Identification and Expression Analysis of Wnt2 Gene in the Sex Differentiation of the Chinese Soft-Shelled Turtle (Pelodiscus sinensis)
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Tissue Distribution of Wnt2 Transcripts
2.3. Cloning of Full-Length cDNAs Encoding Wnt2
2.4. Sequence Alignment and Analysis
2.5. Wnt Agonist Treatment
2.6. Statistical Analysis
3. Results
3.1. Cloning and Sequence Analysis
3.2. Expression Pattern of PsWnt2 during Embryonic Development
3.3. Tissue Distribution of PsWnt2 mRNA
3.4. Effects of a Wnt Agonist on P. sinensis Wnt2 Expression
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Liang, H.; Meng, Y.; Cao, L.; Li, X.; Zou, G. Effect of exogenous hormones on R-spondin 1 (RSPO1) gene expression and embryo development in Pelodiscus sinensis. Reprod. Fertil. Dev. 2019, 31, 1425–1433. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ji, X.; Chen, F.; Du, W.; Chen, H. Incubation temperature affects hatchling growth but not sexual phenotype in the Chinese soft-shelled turtle, Pelodiscus sinensis (Trionychidae). J. Zool. 2003, 261, 409–416. [Google Scholar] [CrossRef] [Green Version]
- Li, H.; Zhou, Z.S.; Wu, T.; Wu, Y.Q.; Ji, X. Do fluctuations in incubation temperature affect hatchling quality in the Chinese soft-shelled turtle Pelodiscus sinensis? Aquaculture 2013, 406, 91–96. [Google Scholar] [CrossRef]
- Ma, X.; Cen, S.; Wang, L.; Zhang, C.; Wu, L.; Tian, X.; Wu, Q.; Li, X.; Wang, X. Genome-wide identification and comparison of differentially expressed profiles of miRNAs and lncRNAs with associated ceRNA networks in the gonads of Chinese soft-shelled turtle, Pelodiscus sinensis. BMC Genom. 2020, 21, 443. [Google Scholar] [CrossRef] [PubMed]
- Mu, Y.; Zhao, B.; Tang, W.-Q.; Sun, B.-J.; Zeng, Z.-G.; Valenzuela, N.; Du, W.-G. Temperature-dependent sex determination ruled out in the Chinese soft-shelled turtle (Pelodiscus sinensis) via molecular cytogenetics and incubation experiments across populations. Sex. Dev. 2015, 9, 111–117. [Google Scholar] [CrossRef]
- Lu, F.I.; Thisse, C.; Thisse, B. Identification and mechanism of regulation of the zebrafish dorsal determinant. Proc. Natl. Acad. Sci. USA 2011, 108, 15876–15880. [Google Scholar] [CrossRef] [Green Version]
- Yao, M.; Fang, M.; Zheng, W.J.; Yao, D.F. Oncogenic Wnt3a: A promising specific biomarker in hepatocellular carcinoma. Hepatoma Res. 2018, 4, 30. [Google Scholar] [CrossRef] [Green Version]
- Yin, A.; Winata, C.L.; Korzh, S.; Korzh, V.; Gong, Z. Expression of components of Wnt and Hedgehog pathways in different tissue layers during lung development in Xenopus laevis. Gene Expr. Patterns 2010, 10, 338–344. [Google Scholar] [CrossRef]
- Zhang, B.; Tran, U.; Wessely, O. Expression of Wnt signaling components during Xenopus pronephros development. PloS ONE 2011, 6, e26533. [Google Scholar] [CrossRef]
- Barlian, A.; Vanawati, N.; Ayuningtyas, F.D. The patterns of sex determination and differentiation genes in green sea turtle (Chelonia mydas). Berk. Penelit. Hayati 2015, 20, 15–20. [Google Scholar] [CrossRef]
- Zhang, Y.; Xiao, L.; Sun, W.; Li, P.; Zhou, Y.; Qian, G.; Ge, C. Knockdown of R-spondin1 leads to partial sex reversal in genetic female Chinese soft-shelled turtle Pelodiscus sinensis. Gen. Comp. Endocrinol. 2021, 309, 113788. [Google Scholar] [CrossRef] [PubMed]
