Next Article in Journal
Astrochemical Pathways to Complex Organic and Prebiotic Molecules: Experimental Perspectives for In Situ Solid-State Studies
Previous Article in Journal
Effects of Dietary Calcium Propionate Supplementation on Hypothalamic Neuropeptide Messenger RNA Expression and Growth Performance in Finishing Rambouillet Lambs
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

TaaI/Cdx-2 AA Variant of VDR Defines the Response to Phototherapy amongst Patients with Psoriasis

by
Aleksandra Lesiak
1,*,
Karolina Wódz
2,
Magdalena Ciążyńska
3,
Małgorzata Skibinska
1,
Michał Waszczykowski
4,
Karol Ciążyński
5,
Irmina Olejniczak-Staruch
1,
Dorota Sobolewska-Sztychny
1 and
Joanna Narbutt
1
1
Department of Dermatology, Paediatric Dermatology and Oncology, Medical University of Lodz, 91-347 Lodz, Poland
2
Department of Molecular Biology, VET-LAB Brudzew, 62-720 Brudzew, Poland
3
Nicolaus Copernicus Multidisciplinary Centre for Oncology and Traumatology, Department of Proliferative Diseases, 93-513 Lodz, Poland
4
Department of Arthroscopy, Minimally Invasive Surgery and Sports Traumatology, Medical University of Lodz, 90-549 Lodz, Poland
5
Institute of Applied Computer Science, Lodz University of Technology, 90-924 Lodz, Poland
*
Author to whom correspondence should be addressed.
Life 2021, 11(6), 567; https://doi.org/10.3390/life11060567
Submission received: 1 May 2021 / Revised: 23 May 2021 / Accepted: 14 June 2021 / Published: 16 June 2021
(This article belongs to the Section Physiology and Pathology)

Abstract

1,25-dihydroxyvitamin-D3 plays a central role in the immune system via binding to the vitamin D receptor. VDR polymorphisms have been associated with multiple autoimmune disorders, including psoriasis. Until now, five VDR polymorphisms, FokI, ApaI, BsmI, TaqI and TaaI/Cdx2, have been studied in psoriasis, with contradicting results. Therefore, this study aimed to evaluate the association of VDR polymorphisms with susceptibility to psoriasis, effectiveness of NB-UVB phototherapy and concentration of proinflammatory cytokines and vitamin D amongst the Polish population. VDR polymorphisms were analyzed by PCR-RFLP or real-time PCR. We found that the frequency of the TaaI/Cdx-2 GG genotype was significantly higher in psoriasis patients and was associated with regulation of IL-17 and IL-23 concentration. Moreover, TaaI/Cdx-2 AA might have a significant effect on the response to phototherapy amongst patients with psoriasis. Our results suggest that VDR is a susceptibility factor for psoriasis development. Moreover, TaaI/Cdx-2 variants have a significant effect on the response to phototherapy amongst patients with psoriasis and regulation of inflammatory response via decrease of IL-17 and IL-23 level after UVB phototherapy in the Polish population. Results of our study provide some evidence in support of the hypothesis that the vitamin D signaling pathway may be of relevance for pathogenesis and treatment of psoriasis.

