Tyrosine Kinase Self-Phosphorylation Controls Exopolysaccharide Biosynthesis in Gluconacetobacter diazotrophicus Strain Pal5
Abstract
:1. Introduction
2. Materials and Methods
2.1. Annotation of the Putative Wzc Protein
2.2. Bacterial Strains and Growth Conditions
2.3. Construction of Wzc Mutant of G. Diazotrophicus
2.4. EPS Purification and Quantification
2.5. Tyrosine Kinase Assay with Radiolabeled ATP
2.6. In Vitro IP Kinase Assay
2.7. Cloning and Expression of the Wzc Gene in E. coli Strain BL21-AI
2.8. RT-qPCR Analysis
2.9. Statistical Analysis
3. Results
3.1. Homology of the Strain Pal5 Wzc Protein to Other Bacterial Proteins
3.2. Tn5 Insertional Inactivation of the PAL5 Wzc Gene
3.3. EPS Production Is Impaired in a Wzc Mutant
3.4. Glycosyltransferase Phosphorylation in G. diazotrophicus
3.5. Immunoprecipitation Assay for Detection of Protein Tyrosine Kinase Self-Phosphorylation Dynamics with Radiolabeled ATP
3.6. Wzc Expression in E. coli BL21-AI
3.7. Wzc Gene Expression in Bacterial Strains Grown in Different Carbon Sources
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Cavalcante, V.A.; Döbereiner, J. A new acid tolerant nitrogen-fixing bacterium associated with sugarcane. Plant Soil 1998, 108, 23–31. [Google Scholar] [CrossRef] [Green Version]
- Muthukumarasamy, U.G.; Kang, K.D.; Park, W.T.; Jeon, C.Y.; Park, Y.S.; Cho, S.W.; Kwon, J.; Song, D.H.; Revathi, G. Enumeration, isolation and identification of diazotrophs from Korean wetland rice varieties grown with long-term application of N and compost and their short-term inoculation effect on rice plants. J. Appl. Microbiol. 2007, 102, 981–991. [Google Scholar] [CrossRef] [PubMed]
- Videira, S.S.; de Oliveira, D.M.; de Morais, R.F.; Borges, W.L.; Baldani, V.L.D.; Baldani, J.I. Genetic diversity and plant growth promoting traits of diazotrophic bacteria isolated from two Pennisetum purpureum Schum. genotypes grown in the field. Plant Soil 2012, 356, 51–66. [Google Scholar] [CrossRef] [Green Version]
- Sevilla, M.; Burris, R.H.; Gunapala, N.; Kennedy, C. Comparison of benefit to sugarcane plant growth and 15N2 incorporation following inoculation of sterile plants with Acetobacter diazotrophicus wildtype and Nif mutants strains. Mol. Plant-Microbe Interact. 2001, 14, 358–366. [Google Scholar] [CrossRef] [Green Version]
- De Paula Soares, C.; Rodrigues, E.P.; de Paula Ferreira, J.; Simões Araújo, J.L.; Rouws, L.F.; Baldani, J.I.; Vidal, M.S. Tn5 insertion in the tonB gene promoter affects iron-related phenotypes and increases extracellular siderophore levels in Gluconacetobacter diazotrophicus. Arch. Microbiol. 2015, 197, 223–233. [Google Scholar] [CrossRef] [PubMed]
- Saravanan, V.S.; Madhaiyan, M.; Thangaraju, M. Solubilization of zinc compounds by the diazotrophic, plant growth promoting bacterium Gluconacetobacter diazotrophicus. Chemosphere 2007, 66, 1794–1798. [Google Scholar] [CrossRef] [PubMed]
- Arencibia, A.D.; Vinagre, F.; Estevez, Y.; Bernal, A.; Perez, J.; Cavalcanti, J.; Santana, I.; Hemerly, A.S. Gluconacetobacter diazotrophicus elicits a sugarcane defense response against a pathogenic bacteria Xanthomonas albilineans. Plant Signal. Behav. 2006, 1, 265–273. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Stephan, M.; Oliveira, M.; Teixeira, K.; Martinez-Drets, G.; Döbereiner, J. Physiology and dinitrogen fixation of Acetobacter diazotrophicus. FEMS Microbiol. Lett. 1991, 77, 67–72. [Google Scholar] [CrossRef]
- Reis, V.M.; Döbereiner, J. Effect of high sugar concentrtaion on nitrogenase activity of Acetobacter diazotrophicus. Arch. Microbiol. 1998, 171, 13–18. [Google Scholar] [CrossRef]