- Biason-Lauber, A. WNT4, RSPO1, and FOXL2 in sex development. Semin. Reprod. Med. 2012, 30, 387–395. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dailey, W.A.; Gryc, W.; Garg, P.G.; Drenser, K.A. Frizzled-4 variations associated with retinopathy and intrauterine growth retardation: A potential marker for prematurity and retinopathy. Ophthalmology 2015, 122, 1917–1923. [Google Scholar] [CrossRef] [PubMed]
- Drenser, K.A. Wnt signaling pathway in retinal vascularization. Eye Brain 2016, 8, 141. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Z.; Zhang, L.; Zhang, L.; Jia, L.; Wang, P.; Gao, Y. Association of Wnt2 and sFRP4 expression in the third trimester placenta in women with severe preeclampsia. Reprod. Sci. 2013, 20, 981–989. [Google Scholar] [CrossRef] [Green Version]
- Boyer, A.; Goff, A.K.; Boerboom, D. WNT signaling in ovarian follicle biology and tumorigenesis. Trends Endocrinol. Metab. 2010, 21, 25–32. [Google Scholar] [CrossRef]
- Ferreira, J.C.; Choufani, S.; Grafodatskaya, D.; Butcher, D.T.; Zhao, C.; Chitayat, D.; Shuman, C.; Kingdom, J.; Keating, S.; Weksberg, R. WNT2 promoter methylation in human placenta is associated with low birthweight percentile in the neonate. Epigenetics 2011, 6, 440–449. [Google Scholar] [CrossRef] [Green Version]
- Waiho, K.; Fazhan, H.; Zhang, Y.; Li, S.; Zhang, Y.; Zheng, H.; Ikhwanuddin, M.; Ma, H. Comparative profiling of ovarian and testicular piRNAs in the mud crab Scylla paramamosain. Genomics 2020, 112, 323–331. [Google Scholar] [CrossRef]
- Nicol, B.; Guiguen, Y. Expression Profiling of Wnt Signaling Genes during Gonadal Differentiation and Gametogenesis in Rainbow Trout. Sex. Dev. 2011, 5, 318–329. [Google Scholar] [CrossRef]
- Goss, A.M.; Tian, Y.; Tsukiyama, T.; Cohen, E.D.; Zhou, D.; Lu, M.M.; Yamaguchi, T.P.; Morrisey, E.E. Wnt2/2b and β-catenin signaling are necessary and sufficient to specify lung progenitors in the foregut. Dev. Cell 2009, 17, 290–298. [Google Scholar] [CrossRef]
- Du, J.; Zhang, X.; Yuan, J.; Zhang, X.; Li, F.; Xiang, J. Wnt gene family members and their expression profiling in Litopenaeus vannamei. Fish Shellfish. Immunol. 2018, 77, 233–243. [Google Scholar] [CrossRef] [PubMed]
- Robert, N.; Hammami, F.; Lhomond, G.; Dru, P.; Lepage, T.; Schubert, M.; Croce, J.C. A wnt2 ortholog in the sea urchin Paracentrotus lividus. Genesis 2019, 57, e23331. [Google Scholar] [CrossRef] [PubMed]
- Riddiford, N.; Olson, P.D. Wnt gene loss in flatworms. Dev. Genes Evol. 2011, 221, 187. [Google Scholar] [CrossRef]
- Prakash, A.; Monteiro, A. Molecular mechanisms of secondary sexual trait development in insects. Curr. Opin. Insect Sci. 2016, 17, 40–48. [Google Scholar] [CrossRef] [PubMed]
- Hu, Q.; Tian, H.; Li, W.; Meng, Y.; Wang, Q.; Xiao, H. Identification of critical sex-biased genes in Andrias davidianus by de novo transcriptome. Mol. Genet. Genom. 2019, 294, 287–299. [Google Scholar] [CrossRef] [PubMed]
- Qiao, G.Y.; Dong, B.W.; Zhu, C.J.; Yan, C.Y.; Chen, B.L. Deregulation of WNT2/FZD3/β-catenin pathway compromises the estrogen synthesis in cumulus cells from patients with polycystic ovary syndrome. Biochem. Biophys. Res. Commun. 2017, 493, 847–854. [Google Scholar] [CrossRef] [PubMed]