1. Introduction

Psoriasis is a chronic autoimmune skin disease with a genetic background [1]. Its prevalence is estimated to be 2–4% worldwide [2,3]. A Polish epidemiological study by Borzecki et al. [4] in which 1,147,279 patients with psoriasis were analyzed showed that prevalence of the disease in Poland is about 2.99%. As the disease mainly affects professionally active people, it is a real socio-economic problem [5]. The presence of skin lesions is associated with a decrease in patients’ quality of life which leads to impairment in their professional, social and family life. In recent years, there has been a breakthrough in the understanding of the pathogenesis of the disease in terms of the participation of genetic, immunological [6] and environmental factors [7]. Plaque psoriasis is the most common clinical form of psoriasis vulgaris and accounts for approximately 85% of all cases. The assessment of disease activity based on the PASI (Psoriasis Area and Severity Index) index, BSA (Body Surface Area) and DLQI (Dermatology Life Quality Index) measurements is a key element in making therapeutic decisions. It is believed that the involvement of more than 10% of the skin surface by psoriatic lesions is an indication for the initiation of phototherapy or general treatment. However, there are cases in which patients experience a significant reduction in the quality of life despite the fact that the lesions occupy a smaller area, which should be taken into account in the selection of therapy [8]. PASI as well as BSA and DLQI are used to assess the severity of plaque psoriasis. PASI or BSA > 10 or DLQI > 10 define moderate to severe psoriasis. PASI, BSA and DLQI ≤ 10 relate to mild psoriasis. As psoriasis is a chronic disease, the majority of patients need continuous treatment. In recent years due to new molecular achievements, psoriatic biological treatment has been introduced against tumor necrosis factor (TNF), interleukin IL-12 and IL-23, IL-23 (IL-23p19) and IL-17. Despite the new therapeutic options, classic systemic therapies are still used, i.e., MTx (Methotrexate), CsA (cyclosporin A), oral retinoids and phototherapy [8].
UV light therapy is very important in the treatment of patients suffering from psoriasis. It is an effective, cheap method that has relatively few side effects. Narrowband UVB phototherapy, also known as TL-01 or NB-UVB (Narrowband UVB), was introduced in the 1980s and has since become one of the most common methods of light therapy [9]. The European guidelines on the basis of several other studies have determined that the use of NB-UVB irradiation twice a week causes remission within 20 weeks in 63–75% of patients. The recommendations of the AAD (American Academy of Dermatology) indicate that the initial improvement may occur within two weeks, with an average of 15–20 treatments to induce remission, and after one year this remission is maintained in 38% of patients [10]. A literature review for NB-UVB estimated PASI 75 at 62%, and when assessing the percentage of patients achieving remission (or ≥90% improvement), it was on average 68% [11].
The study comparing the use of high doses of NB-UVB (initial dose of 70% MED; minimal erythema dose), with subsequent increases by 40%) with the use of low doses of NB-UVB (initial dose of 35% MED and increase of subsequent doses by 20%) showed a similar the effectiveness of both methods, but for high doses of NB-UVB the desired effect was achieved with a smaller number of irradiations and lasted longer [12]. It has also been shown that NB-UVB is more effective when used three times a week compared to the twice weekly regimen [13,14,15].
Since the introduction of lamps with a narrow spectrum of radiation, many studies have confirmed the superiority of NB-UVB over BB-UVB (Broadband UVB). The use of narrowband UVB can led to better treatment outcomes and faster regression of the lesions [10]. The meta-analysis evaluating the effectiveness of NB-UVB and BB-UVB in the treatment of psoriasis clearly showed that the use of NB-UVB brings better results, especially in relation to plaque psoriasis [11].
As in most diseases with a complex etiology, the response to treatment is individual and often difficult to predict based on our own observations and literature data, and it is assumed that individual response to treatment is genetically determined. Therefore, determining precise phenotypes will allow for the selection of the best treatment option for patients with psoriasis in the future [11].
Vitamin D serves as regulator of the immune system. Its action depends on the vitamin D receptor (VDR), a member of the nuclear hormone receptor superfamily. The VDR gene is located on chromosome 12q12-q14. The most frequently occurring VDR polymorphisms are FokI (rs2228570), BsmI (rs1544410), ApaI (rs7975232) and TaqI (rs731236). Recently, Yamamoto et al. [16] described a functional binding site for the intestinal-specific transcription factor Cdx-2 in the 1a promoter region of the VDR gene. Subsequently, Arai et al. [17] described a G to A nucleotide substitution TaaI/Cdx-2 (rs11568820) at this Cdx-2 binding site, which was found to modulate the intestine-specific transcription of the VDR gene. In particular, the A-allele was found to more efficiently bind the Cdx-2 protein in vitro and showed increased transcription activity of the VDR promoter compared with the G allele [18]. VDR is responsible for cellular effects of vitamin D and the regulation of various intracellular signaling pathways which are involved in cell differentiation [19,20]. Genetic polymorphisms in VDR influence the level of vitamin D synthesis in the skin, liver and kidneys, as well as its metabolism and degradation. VDR is expressed in the intestine, thyroid and kidneys and has a vital role in calcium homeostasis. VDRs repress expression of 1alpha-hydroxylase (the proximal activator of 1,25(OH)2D3) and induce expression of the 1,25(OH)2D3 inactivating enzyme CYP24. VDR is expressed on keratinocytes and is a natural ligand for calcitriol which has the ability to inhibit proliferation and induces differentiation of human keratinocytes [21,22].
In some studies, associations between several gene polymorphisms and response to treatment have been assessed. It was revealed that in the case of HLA-C*06, the risk allele carriers have different responses to systemic treatment with methotrexate and biologics [23,24,25,26]. In patients who inherit at least one HLA-C*06 variant, there is a better response to methotrexate [24] as well as to ustekinumab, an inhibitor of IL-12/23 [25,26]. However, it was also shown that HLA-C*06 carriers have a poorer response to the treatment of TNF-alfa inhibitors when compared to the patients without this allele [25]. Bojko et al. [27] performed a study in which they assessed the role of IL12B, IL23A and IL23R genetic variants in susceptibility and response to treatment with NB-UVB, however they found no significant result. To the best of our knowledge, this is the first study to find genetic evidence that the VDR gene is associated with effectiveness of phototherapy. The aim of our paper is to perform an association study between VDR polymorphism, proinflammatory cytokine and vitamin D levels, and individual response to NB-UVB phototherapy commonly used in the treatment of psoriasis.

2. Materials and Methods

2.1. Subjects

The study group included 50 patients with psoriasis vulgaris (PsV) treated with NB-UVB therapy at the Department of Dermatology, Medical University of Lodz. The mean age was 42 years old (18–63 years old) and the mean duration of the disease was 20 years (from 6 months to 40 years). Fifty unrelated healthy controls (age and sex matched, Caucasian of Polish origin) were enrolled into the study. All individuals gave written informed consent before entering the study. The experimental plan was approved by the local ethics committee of the Medical University of Lodz and was conducted according to the principles of the Declaration of Helsinki. Before treatment, the intensity of psoriatic lesions was assessed in all patients by the PASI, BSA and DLQI. The mean: PASI index before phototherapy was 21.38; BSA was 33.46; DLQI was 16.2 [28,29]. The patients had II and III skin phototypes as assessed by the Fitzpatrick scale. The patients underwent irradiations with UVB NB (wavelength 311–312 nm) for 20 consecutive days with initial dose of 0.7 personal MED (minimal erythema dose). They were treated in a Dermalight-Medisun 2800 PC-AB cabin (Schulze and Böhm GmbH-Brühl, Germany) with TL100W/01 fluorescent lamps (Philips, Eindhoven, Netherlands). The mean initial dose was 0.2 J/cm2 and it was systematically increased either daily or every other day, depending on the individual patient’s reaction. The mean cumulative dose of UVB 311 radiation was 12.7 J/cm2. This regimen has been used at our department for several years and treatment results are satisfactory. The same doses were used also in other studies [30].

2.2. ELISA

Blood samples were taken amongst all subjects, once for DNA genotyping and twice to determine the concentration of TNF alpha (ELISA kits (Human HS TNF-α, R&D Systems, Minneapolis, MN, USA), IL-17 (Raybiotech INC. Norccross, GA, USA) and IL-23 (R&D System, Minneapolis Abingdon, MN, USA) with the use of ELISA according to standard manufacturer’s protocol. Moreover, in each subject the level of 25(OH)D and lipids, glucose and liver was assessed. These procedures were also repeated after the 20th irradiation.