- Tejera, N.A.; Campos, R.; Sanjuan, J.; Lluch, C. Nitrogenase and antioxidant enzyme activities in Phaseolus vulgaris nodules formed by Rhizobium tropici isogenic strains with varying tolerance to salt stress. J. Plant Physiol. 2004, 161, 329–338. [Google Scholar] [CrossRef] [Green Version]
- Islam, S.T.; Lam, J.S. Synthesis of bacterial polysaccharides via the Wzx/Wzy-dependent pathway. Can. J. Microbiol. 2014, 60, 697–716. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Grangeasse, C.; Nessler, S.; Mijakovic, I. Bacterial tyrosine kinases: Evolution, biological function and structural insights. J. Philos. Trans. R. Soc. B Biol. Sci. 2012, 367, 2640–2655. [Google Scholar] [CrossRef] [Green Version]
- Grangeasse, C.; Doublet, P.; Cozzone, A.J. Tyrosine phosphorylation of protein kinase Wzc from Escherichia coli K12 occurs through a two-step process. J. Biol. Chem. 2002, 277, 7127–7135. [Google Scholar] [CrossRef] [Green Version]
- Fang, L.; Catchmark, J.M. Characterization of cellulose and other exopolysaccharides produced from Gluconacetobacter strains. Carbohydr. Polym. 2015, 22, 663–669. [Google Scholar] [CrossRef] [Green Version]
- Serrato, R.V.; Meneses, C.H.; Vidal, M.S.; Santana-Filho, A.P.; Iacomini, M.; Sassaki, G.L.; Baldani, J.I. Structural studies of an exopolysaccharide produced by Gluconacetobacter diazotrophicus Pal5. Carbohydr. Polym. 2013, 15, 1153–1159. [Google Scholar] [CrossRef]
- Meneses, C.H.S.G.; Rouws, L.F.M.; Araújo, J.L.S.; Vidal, M.S.; Baldani, J.I. Exopolysaccharide production is required for biofilm formation and plant colonization by the nitrogen-fixing endophyte Gluconacetobacter diazotrophicus. Mol. Plant-Microbe Interact. 2011, 24, 1448–1458. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Costa, O.Y.A.; Raaijmakers, J.M.; Kuramae, E.E. Microbial Extracellular Polymeric Substances: Ecological Function and Impact on Soil Aggregation. Front. Microbiol. 2018, 9, 1636–1649. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Thapa, S.; Prasanna, R. Prospecting the characteristics and significance of the phyllosphere microbiome. Ann. Microbiol. 2018, 68, 229–245. [Google Scholar] [CrossRef]
- Dow, J.M.; Newman, A.A.; von Roepenack, E. The induction and modulation of plant defense responses by bacterial lipopolysaccharides. Annu. Rev. Phytopathol. 2000, 38, 241–261. [Google Scholar] [CrossRef] [PubMed]
- Alquéres, S.M.; Oliveira, J.H.; Nogueira, E.M.; Guedes, H.V.; Oliveira, P.L.; Câmara, F.; Baldani, J.I.; Martins, O.B. Antioxidant pathways are up-regulated during biological nitrogen fixation to prevent ROS-induced nitrogenase inhibition in Gluconacetobacter diazotrophicus. Arch. Microbiol. 2010, 192, 835–841. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rouws, L.F.M.; Simões-Araújo, J.L.; Hemerly, A.S.; Baldani, J.I. Validation of Tn5 transposon mutagenesis system for Gluconacetobacter diazotrophicus through characterization of a flagellar mutant. Arch. Microbiol. 2008, 189, 397–405. [Google Scholar] [CrossRef]
- Bertalan, M.; Albano, R.; de Pádua, V.; Rouws, L.; Rojas, C.; Hemerly, A.; Teixeira, K.; Schwab, S.; Araujo, J.; Oliveira, A.; et al. Complete genome sequence of the sugarcane nitrogen-fixing endophyte Gluconacetobacter diazotrophicus PAL5. BMC Genom. 2009, 10, 1–17. [Google Scholar] [CrossRef] [Green Version]
- Schmid, J.; Sieber, V.; Rehm, B. Bacterial exopolysaccharides: Biosynthesis pathways and engineering strategies. Front. Microbiol. 2015, 6, 496–519. [Google Scholar] [CrossRef] [Green Version]