- Tepekoy, F.; Uysal, F.; Acar, N.; Ustunel, I.; Akkoyunlu, G. The effect of GnRH antagonist cetrorelix on Wnt signaling members in pubertal and adult mouse ovaries. Histochem. Cell Biol. 2019, 152, 423–437. [Google Scholar] [CrossRef]
- Wang, H.X.; Gillio-Meina, C.; Chen, S.; Gong, X.Q.; Li, T.Y.; Bai, D.; Kidder, G.M. The canonical WNT2 pathway and FSH interact to regulate gap junction assembly in mouse granulosa cells. Biol. Reprod. 2013, 89, 39. [Google Scholar] [CrossRef]
- Wang, Y.; Chen, Y.; Cao, M.; Wang, X.; Wang, G.; Li, J. Identification of Wnt2 in the pearl mussel Hyriopsis cumingii and its role in innate immunity and gonadal development. Fish Shellfish. Immunol. 2021, 118, 85–93. [Google Scholar] [CrossRef]
- Tokita, M.; Kuratani, S. Normal Embryonic Stages of the Chinese Softshelled Turtle Pelodiscus sinensis (Trionychidae). Zool. Sci. 2001, 18, 705–715. [Google Scholar] [CrossRef]
- Chen, M.; Zhang, Y.; Zhang, M.; Qu, C.; Zou, G.; Liang, H. Characterization and expression pattern of Wnt5b gene in Pelodiscus sinensis. Aquac. Res. 2022, 53, 2937–2946. [Google Scholar] [CrossRef]
- Liang, H.W.; Wang, L.; Sha, H.; Zou, G.W. Development and Validation of Sex-Specific Markers in Pelodiscus Sinensis Using Restriction Site-Associated DNA Sequencing. Genes 2019, 10, 302. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(–Delta Delta C(T)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Kuncewitch, M.; Yang, W.L.; Molmenti, E.; Nicastro, J.; Coppa, G.F.; Wang, P. Wnt agonist attenuates liver injury and improves survival after hepatic ischemia/reperfusion. Shock 2013, 39, 3–10. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Poulain, M.; Ober, E.A. Interplay between Wnt2 and Wnt2bb controls multiple steps of early foregut-derived organ development. Development 2011, 138, 3557–3568. [Google Scholar] [CrossRef] [Green Version]
- Deshpande, G.; Nouri, A.; Schedl, P. Wnt Signaling in Sexual Dimorphism. Genetics 2016, 202, 661–673. [Google Scholar] [CrossRef] [Green Version]
- Deepa, S.; Senthilkumaran, B. Interactive role of Wnt signaling and Zn in regulating testicular function of the common carp, Cyprinus carpio. Theriogenology 2021, 161, 161–175. [Google Scholar] [CrossRef]
- Gifford, J.H. The role of WNT signaling in adult ovarian folliculogenesis. Reproduction 2015, 150, R137–R148. [Google Scholar] [CrossRef] [Green Version]
- Marui, T.; Funatogawa, I.; Koishi, S.; Yamamoto, K.; Matsumoto, H.; Hashimoto, O.; Jinde, S.; Nishida, H.; Sugiyama, T.; Kasai, K.; et al. Association between autism and variants in the wingless-type MMTV integration site family member 2 (WNT2) gene. Int. J. Neuropsychopharmacol. 2010, 13, 443–449. [Google Scholar] [CrossRef] [Green Version]
- Janssen, R.; Posnien, N. Identification and embryonic expression of Wnt2, Wnt4, Wnt5 and Wnt9 in the millipede Glomeris marginata (Myriapoda: Diplopoda). Gene Expr. Patterns 2014, 14, 55–61. [Google Scholar] [CrossRef]
- Mork, L.; Capel, B. Conserved action of β-catenin during female fate determination in the red-eared slider turtle. Evol. Dev. 2013, 15, 96–106. [Google Scholar] [CrossRef] [PubMed]