2.3. Genotyping

DNA was extracted from whole blood using spin column-based DNA extraction kits, according to the manufacturer’s instructions (A&A Biotechnology, Gdańsk, Poland). The occurrence of the SNP: four VDR (rs2228570, rs7975232, rs1544410, rs731236) gene sequences were assessed in the patients with psoriasis and controls by a standard PCR-RFLP method with using DreamTaq Green PCR Master Mix (2X) (Thermo Scientific™, Waltham, MA, USA). PCR conditions were as follows: 1 cycle at 95 °C for 3 min for an initial denaturation, followed by 35 cycles of denaturation for 30 sec at 95 °C, primer annealing for 30 sec at 56 °C, primer extension for 1 min at 72 °C and a final extension for 7 min at 72 °C. The loci were recognized by FastDigest® restriction enzymes (Thermo Scientific™, Waltham, MA, USA), used at 37 °C for 20 min, except for TaqI which was used at 65 °C for 20 min. RFLP products were electrophoresed for 45 min and visualized on 2% agarose gels stained with ethidium bromide. The size of the restriction endonuclease digested products was determined using a GeneRuler 50 bp DNA Ladder (Thermo Scientific™, Waltham, MA, USA). A TaqMan® SNP Genotyping assay was used to detect the single nucleotide polymorphism rs11568820 (TaaI/Cdx-2—VDR, A/G). Real-Time PCRs were performed according to the manufacturer’s instructions in a 96-well format in a total reaction volume of 5 μL using 10 ng of genomic DNA and ABI Prism 7900HT (Thermo Scientific™, Waltham, MA, USA). Thermal conditions were as follows: initial denaturation at 95 °C for 10 min, 40 cycles were run at 95 °C for 15 s (denaturing) followed by 60 °C for 1 min (annealing/extension).
Details of the experimental conditions are shown in Table 1.

2.4. Statistical Analysis

Qualitative variables are presented as numbers with a corresponding percentage. The chi-square test with appropriate corrections applied depending on the size of the subgroups was used for the analysis. Continuous variables are presented as median with the values of the lower and upper quartiles (25–75 percentile). The normality of the distribution was verified by the Shapiro-Wilk W test. The differences between the groups were assessed using the Mann-Whitney and Kruskal-Wallis test or the χ2 test (variables with a distribution other than normal). Spearman’s rank correlation was used to determine the correlation of variables with a distribution other than normal. The differences for the statistic value p < 0.05 were considered statistically significant. The statistical analysis was performed using the Statistica 13.1 software package (StatSoft, Krakow, Poland). p value ≤ 0.05 was considered statistically significant.

3. Results

3.1. Influence of UVB Treatment on Selected Clinical Features

The mean value of PASI after 20 doses of ultraviolet radiation was 6.17 (±3.60) and was significantly lower in comparison to mean PASI value before therapy (21.38 ± 9.84). On average, all patients improved their clinical condition, as measured by the PASI index, by 72% (43 patients had a PASI of 50; 22 patients had a PASI of 75; 3 patients had a PASI of 90). Moreover, the improvement was achieved in the range of BSA after 20 irradiations (13.90 ± 7.08 vs. 33.46 ± 12.71; p < 0.05) and the DLQI index, which decreased on average 1.60 ± 0.66 vs. 3.32 ± 0.79; p < 0.05.
The median values of TNF alpha, IL-17 and IL-23 in patients with psoriasis before phototherapy was significantly higher compared to the control group (10.45 pg/mL vs. 6.33 pg/mL, p = 0.003; 30.49 pg/mL vs. 14.65 pg/mL, p < 0.0001; 94.12 pg/mL vs. 64.41 pg/mL, p < 0.0001). The baseline levels of vitamin D amongst all the patients were 22.13 ± 12.52 ng/mL, whilst in the control group they were 19.33 ± 7.78 ng/mL. After the nb-UVB phototherapy, the average level was 35.03 ± 14.57 ng/mL for the patients. No statistical difference was observed in vitamin D level in patients with psoriasis compared to the control group (p > 0.05). There were no statistical differences in the parameters described above by gender in the individual groups (p > 0.05 for all comparisons). Statistical analysis shows that the PASI 75 response was dependent on changes in the concentrations of the analyzed cytokines (p > 0.05 for all comparisons).

3.2. Genotype Frequencies

The distribution of the analyzed VDR gene polymorphisms in patients with psoriasis and controls were in correspondence with the Hardy-Weinberg equilibrium (p > 0.05 in all cases), showing that the analyzed groups were selected correctly. When analyzing the distribution of genotypes of individual polymorphisms in this gene, no differences were found between the control group and patients, except for the GG genotype in the TaaI/Cdx-2 polymorphism which was significantly more frequent in patients with psoriasis (p < 0.001; OR 9.75). Other genotypes such as BsmI AA, FokI TT and CT increased the risk of psoriasis, although the relative risks for these associations were not so high (p = 0.03, p = 0.04, p = 0.03). Table 2 presents the distribution of ApaI, FokI, TaqI, BsmI and TaaI/Cdx-2 VDR genotypes in the patients with psoriasis and controls.

3.3. Association of VDR SNPs with Selected Clinical Features

When analyzing genotypes in individual polymorphisms for the VDR gene in terms of the therapeutic response to phototherapy, improvement of PASI 50, PASI 75 or PASI 90 did not show any relationship except with the TaaI/Cdx-2 polymorphism. We found a significantly higher frequency of rs11568820 AA (TaaI/Cdx-2) amongst the group with a negative response (p = 0.04, odds ratio 7.31, 95% confidence interval 1.19–44.97). The common rs11568820 AA (TaaI/Cdx-2) variant might have a significant effect on the response to therapies amongst patients with psoriasis (Table 3).
TNF alpha concentration in patients with psoriasis decreases significantly after UVB irradiation (10.45 pg/mL vs. 3.31 pg/mL; p < 0.01). The decrease in TNF alpha concentration was not dependent on polymorphisms in the VDR gene, except for the presence of the TaaI/Cdx-2 AA genotype and TaaI/Cdx-2 TT genotype of the VDR polymorphism, the presence of which was not associated with a statistically significant decrease in TNF alpha concentration (Table 4).
Irradiation with a narrowband UVB caused a decrease in the concentration of IL-17. The decrease in IL-17 concentration after phototherapy was statistically significant for patients with the CT genotype in the FokI polymorphism (p = 0.03), for the AA genotype in the BmsI polymorphism (p = 0.03) and in the GG polymorphism in TaaI/Cdx-2 (p = 0.03). In other genotypes of determined polymorphisms, no relationship was observed in the reduction of IL-17 after irradiation compared to other genotypes in the analyzed polymorphisms (Table 5).
NB-UVB irradiation may have impacted the IL-23 concentration. Moreover, the decrease in IL-23 concentration after phototherapy was statistically significant for patients with the TT genotype in the FokI polymorphism (p = 0.00001), for the CC genotype in the polymorphism TaqI (p = 0.003) and in the GG polymorphism in TaaI/Cdx-2 (p = 0.01). In other genotypes of the determined polymorphisms, no relationship was observed in the reduction of IL-23 after irradiation compared to other genotypes in the analyzed polymorphisms (Table 6).
Irradiation with NB-UVB in all patients caused a significant increase in vitamin D concentration, regardless of genotypes, in all analyzed VDR polymorphisms.