- Serra, D.O.; Hengge, R. Bacterial Multicellularity: The biology of Escherichia coli building large-scale biofilm communities. Annu. Rev. Microbiol. 2021, 75, 269–290. [Google Scholar] [CrossRef]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Bateman, A.; Birney, E.; Cerrutti, L.; Burbin, R.; Etwiller, L.; Eddy, S.R.; Griffiths-Jones, S.; Howe, K.L.; Marshall, M.; Sonnhammer, E.L. The Pfam protein families database. Nucleic Acids Res. 2002, 30, 276–280. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gasteiger, E.; Gattiker, A.; Hoogland, C.; Ivanyi, I.; Appel, R.D.; Bairoch, A. ExPASy: The proteomics server for in-depth protein knowledge and analysis. Nucleic Acid Res. 2003, 31, 3784–3788. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Teixeira, K.R.S.; Wülling, M.; Morgan, T.; Galler, R.; Zellermann, E.M.; Baldani, J.I.; Kennedy, C.; Meletzus, D. Molecular analysis of the chromosomal region encoding the nifA and nifB genes of Acetobacter diazotrophicus. FEMS Microbiol. Lett. 1999, 176, 301–309. [Google Scholar] [CrossRef]
- Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd ed.; Cold Spring Harbor Laboratory Press: New York, NY, USA, 1989; ISBN 0879693096. [Google Scholar]
- Quesada, E.; Béjar, V.; Calvo, C. Exopolysaccharide production by Volcaniella eurihalina. Experientia 1993, 49, 1037–1041. [Google Scholar] [CrossRef]
- Dubois, M.; Gilles, K.A.; Hamilton, J.K.; Rebers, P.A.; Smith, F. Colorimetric method for determination of sugars and related substances. Anal. Chem. 1956, 28, 350–356. [Google Scholar] [CrossRef]
- Hastie, C.; McLauchlan, H.; Cohen, P. Assay of protein kinases using radiolabeled ATP: A protocol. Nat. Protoc. 2006, 1, 968–971. [Google Scholar] [CrossRef]
- Laemmli, U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970, 227, 680–685. [Google Scholar] [CrossRef] [PubMed]
- Oliveira, M.; Ramos, E.; Drechsel, M.; Vidal, M.; Schwab, S.; Baldani, J. Gluconacin from Gluconacetobacter diazotrophicus PAL5 is an active bacteriocin against phytopathogenic and beneficial sugarcane bacteria. J. Appl. Microbiol. 2018, 125, 1812–1826. [Google Scholar] [CrossRef] [PubMed]
- Ramos, E.T.A.; Meneses, C.H.S.G.; Vidal, M.S.; Baldani, J.I. Characterization and action mode of Gluconacin, a bacteriocin with antimicrobial activity against Xanthomonas albilineans. Ann. Appl. Biol. 2021, in press. [Google Scholar] [CrossRef]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Doublet, P.; Grangeasse, C.; Obadia, B.; Vaganay, E.; Cozzone, A.J. Structural organization of the protein-tyrosine autokinase Wzc within Escherichia coli cells. J. Biol. Chem. 2002, 277, 37339–37348. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Meneses, C.; Gonçalves, T.; Alquéres, S.; Rouws, L.; Serrato, R.; Vidal, M.; Baldani, J.I. Gluconacetobacter diazotrophicus exopolysaccharide protects bacterial cells against oxidative stress in vitro and during rice plant colonization. Plant Soil 2017, 416, 133–147. [Google Scholar] [CrossRef]
- Liu, H.; Carvalhais, L.C.; Crawford, M.; Singh, E.; Dennis, P.G.; Pieterse, C.M.J.; Schenk, P.M. Inner plant values: Diversity, colonization and benefits from endophytic bacteria. Front. Microbiol. 2017, 8, 2552–2568. [Google Scholar] [CrossRef]
- Sabra, W.; Zeng, A.P.; Lünsdorf, H.; Deckwer, W.D. Effect of oxygen on formation and structure of Azotobacter vinelandii alginate and its role in protecting nitrogenase. Appl. Environ. Microbiol. 2000, 66, 4037–4044. [Google Scholar] [CrossRef] [Green Version]
- Bentley, S.D.; Aanensen, D.M.; Mavroidi, A.; Saunders, D.; Rabbinowitsch, E.; Collins, M.; Donohoe, K.; Harris, D.; Murphy, L.; Quail, M.A.; et al. Genetic Analysis of the Capsular Biosynthetic Locus from All 90 Pneumococcal Serotypes. PLoS Genet. 2006, 2, e31. [Google Scholar] [CrossRef] [Green Version]
