.; Bhatia, N.; Zinta, R.; Kaushal, N.; Kumar, V.; Sharma, A.K.; Sharma, S.; Choudhary, B.; et al. Resistance Evaluation for Native Potato Accessions against Late Blight Disease and Potato Cyst Nematodes by Molecular Markers and Phenotypic Screening in India. Life 2023, 13, 33. https://doi.org/10.3390/life13010033
Dalamu, Tiwari JK, Bairwa A, Bhatia N, Zinta R, Kaushal N, Kumar V, Sharma AK, Sharma S, Choudhary B, et al. Resistance Evaluation for Native Potato Accessions against Late Blight Disease and Potato Cyst Nematodes by Molecular Markers and Phenotypic Screening in India. Life. 2023; 13(1):33. https://doi.org/10.3390/life13010033
Chicago/Turabian StyleDalamu, Jagesh Kumar Tiwari, Aarti Bairwa, Nisha Bhatia, Rasna Zinta, Nimisha Kaushal, Vinod Kumar, Ashwani K. Sharma, Sanjeev Sharma, Babita Choudhary, and et al. 2023. "Resistance Evaluation for Native Potato Accessions against Late Blight Disease and Potato Cyst Nematodes by Molecular Markers and Phenotypic Screening in India" Life 13, no. 1: 33. https://doi.org/10.3390/life13010033