4. Discussion

The present study provides evidence of an association between VDR polymorphisms, cytokines, vitamin D levels and NB-UVB phototherapy for the first time. In our study, we analyzed an association between one of the VDR gene polymorphisms, level of TNF, IL-17, IL-23, vitamin D and psoriasis in the Polish population. Moreover, this was the first time the influence of VDR gene polymorphisms on effectiveness of phototherapy was explored. This data suggests that VDR polymorphisms may be involved in the etiopathogenesis of psoriasis and response to UVB therapy. The genotype distributions of all the analyzed polymorphisms of VDR are in the Hardy-Weinberg equilibrium.
VDR gene polymorphisms have been implicated in several autoimmune disorders, including systemic lupus erythematosus, rheumatoid arthritis and psoriasis [31,32,33,34].
Few studies have found a strong genetic background for psoriasis. We found that the frequency of the TaaI/Cdx-2 GG genotype was significantly higher in psoriasis patients than in controls. Other genotypes, such as Bsml AA, Fokl TT and CT, increased the risk of psoriasis, although the relative risks for these associations were not so high. Similarly, Zhu et al. [35] observed that BsmI polymorphism of the VDR gene is associated with psoriasis. In contrast, Xing Zhou et al. [36] and Rucevic et al. [34] did not find any significant differences between patients with psoriasis and controls in the genotype frequency of BsmI, FokI, and TaaI/Cdx-2 polymorphisms in Asian and Caucasian populations, respectively. There may be several reasons for this contradiction, probably due to different ethnic groups’ association with environmental factors, such as environmental exposure to UV radiation, or clinical heterogeneity of the study groups.
It is well known that biologically active 1,25-dihydroxyvitamin D3 regulates the growth of epidermal cells by inhibition of its proliferation and induces terminal differentiation of keratinocytes. Moreover, it activates anti-inflammatory and immunosuppressive pathways. Physiological response of keratinocytes and clinical response to treatment with vitamin D is correlated with the VDR mRNA expression, which may be influenced by the polymorphisms of the VDR. Polymorphism BsmI is located in intron 8 in the 3′ untranslated region (UTR), which may alter mRNA levels and the efficiency of protein translation by regulating gene transcription to change the expression and function of VDR. FokI is located in the 5′ end of the VDR gene and alters the start codon (ATG, Met1Thr) and leads to forming a protein with a different size—a shorter (424 amino acids) VDR protein—instead of a long (427 amino acids) VDR protein.
The 424-amino-acid VDR variant is more active than the 427-amino-acid variant in terms of its transactivation capacity as a transcription factor. Thus, the binding of vitamin D to VDR might be decreased and change the activation of the vitamin D/VDR signaling pathway. In that way, it inhibits the functions of VDR signaling pathway, such as anti-inflammatory effects, and leads to the overacting of the immune system. The TaaI/Cdx-2 polymorphism is located in the promoter region and plays a role in transcription of the VDR gene. Irradiation with UVB in all patients caused a significant increase in vitamin D concentration, regardless of genotypes, in all analyzed VDR polymorphisms. In patients with psoriasis, resistance to treatment with vitamin D was observed, which may be due to VDR gene polymorphisms. Our analysis showed an association between the VDR TaaI/Cdx-2 AA homozygous with a negative response to phototherapy, probably due to altered transcription of VDR gene but with normal production of vitamin D after UVB irradiation. Caudal-type homeobox protein 2 (Cdx-2) is a transcription factor (TF) with a polymorphic binding site (TaaI/Cdx-2) in the VDR. The molecular mechanism underlying the Cdx-2 association with conditions like psoriasis, which depends on VDR expression and vitamin D absorption, is believed to be due to higher affinity of Cdx-2 for the G allele compared to the A allele. TaaI/Cdx-2 with the AA genotype shows significantly lower VDR activation than AG and GG genotypes. Thus, the TaaI/Cdx-2 polymorphism might be a crucial functional polymorphism in the transcription of the VDR gene [17].
The rs7975232 ApaI variant of VDR may be associated with the development of inflammatory disease, such as oral lichen planus [37] and psoriasis [31,36] in the Asian population. Conversely, our study showed no association of ApaI variants with psoriasis in the Caucasian population.
In the case of psoriasis, as in most diseases with a complex etiology, the response to treatment is individual and often difficult to predict. This study was conducted to investigate whether VDR polymorphisms could be susceptibility markers for psoriasis. Therefore, screening of genetic markers will allow for the selection of the best treatment option for patients with psoriasis in the future, as well as decrease the treatment costs [5].
Interleukin-17 is a pro-inflammatory cytokine produced by the T helper 17 (Th17) cells and plays an important role in the development and progression of inflammatory and autoimmune diseases [38]. Mechanisms underlying the complex pathogenesis of psoriasis have not been fully understood, but there is increasing evidence that the IL-17/IL-23 axis plays a crucial role in the inflammatory response in psoriasis [39,40]. The vitamin D3 analogue calcipotriol used in treating psoriasis inhibited IL-23/IL-17 axis and neutrophil infiltration in psoriatic skin through the vitamin D receptor (VDR) in keratinocytes [41].
IL-23 alone promotes epidermal hyperplasia and activates the keratinocyte proliferation [42] or acts simultaneously with IL-17, enhancing dermal acanthosis, neutrophil recruitment and infiltration of IL-17-secreting cells into the psoriatic skin [6]. The median values of TNF alpha, IL-17 and IL-23 in patients with psoriasis before phototherapy was significantly higher compared to the control group. The PASI 75 response was dependent on changes in the concentrations of the analyzed cytokines. TNF alpha concentration in patients with psoriasis decreases after UVB irradiation, independent of polymorphisms in the VDR gene, except for the presence of the TaaI/Cdx-2 AA genotype and TaqI TT genotype. IL-17 and IL-23 are associated with inflammatory and dendritic cells such as Langerhans cells in skin. Irradiation with a narrowband UVB caused a decrease in the concentration of IL-17 and IL-23. The decrease in IL-17 concentration after phototherapy was observed for patients with the CT genotype in the FokI polymorphism and IL-23 for TT genotype. Decrease of IL-17 was observed for the AA genotype in the BmsI polymorphism and IL-23 for the CC genotype in the TaqI polymorphism. For the GG polymorphism in TaaI/Cdx-2, simultaneous decrease of the IL-17 and IL-23 level was observed.
A few limitations of the present study require consideration. First, the number of samples tested was relatively small and thus further studies in a larger population are required. We observed a weak association between genotypes Bsml and FokI and psoriasis, and lack of association with ApaI. Therefore, it is important to mention that the absence of a significant association of VDR ApaI polymorphism with psoriasis in the present study may be explained by the number of persons analyzed, which is insufficient for the investigation of rare alleles in the case of comparing Caucasians to Asians. Second, we did not evaluate interactions between vitamin D intake and environmental ultraviolet radiation exposure. Third, we did not evaluate associations with other relevant gene polymorphisms, IL-7, IL-23 or GC, and the vitamin D binding protein.
Strengths of this study include the collection of clinically characterized cohorts and results that were confirmed in two independent populations. Additionally, our study provides data for comparison with other studies to determine the possible value of VDR polymorphisms to predict predisposition to psoriasis in different ethnic groups.