- Liu, M.; Siezen, R.J.; Nauta, A. In silico prediction of horizontal gene transfer events in Lactobacillus bulgaricus and Streptococcus thermophilus reveals protocooperation in yogurt manufacturing. Appl. Environ. Microbiol. 2009, 75, 4120–4129. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bouchard, A.; Hofland, G.W.; Witkamp, G. Properties of sugar polyol and polysaccharide water-ethanol solutions. J. Chem. Eng. Data 2007, 52, 1838–1842. [Google Scholar] [CrossRef]
- Vincent, C.; Duclos, B.; Grangeasse, C.; Vaganay, E.; Riberty, M.; Cozzone, A.J.; Doublet, P. Relationship between exopolysaccharide production and protein-tyrosine phosphorylation in gram-negative bacteria. J. Mol. Biol. 2000, 304, 311–321. [Google Scholar] [CrossRef]
- Grangeasse, C.; Terreux, R.; Nessler, S. Bacterial tyrosine-kinases: Structure–function analysis and therapeutic potential. Biochim. Biophys. Acta 2010, 1804, 628–634. [Google Scholar] [CrossRef] [PubMed]
- Schwechheimer, C.; Hebert, K.; Tripathi, S.; Singh, P.K.; Floyd, K.A.; Brown, E.R.; Porcella, M.E.; Osorio, J.; Kiblen, J.T.M.; Pagliai, F.A.; et al. A tyrosine phosphoregulatory system controls exopolysaccharide biosynthesis and biofilm formation in Vibrio cholerae. PLoS Pathog. 2020, 16, e1008745. [Google Scholar] [CrossRef]
Strains and Primers | Characteristics or Sequences | Reference |
---|---|---|
Pal5 | Wild-type, AmpS, KmS, TcS, EPS+ | [1] |
MGD | gumD::Tn5, KmR, gumD−, EPS− | [16] |
MWzc | wzc::Tn5, KmR, wzc−, EPS− | This study |
ΔW_Pal5 | His6-tagged Wzc recombinant protein of Pal5 | This study |
ΔW_MGD | His6-tagged Wzc recombinant protein of MGD | This study |
ΔW_MWzc | His6-tagged Wzc recombinant protein of MWzc | This study |
wzc-sense wzc-antisense | 5′-GACCTGGCCAATATGTTCGT-3′ 5′-ATCAGCAGCTTCTTGCGATT-3′ | This study |
ExpWzcN1-sense ExpWzcN1-antisense | 5′-GACCTGGCCAAAATATGTTCGT-3′ 5′-ATCAGCAGCTATATGTTCGT-3′− | This study |
M13GW-sense M13GW-antisense | 5′-GTAAAACGACGGCCAG-3′ 5′-AGGAAACAGCTATGAC-3′ | This study |
attB1 | 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3′ | Invitrogen |
attB2 | 5′-GGGGACCACTTTGTACAAGAAAGCTGGGT-3′ | |
23S-sense 23S-antisense | 5′AAAGCCGGATCAATCCGTTA3′ 5′AAGCCGTAGTCGATGGAAAC3′ | [20] |
RTwzc-sense RTwzc-antisense | 5′GGGGAAATCGAACAGTTGCG3′ 5′CGGGCGCGCGGTCCGC3′ | This study |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wanderley, K.; Sousa, D.; Silva, G.; Maia, J.; Silva, M.; Vidal, M.; Baldani, J.; Meneses, C. Tyrosine Kinase Self-Phosphorylation Controls Exopolysaccharide Biosynthesis in Gluconacetobacter diazotrophicus Strain Pal5. Life 2021, 11, 1231. https://doi.org/10.3390/life11111231
Wanderley K, Sousa D, Silva G, Maia J, Silva M, Vidal M, Baldani J, Meneses C. Tyrosine Kinase Self-Phosphorylation Controls Exopolysaccharide Biosynthesis in Gluconacetobacter diazotrophicus Strain Pal5. Life. 2021; 11(11):1231. https://doi.org/10.3390/life11111231
Chicago/Turabian StyleWanderley, Katyanne, Dayse Sousa, Gabriel Silva, Josemir Maia, Maria Silva, Marcia Vidal, José Baldani, and Carlos Meneses. 2021. "Tyrosine Kinase Self-Phosphorylation Controls Exopolysaccharide Biosynthesis in Gluconacetobacter diazotrophicus Strain Pal5" Life 11, no. 11: 1231. https://doi.org/10.3390/life11111231
APA StyleWanderley, K., Sousa, D., Silva, G., Maia, J., Silva, M., Vidal, M., Baldani, J., & Meneses, C. (2021). Tyrosine Kinase Self-Phosphorylation Controls Exopolysaccharide Biosynthesis in Gluconacetobacter diazotrophicus Strain Pal5. Life, 11(11), 1231. https://doi.org/10.3390/life11111231