- Finnson, K.W.; Kontogiannea, M.; Li, X.; Farookhi, R. Characterization of Wnt2 overexpression in a rat granulosa cell line (DC3): Effects on CTNNB1 activation. Biol. Reprod. 2012, 87, 12. [Google Scholar] [CrossRef] [PubMed]
- Kato, Y.; Naiki, Y.; Komatsu, T.; Takahashi, K.; Nakamura, J.; Koide, N. A Wnt Pathway Activator Induces Apoptosis and Cell Death in Mouse Monocytic Leukemia Cells. Oncol. Res. 2017, 25, 479–483. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.C.; Tsai, J.J.; Kuo, C.Y.; Chen, H.M.; Kao, S.H. Non-proteolytic house dust mite allergen, Der p 2, upregulated expression of tight junction molecule claudin-2 associated with Akt/GSK-3β/β-catenin signaling pathway. J. Cell. Biochem. 2011, 112, 1544–1551. [Google Scholar] [CrossRef]
- Satou, Y.; Imai, K.S.; Satoh, N. Early embryonic expression of a LIM-homeobox gene Cs-lhx3 is downstream of β-catenin and responsible for the endoderm differentiation in Ciona savignyi embryos. Development 2001, 128, 3559–3570. [Google Scholar] [CrossRef]
Primer Name | Primer Sequence (5′–3′) | Application |
---|---|---|
UPM | CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT | 5′ and 3′ RACE PCR |
UPM short | CTAATACGACTCACTATAGGGC | |
Wnt2-F | CGGAGTGAAGTGTTTCTAATATGAA | CDS clone |
Wnt2-R | ACAGCCTTCCTTCCCGCTCT | |
Wnt2-F2 | TCACAAGGGCATGTAGTCAAGGGGA | |
Wnt2-R2 | GTGTACGTCCACCACCTCCAGGCAG | |
Wnt2-3′-GSP | CTGTATCAGAGACTGGGATGTAGGCT | 3′ RACE |
Wnt2-qF | CAAGACGGCACTGGTTTCAC | qPCR |
Wnt2-qR | GTCCCAAGGGAGCCTACATC | |
Sox3-F | GAGTGTAGAGGTGGAATGGAAACG | |
Sox3-R | AAACCCTCAAGCAGGATACGG | |
Dmrt1-F | CCGCCTCGGGAAAGAAGTC | |
Dmrt1-R | TGCTGGATGCCGTAGTTGC | |
Wnt4-F | GAGGTGATGGACTCGGTGCG | |
Wnt4-R | CCCGTTCTTGAGGTCGTGGTC | |
Amh-F | CGGCTACTCCTCCCACACG | |
Amh-R | CCTGGCTGGAGTATTTGACGG | |
18S rRNA-F | AAAGGAATTGACGGAAGGGCAC | Internal control |
18S rRNA-R | GCTCCACCAACTAAGAACGG | |
Ps4085-F | GTTTGAAGTGCTGCTGGGAAG | Sex identification |
Ps4085-R | TTCCCCGTATAAAGCCAGGG | |
COI-F | CAACCAACCACAAAGACATTGGCAC | |
COI-R | ACCTCAGGGTGTCCGAAAATCAAA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhou, T.; Zhang, H.; Chen, M.; Zhang, Y.; Chen, G.; Zou, G.; Liang, H. Identification and Expression Analysis of Wnt2 Gene in the Sex Differentiation of the Chinese Soft-Shelled Turtle (Pelodiscus sinensis). Life 2023, 13, 188. https://doi.org/10.3390/life13010188
Zhou T, Zhang H, Chen M, Zhang Y, Chen G, Zou G, Liang H. Identification and Expression Analysis of Wnt2 Gene in the Sex Differentiation of the Chinese Soft-Shelled Turtle (Pelodiscus sinensis). Life. 2023; 13(1):188. https://doi.org/10.3390/life13010188
Chicago/Turabian StyleZhou, Tong, Haiqi Zhang, Meng Chen, Yingping Zhang, Guobin Chen, Guiwei Zou, and Hongwei Liang. 2023. "Identification and Expression Analysis of Wnt2 Gene in the Sex Differentiation of the Chinese Soft-Shelled Turtle (Pelodiscus sinensis)" Life 13, no. 1: 188. https://doi.org/10.3390/life13010188
APA StyleZhou, T., Zhang, H., Chen, M., Zhang, Y., Chen, G., Zou, G., & Liang, H. (2023). Identification and Expression Analysis of Wnt2 Gene in the Sex Differentiation of the Chinese Soft-Shelled Turtle (Pelodiscus sinensis). Life, 13(1), 188. https://doi.org/10.3390/life13010188