5. Conclusions

Summarizing, we examined the association between VDR gene polymorphisms and psoriasis in the Polish population. This is the first report of a relationship between VDR polymorphisms and response to UVB treatment of psoriasis. The TaaI/Cdx-2 AA variant might have a significant effect on the response to phototherapy amongst patients with psoriasis. On the other hand, the TaaI/Cdx-2 GG variant might have an association with regulation of inflammatory response via decrease of the IL-17 and IL-23 level after UVB phototherapy in the Polish population. Moreover, VDR polymorphisms could be susceptibility markers for psoriasis and effectiveness of UVB therapy.
Further analysis of VDR gene polymorphisms may help to obtain more information on their association with development of psoriasis and different responses to phototherapy.

Author Contributions

Conceptualization, K.W. and A.L.; methodology, K.W.; software, K.C.; validation, I.O.-S., M.C., D.S.-S. and M.W.; formal analysis, J.N.; investigation, K.W.; resources, M.C. and K.W.; data curation, M.C., M.S. and K.C.; writing—original draft preparation, K.W.; writing—review and editing, M.W., J.N., A.L. and M.C.; visualization, K.W. and M.C.; supervision, A.L.; project administration, A.L.; funding acquisition, K.W. and A.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Polish National Science Centre grant project no. UMO-2013/11/B/NZ5/00037 and by the Medical University of Lodz statutory activities no. 503/5-064-04/503-01.

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the ethics committee of Medical University of Lodz (RNN/219/18/KE).

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets generated during and analyzed during the current study are available from the corresponding author on reasonable request.

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References

  1. Boehncke, W.H.; Schön, M.P. Psoriasis. Lancet 2015, 386, 983–994. [Google Scholar] [CrossRef] [Scilit]
  2. Danielsen, K.; Duvetorp, A.; Iversen, L.; Østergaard, M.; Seifert, O.; Steinar, K.T.; Skov, L. Prevalence of psoriasis and psoriatic arthritis and patient perceptions of severity in Sweden, Norway and Denmark: Results from the nordic patient survey of psoriasis and psoriatic arthritis. Acta Derm. Venereol. 2019, 99, 18–25. [Google Scholar] [CrossRef] [Scilit]
  3. Parisi, R.; Symmons, D.P.M.; Griffiths, C.E.M.; Ashcroft, D.M. Global epidemiology of psoriasis: A systematic review of incidence and prevalence. J. Investig. Dermatol. 2013, 113, 377–385. [Google Scholar] [CrossRef] [Scilit]
  4. Borzęcki, A.; Koncewicz, A.; Raszewska-Famielec, M.; Dudra-Jastrzębska, M. Epidemiology of psoriasis in the years 2008–2015 in Poland. Dermatol. Rev. 2018, 105, 693–700. [Google Scholar] [CrossRef] [Scilit]
  5. Medical Advisory Secretariat, Ontario Health Technology Advisory Committee. Ultraviolet Phototherapy Management of Moderate-to-Severe Plaque Psoriasis: An Evidence-Based Analysis. Ont. Health Technol. Assess. Ser. 2009, 9, 1–66. [Google Scholar] [PubMed]
  6. Gaffen, S.L.; Jain, R.; Garg, A.V.; Cua, D.J. The IL-23-IL-17 immune axis: From mechanisms to therapeutic testing. Nat. Rev. Immunol. 2014, 14, 585–600. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Barrea, L.; Nappi, F.; Di Somma, C.; Savanelli, M.C.; Falco, A.; Balato, A.; Balato, N.; Savastano, S. Environmental Risk Factors in Psoriasis: The Point of View of the Nutritionist. Int. J. Environ. Res. Public Health 2016, 13, 743. [Google Scholar] [CrossRef] [Scilit]
  8. Mrowietz, U.; Kragballe, K.; Reich, K.; Spuls, P.; Griffiths, C.E.M.; Nast, A.; Franke, J.; Antoniou, C.; Arenberger, P.; Balieva, F.; et al. Definition of treatment goals for moderate to severe psoriasis: A European consensus. Arch. Dermatol. Res. 2011, 303, 1–10. [Google Scholar] [CrossRef] [Scilit]
  9. Sadowska, M.; Lesiak, A.; Narbutt, J. Application of phototherapy in the treatment of psoriasis vulgaris. Dermatol. Rev. 2019, 106, 198–209. [Google Scholar] [CrossRef] [Scilit]
  10. Menter, A.; Korman, N.J.; Elmets, C.A.; Feldman, S.R.; Gelfand, J.M.; Gordon, K.B.; Gottlieb, A.; Koo, J.Y.M.; Lebwohl, M.; Lim, H.W.; et al. Guidelines of care for the management of psoriasis and psoriatic arthritis: Section 5. Guidelines of care for the treatment of psoriasis with phototherapy and photochemotherapy. J. Am. Acad. Dermatol. 2010, 62, 114–135. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  11. Almutawa, F.; Alnomair, N.; Wang, Y.; Hamzavi, I.; Lim, H.W. Systematic review of UV-based therapy for psoriasis. Am. J. Clin. Dermatol. 2013, 14, 87–109. [Google Scholar] [CrossRef] [Scilit]
  12. Pathirana, D.; Ormerod, A.D.; Saiag, P.; Smith, C.; Spuls, P.I.; Nast, A.; Barker, J.; Bos, J.D.; Burmester, G.-R.; Chimenti, S.; et al. European S3-guidelines on the systemic treatment of psoriasis vulgaris. J. Eur. Acad. Dermatol. Venereol. 2009, 23 (Suppl. S2), 5–70. [Google Scholar] [CrossRef] [Scilit]
  13. Matos, T.R.; Sheth, V. The symbiosis of phototherapy and photoimmunology. Clin. Dermatol. 2016, 34, 538–547. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Ling, T.C.; Clayton, T.H.; Crawley, J.; Exton, L.S.; Goulden, V.; Ibbotson, S.; McKenna, K.; Mohd Mustapa, M.F.; Rhodes, L.E.; Sarkany, R.; et al. British Association of Dermatologists and British Photodermatology Group guidelines for the safe and effective use of psoralen-ultraviolet A therapy 2015. Br. J. Dermatol. 2016, 174, 24–55. [Google Scholar] [CrossRef] [Scilit]
  15. Matos, T.R.; Ling, T.C.; Sheth, V. Ultraviolet B radiation therapy for psoriasis: Pursuing the optimal regime. Clin. Dermatol. 2016, 34, 587–593. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Yamamoto, H.; Miyamoto, K.; Li, B.; Taketani, Y.; Kitano, M.; Inoue, Y.; Morita, K.; Pike, W.J.; Takeda, E. The caudal related homeodomain protein Cdx-2 regulates vitamin D receptor gene expression in the small intestine. J. Bone Miner. Res. 1999, 14, 240–247. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Arai, H.; Miyamoto, K.I.; Yoshida, M.; Yamamoto, H.; Taketani, Y.; Morita, K.; Kubota, M.; Yoshida, S.; Ikeda, M.; Watabe, F.; et al. The polymorphism in the caudal-related homeodomain protein Cdx-2 binding element in the human vitamin D receptor gene. J. Bone Miner. Res. 2001, 16, 1256–1264. [Google Scholar] [CrossRef] [Scilit]
  18. Sentinelli, F.; Bertoccini, L.; Barchetta, I.; Capoccia, D.; Incani, M.; Pani, M.G.; Loche, S.; Angelico, F.; Arca, M.; Morini, S.; et al. The vitamin D receptor (VDR) gene rs11568820 variant is associated with type 2 diabetes and impaired insulin secretion in Italian adult subjects, and associates with increased cardio-metabolic risk in children. Nutr. Metab. Cardiovasc. Dis. 2016, 26, 407–413. [Google Scholar] [CrossRef] [Scilit]
  19. Deeb, K.K.; Trump, D.L.; Johnson, C.S. Vitamin D signalling pathways in cancer: Potential for anticancer therapeutics. Nat. Rev. Cancer 2007, 7, 684–700. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  20. Zmuda, J.M.; Cauley, J.A.; Ferrell, R.E. Molecular epidemiology of vitamin D receptor gene variants. Epidemiol. Rev. 2000, 22, 203–217. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  21. Köstner, K.; Denzer, N.; Müller, C.S.; Klein, R.; Tilgen, W.; Reichrath, J. The relevance of vitamin D receptor (VDR) gene polymorphisms for cancer: A review of the literature. Anticancer Res. 2009, 29, 3511–3536. [Google Scholar] [PubMed]
  22. Lee, Y.H. Vitamin D receptor ApaI, TaqI, BsmI, and FokI polymorphisms and psoriasis susceptibility: An updated meta-analysis. Clin. Exp. Dermatol. 2019, 44, 498–505. [Google Scholar] [CrossRef] [Scilit]
  23. Gallo, E.; Cabaleiro, T.; Roman, M.; Solano-Lopez, G.; Abad-Santos, F.; Garcia-Diez, A.; Daudén, E. The relationship between tumour necrosis factor (TNF)-alpha promoter and IL12B/IL-23R genes polymorphisms and the efficacy of anti-TNF-alpha therapy in psoriasis: A case-control study. Br. J. Dermatol. 2013, 169, 819–829. [Google Scholar] [CrossRef] [Scilit]
  24. West, J.; Ogston, S.; Berg, J.; Palmer, C.; Fleming, C.; Kumar, V.; Foerster, J. HLA-Cw6-positive patients with psoriasis show improved response to methotrexate treatment. Clin. Exp. Dermatol. 2017, 42, 651–655. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Talamonti, M.; Galluzzo, M.; van den Reek, J.M.; de Jong, E.M.; Lambert, J.L.W.; Malagoli, P.; Bianchi, L.; Costanzo, A. Role of the HLA-C*06 allele in clinical response to ustekinumab: Evidence from real life in a large cohort of European patients. Br. J. Dermatol. 2017, 177, 489–496. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Li, K.; Huang, C.C.; Randazzo, B.; Li, S.; Szapary, P.; Curran, M.; Campbell, K.; Brodmerkel, C. HLA-C*06:02 Allele and Response to IL-12/23 Inhibition: Results from the Ustekinumab Phase 3 Psoriasis Program. J. Investig. Dermatol. 2016, 136, 2364–2371. [Google Scholar] [CrossRef] [Scilit]
  27. Bojko, A.; Ostasz, R.; Białecka, M.; Klimowicz, A.; Malinowski, D.; Budawski, R.; Bojko, P.; Droździk, M.; Kurzawski, M. IL12B, IL23A, IL23R and HLA-C*06 genetic variants in psoriasis susceptibility and response to treatment. Hum. Immunol. 2018, 79, 213–217. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Reich, A.; Orda, A.; Wiśnicka, B.; Szepietowski, J.C. Plasma neuropeptides and perception of pruritus in psoriasis. Acta Derm. Venereol. 2007, 87, 299–304. [Google Scholar] [CrossRef] [Scilit]
  29. Reich, A.; Szepietowski, J.C. Mediators of pruritus in psoriasis. Mediat. Inflamm. 2007, 2007, 64727. [Google Scholar] [CrossRef] [Scilit]
  30. Aydogan, K.; Karadogan, S.K.; Tunali, S.; Adim, S.B.; Ozcelik, T. Narrowband UVB phototherapy for small plaque parapsoriasis. J. Eur. Acad. Dermatol. Venereol. 2006, 20, 573–577. [Google Scholar] [CrossRef] [Scilit]
  31. Park, B.S.; Park, J.S.; Lee, D.Y.; Youn, J.I.; Kim, I.G. Vitamin D receptor polymorphism is associated with psoriasis. J. Investig. Dermatol. 1999, 112, 113–116. [Google Scholar] [CrossRef] [Scilit]
  32. Kaya, T.I.; Erdal, M.E.; Tursen, U.; Camdeviren, H.; Gunduz, O.; Soylemez, F.; Ikizoglu, G. Association between vitamin D receptor gene polymorphism and psoriasis among the Turkish population. Arch. Dermatol. Res. 2002, 294, 286–289. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Dayangac-Erden, D.; Karaduman, A.; Erdem-Yurter, H. Polymorphisms of vitamin D receptor gene in Turkish familial psoriasis patients. Arch. Dermatol. Res. 2007, 299, 487–491. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Rucevic, I.; Stefanic, M.; Tokic, S.; Vuksic, M.; Glavas-Obrovac, L.; Barisic-Drusko, V. Lack of association of vitamin D receptor gene 3‘-haplotypes with psoriasis in Croatian patients. J. Dermatol. 2012, 39, 58–62. [Google Scholar] [CrossRef] [Scilit]
  35. Zhu, H.Q.; Xie, K.C.; Chen, L.D.; Zhu, G.D. The Association between vitamin D receptor polymorphism and psoriasis. Chin. J. Dermatol. 2002, 35, 386–388. [Google Scholar]
  36. Zhou, X.; Xu, L.; Li, Y.Z. The association of polymorphisms of the vitamin D receptor gene with psoriasis in the Han population of northeastern China. J. Dermatol. Sci. 2014, 73, 63–66. [Google Scholar] [CrossRef] [Scilit]
  37. Shen, H.; Liu, Q.; Huang, P.; Fan, H.; Zang, F.; Liu, M.; Zhuo, L.; Wu, J.; Wu, G.; Yu, R.; et al. Vitamin D receptor genetic polymorphisms are associated with oral lichen planus susceptibility in a Chinese Han population. BMC Oral Health 2020, 20, 26. [Google Scholar] [CrossRef] [Scilit]
  38. Iwakura, Y.; Ishigame, H.; Saijo, S.; Nakae, S. Functional specialization of interleukin-17 family members. Immunity 2011, 25, 149–162. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Tollenaere, M.A.X.; Hebsgaard, J.; Ewald, D.A.; Lovato, P.; Garcet, S.; Li, X.; Pilger, S.D.; Tiirikainen, M.L.; Bertelsen, M.; Krueger, G.J.; et al. Signaling of multiple IL-17 family cytokines through IL-17RA drive psoriasis-related inflammatory pathways. Br. J. Dermatol. 2021. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  40. Di Cesare, A.; Di Meglio, P.; Nestle, F.O. The IL-23/Th17 axis in the immunopathogenesis of psoriasis. J. Investig. Dermatol. 2009, 129, 1339–1350. [Google Scholar] [CrossRef] [Scilit]
  41. Germán, B.; Wei, R.; Hener, P.; Martins, C.; Ye, T.; Gottwick, C.; Yang, J.; Seneschal, J.; Boniface, K.; Li, M. Disrupting the IL-36 and IL-23/IL-17 loop underlies the efficacy of calcipotriol and corticosteroid therapy for psoriasis. JCI Insight 2019, 24, e123390. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Chan, J.R.; Blumenschein, W.; Murphy, E.; Diveu, C.; Wiekowski, M.; Abbondanzo, S.; Lucian, L.; Geissler, R.; Brodie, S.; Kimball, A.B.; et al. IL-23 stimulates epidermal hyperplasia via TNF and IL-20R2-dependent mechanisms with implications for psoriasis pathogenesis. J. Exp. Med. 2006, 203, 2577–2587. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Table 1. PCR-RFLP of loci within the VDR (vitamin D receptor) gene.
Table 1. PCR-RFLP of loci within the VDR (vitamin D receptor) gene.
PolymorphismAllelesPCR PrimerAnnealing TemperaturePCR Product (BP)Restriction EnzymeRFLP
Products
(BP)
rs2228570
(FokI)
162 T/C
(Met1Thr, exon 1)
F: 5′-CACCCTGGAAGTAAAACA-3′
R: 5′-ACCTGAAGAAGCCTTTGC-3′
56 °C486FokI486 CC
344/142 TT 486/344/142 TC
rs7975232 (ApaI)64978G/T
(intron 8 variant)
F: 5′-
GCAAAGATAGCAGAGCAGAGTTCC –3′
R: 5′-
AGGTTGGACAGGAGAGAGAATGG -3′
56 °C781ApaI781 TT
469/312 GG 781/469/312 GT
rs1544410 (BsmI)63980G/A
(intron 8 variant)
F: 5′-
GGGGAGTATGAAGGACAAAGAC–3′ R: 5′-TTCTCACCTCTAACCAGCGG-3′
56 °C429HinP1I429 AA
282/147 GG 429/282/147 GA
rs731236
(TaqI)
1216 C/T
(Ile352Ile, exon 9)
F: 5′-
CAGAGCATGGACAGGGAGCAAG-3′ R: 5′-GCAACTCCTCATGGCTGAGGTCTC-3′
56 °C740TaqI740 TT
495/245 CC 740/495/245 CT
rs11568820 (TaaI/Cdx-2)G/A
(promoter region)
TaqMan® SNP Genotyping assay C___2880808_10
Table 2. Distribution of ApaI, FokI, TaqI, BsmI and TaaI/Cdx-2 genotypes in the VDR gene amongst patients with psoriasis and controls.
Table 2. Distribution of ApaI, FokI, TaqI, BsmI and TaaI/Cdx-2 genotypes in the VDR gene amongst patients with psoriasis and controls.
ControlsPatients with Psoriasisp Value *
ApaI N(%)N(%)
GG11(22)11(22)
GT17(34)20(40)
TT22(44)19(38)
FokI
CC31(62)12(24)
CT11(22)21(42)0.03
TT8(16)17(34)0.04
TaqI
TT17(34)15(30)
TC22(44)20(40)
CC11(22)15(30)
BsmI
AA6(12)17(34)0.03
AG18(36)20(40)
GG26(52)13(26)
TaaI/Cdx-2
AA23(46)7(14)
AG22(44)17(34)
GG5(10)26(52)<0.001
* p < 0.05 Bonferroni corrections.
Table 3. PASI and BSA response for various polymorphism of VDR gene.
Table 3. PASI and BSA response for various polymorphism of VDR gene.
PASI 50 YesPASI 50 NoPASI 75 YesPASI 75 NoPASI 90 YesPASI 90 NoBSA Response over Median
Apal N(%)N(%)N(%)N(%)N(%)N(%)N (yes)(%)
GG8(73)3(27)3(27)8(73)0(0)11(100)5(45)
GT17(85)3(15)9(45)11(55)2(10)18(90)8(40)
TT18(95)1(5)10(53)9(47)1(5)18(95)11(58)
Fokl
CC9(75)3(25)5(42)7(58)1(8)11(92)5(42)
CT19(90)2(10)8(38)13(62)1(5)20(95)10(48)
TT15(88)2(12)9(53)8(47)1(6)16(94)9(53)
Taql
TT14(93)1(7)6(40)9(60)2(13)13(87)7(47)
TC18(90)2(10)11(55)9(45)1(5)19(95)11(55)
CC11(73)4(27)5(33)10(67)0(0)15(100)6(40)
Bsml
AA15(88)2(12)10(59)7(41)1(6)16(94)8(47)
AG16(80)4(20)7(35)13(65)2(10)18(90)8(40)
GG12(92)1(8)5(38)8(62)0(0)13(100)8(62)
Taal/Cdx-2
AA4(57)3(43)2(29)5(71)0(0)7(100)1(14)
AG15(88)2(12)6(35)11(65)0(0)17(100)7(41)
GG24(92)2(8)14(54)12(46)3(12)23(88)16(62)
Table 4. The comparison of TNF alpha before and after UV irradiation for various polymorphisms of the VDR gene.
Table 4. The comparison of TNF alpha before and after UV irradiation for various polymorphisms of the VDR gene.
Before UV (Mean)After UV (Mean)p
FokITT15.772.960.0130 *
CT10.032.750.0021 *
CC8.872.120.0404 *
ApaITT11.433.580.0475 *
TG10.732.670.0006 *
GG11.142.640.0203 *
TaqITT12.753.340.0742
TC10.962.240.0001 *
CC9.143.680.0013 *
BsmIAA16.092.890.0178 *
GA9.553.22<0.0001 *
GG8.992.830.0214 *
TaaI/Cdx-2GG12.942.980.0066 *
AG9.092.59<0.0001 *
AA11.514.110.1720
* statistical significance.
Table 5. The comparison of IL-17 before and after UV irradiation for various polymorphisms of the VDR gene.
Table 5. The comparison of IL-17 before and after UV irradiation for various polymorphisms of the VDR gene.
Before UV (Mean)After UV (Mean)p
FokITT28.3324.110.1177
CT28.3222.890.0376 *
CC20.3122.810.4713
ApaITT23.5223.410.9674
TG25.6323.850.5515
GG27.5722.040.1329
TaqITT22.5522.530.9958
TC25.2623.720.5784
CC28.4323.460.0726
BsmIAA28.4822.210.0365 *
GA25.6823.410.3910
GG22.0624.490.4772
TaaI/Cdx-2GG28.7623.790.0076 *
AG24.9922.370.4618
AA19.8223.620.3281
* statistical significance.
Table 6. The comparison of IL-23 before and after UV irradiation for various polymorphisms of the VDR gene.
Table 6. The comparison of IL-23 before and after UV irradiation for various polymorphisms of the VDR gene.
Before UV (Mean)After UV (Mean)p
FoklTT95.3575.53<0.0001 *
CT94.2488.240.3329
CC86.9575.510.2028
ApalTT83.5081.850.7814
TG88.4085.300.6725
GG92.1583.580.2697
TaqlTT82.0389.320.3626
TC89.1883.310.3796
CC90.7078.310.0320 *
BsmlAA88.1679.230.1717
GA91.9783.870.1134
GG81.2588.940.4187
TaaI/Cdx-2GG96.1686.130.0114 *
AG88.1881.050.2374
AA71.5580.460.5445
* statistical significance.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Lesiak, A.; Wódz, K.; Ciążyńska, M.; Skibinska, M.; Waszczykowski, M.; Ciążyński, K.; Olejniczak-Staruch, I.; Sobolewska-Sztychny, D.; Narbutt, J. TaaI/Cdx-2 AA Variant of VDR Defines the Response to Phototherapy amongst Patients with Psoriasis. Life 2021, 11, 567. https://doi.org/10.3390/life11060567

AMA Style

Lesiak A, Wódz K, Ciążyńska M, Skibinska M, Waszczykowski M, Ciążyński K, Olejniczak-Staruch I, Sobolewska-Sztychny D, Narbutt J. TaaI/Cdx-2 AA Variant of VDR Defines the Response to Phototherapy amongst Patients with Psoriasis. Life. 2021; 11(6):567. https://doi.org/10.3390/life11060567

Chicago/Turabian Style

Lesiak, Aleksandra, Karolina Wódz, Magdalena Ciążyńska, Małgorzata Skibinska, Michał Waszczykowski, Karol Ciążyński, Irmina Olejniczak-Staruch, Dorota Sobolewska-Sztychny, and Joanna Narbutt. 2021. "TaaI/Cdx-2 AA Variant of VDR Defines the Response to Phototherapy amongst Patients with Psoriasis" Life 11, no. 6: 567. https://doi.org/10.3390/life11060567

APA Style

Lesiak, A., Wódz, K., Ciążyńska, M., Skibinska, M., Waszczykowski, M., Ciążyński, K., Olejniczak-Staruch, I., Sobolewska-Sztychny, D., & Narbutt, J. (2021). TaaI/Cdx-2 AA Variant of VDR Defines the Response to Phototherapy amongst Patients with Psoriasis. Life, 11(6), 567. https://doi.org/10.3390/life11060567

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop