Next Article in Journal
Characterisation and Modelling of Gravity Pre-Concentration Amenability Using LST Fluidisation in a REFLUXTM Classifier
Next Article in Special Issue
Arsenic (III) Removal from a High-Concentration Arsenic (III) Solution by Forming Ferric Arsenite on Red Mud Surface
Previous Article in Journal
The Effect of Pulsed Laser Heating on the Stability of Ferropericlase at High Pressures
Previous Article in Special Issue
Reexamining the Role of Ammonium Ions in the Sulfidization, Xanthate-Flotation of Malachite
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Minerals
Volume 10
Issue 6
10.3390/min10060544
minerals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Bioinformatics and Transcriptional Study of the Nramp Gene in the Extreme Acidophile Acidithiobacillus ferrooxidans Strain DC

by
Bo Miao
1,2,
Li Shen
1,2,
Xueduan Liu
1,2,
Weimin Zeng
1,2 and
Xueling Wu
1,2,*
1
School of Minerals Processing and Bioengineering, Central South University, Changsha 410083, China
2
Key Laboratory of Biometallurgy of Ministry of Education, Central South University, Changsha 410083, China
*
Author to whom correspondence should be addressed.
Minerals 2020, 10(6), 544; https://doi.org/10.3390/min10060544
Submission received: 30 April 2020 / Revised: 8 June 2020 / Accepted: 13 June 2020 / Published: 16 June 2020
(This article belongs to the Special Issue Surface Chemistry in Mineral Processing and Extractive Metallurgy)
Browse Figures
Versions Notes

Abstract

:
The family of Nramp (natural resistance-associated macrophage protein) metal ion transporter functions in diverse organisms from bacteria to humans. Acidithiobacillus ferrooxidans (At. ferrooxidans) is a Gram-negative bacterium that lives at pH 2 in high concentrations of soluble ferrous ion (600 mM). The AFE_2126 protein of At. ferrooxidans of the Dachang Copper Mine (DC) was analyzed by bioinformatics software or online tools, showing that it was highly homologous to the Nramp family, and its subcellular localization was predicted to locate in the cytoplasmic membrane. Transcriptional study revealed that AFE_2126 was expressed by Fe2+-limiting conditions in At. ferrooxidans DC. It can be concluded that the AFE_2126 protein may function in ferrous ion transport into the cells. Based on the ΔpH of the cytoplasmic membrane between the periplasm (pH 3.5) and the cytoplasm (pH 6.5), it can be concluded that Fe2+ is transported in the direction identical to that of the H+ gradient. This study indirectly confirmed that the function of Nramp in At. ferrooxidans DC can transport divalent iron ions.

1. Introduction

NRAMP comprises a cluster of highly conserved integral membrane proteins and exists widely in bacteria, archaea, fungi, plants, animals, and humans [1,2,3,4,5,6]. The NRAMP family is a novel family of functionally related proteins defined by a conserved hydrophobic core of ten transmembrane domains [1]. Rodents and humans express two paralogous genes related to iron imbalance and immune diseases [7]. Nramp1 is an integral membrane protein, expressed only in cells of the immune system, and plays a significant role in the membrane of the phagosome during phagocytosis [8]. Nramp2 is a multivalent divalent cation transporter such as Fe2+, Mn2+, and Zn2+ [9]. It is highly expressed in the intestine and is the major iron uptake system in mammals that do not depend on transferrin. The yeast proteins Smf1p and Smf2p may also transport divalent cations [10]. The natural resistance of mice to infection by intracellular parasites is controlled by the Bcg locus [11], which regulates the cytostatic/cytocidal activity of phagocytes. AtNRAMP1, AtNRAMP3, and AtNRAMP4 encode functional plant metal transporters [12] and are expressed at higher levels when the low iron content in plants is low [13,14]. In contrast, using semiquantitative reverse transcription PCR (semi-Q-RT-PCR), Agranoff et al. [15] suggested that the Nramp mRNA levels in M. tuberculosis will increase with the increases of surrounding Fe2+. Other transporter proteins from multiple sources also belong to this family. After a bioinformatics analysis, the Mn (II)/Fe(II) NRAMP transporter was found in biomining acidophiles [16,17], but it was not detected in Leptospirillum spp. [17]. Using semi-Q-RT-PCR, Potrykus et al. [18] found that two species from the Ferroplasma genus displayed opposite trends. Under iron-limiting conditions, the gene-encoding NRAMP transporter was downregulated in “Ferroplasma Acidarmanus” Fer1 and upregulated in Ferroplasma acidiphilum Y T.
Bioleaching is an established technology to extract base and precious metals from sulfide minerals by using the acidophiles that have the capacities to oxidize ferrous iron and/or sulfur [19]. At. ferrooxidans (formerly Thiobacillus ferrooxidans) is the dominant bacteria used in bioleaching to recover metals [20,21,22,23,24]. It is an acidophilic, chemolithotrophic γ-proteobacterium that can grow aerobically by oxidizing ferrous iron to ferric iron in the outer membrane [25], or sulfur (and reduced sulfur compounds) to sulfuric acid, as its energy source [26,27]. However, iron is an essential micronutrient for almost all organisms, including At. ferrooxidans, due to its redox properties. Given its limited bioavailability, most microorganisms have developed complicated mechanisms to remove this metal from their environment [28]. On the other hand, the redox properties of iron will also convert it into biotoxicity when it is over-acquired. Bacteria have developed strict intracellular homeostasis controls to balance the absorption storage of iron in response to possible oxidative stress [29].
Two primary iron forms are found on the Earth: Fe3+ in the aerobic atmosphere and Fe2+ in reducing intracellular environments. Bacteria have developed a series of strategies for obtaining iron, including both Fe2+ and Fe3+-specific transporters [30]. Fe2+ is sufficiently soluble in bacteria, that it can be transported through porins in the outer membrane and then into the cytoplasm by FeoB (Ferrous iron transport protein B) [30]. Bacteria and fungi synthesize quantities of low molecular weight iron ligands called siderophores, which are secreted into the extracellular medium, where they bind Fe3+ with high affinity [31]. Adding ferric ions (Fe3+) to the medium can alleviate the toxicity of heavy metals to microorganisms [32]. The pathway for Fe3+-dicitrate uptakes may be mediated by the FecA (Ferric citrate uptake A) outer membrane protein, a periplasmic-binding protein (PBP) and FecDE (FecD (Ferric citrate uptake D) and FecE (Ferric citrate uptake E)) [30]. The transport of bound chelates across the outer membrane depends on TonB–ExbB–ExbD. This cytoplasmic membrane-localized complex transduces energy from the proton motive force to high-affinity receptors in the outer membrane [30].
The role of iron transport into cells is involved in important metabolic activities in the cell (such as cellular respiration, photosynthesis, and DNA synthesis, which require the participation of iron-containing metalloenzymes), and magnetotactic bacteria can synthesize some magnetic nanoparticles (magnetosomes). Ferrous sulfate is essential for the synthesis of magnetosomes in At. ferrooxidans [33,34]. The magnetosome is coated by a biofilm and synthesized under the control of cells. It is a new type of biological source magnetic nanomaterial. Its role is to serve as a functional material for the orientation and navigation of microorganisms. Magnetosomes are also products of microbial mineralization, which can produce a large amount of magnetite (Fe3O4) and greigite (Fe3S4) per year [35]. Su et al. [36] found that Fe3O4 can be a good precursor for fabricating nanomaterials applied in energy storage systems.
The purposes of this study are to understand the partial mechanisms by which At. ferrooxidans of the Dachang Copper Mine (DC) processes iron uptake and homeostasis in the presence of an abnormally abundant supply of Fe2+ in an acid environment. The function of NRAMP has been investigated in many microorganisms. However, there are few researches on its function in At. ferrooxidans DC. This deficiency motivated the study reported herein.

2. Materials and Methods

2.1. Bacterial Strains and Growth Conditions

The native At. ferrooxidans strain DC (gi:209405433) was isolated from the Dachang Copper Mine (DC), Guangxi Province, China [37]. At. ferrooxidans DC was grown under aerobic conditions (170 rpm) at 30 °C in 9-K basal salt medium [38] (per liter: 3.0 g (NH4)2SO4, 0.1 g K Cl, 0.5 g K2HPO4, 0.5 g MgSO4·7H2O, and 0.01 g Ca(NO3)2) containing sulfur (9K + S (9Ks): 0.8% (g/L) filter-sterilized sulfur adjusted to pH 2.2 with H2SO4). Based on the research purpose, the 9-Ks medium was modified as follows: 9Ks + Fe2+: 1, 10, 100, 300, and 600 mM FeSO4·7H2O.

2.2. Growth Curves

Media (9Ks + Fe2+) was inoculated with fresh mid-exponential-phase cells of At. ferrooxidans DC pregrown in 9Ks + Fe2+ and incubated at 30 °C. Samples were taken every day and counted in a Petroff–Hausser counting chamber under a phase-contrast microscope at 400× magnification. The number of cells per milliliter was plotted against the incubation time. All experiments were conducted at least twice, with two to three repetitions for each treatment.

2.3. Cell Collection

Before collecting the cells, At. ferrooxidans DC cultures for nucleic acid were centrifuged at 4500×g to remove iron precipitates. The cell pellet was resuspended in 9-K salt solution for further use. The washed cells were collected by centrifugation at 12,000×g for 10 min. To reach the same number of the cells before RNA was extracted from different samples, the concentration of each sample was calculated according to the standard curve at A600. Then, the corresponding volume was taken to reach 5 × 108 cells.

2.4. General DNA Techniques

Genomic DNA was extracted from At. ferrooxidans DC by the manufacturers of the reagents (Tiangen Biotech, Beijing, China). Oligonucleotide primers (F1: 5’-GATGTCAATGTATGCCACGC-3’ and R1: 5’-TATCCTCTATCGCCGCAATT-3’) used in this study and PCR was performed using a 25-μL PCR reaction system and conditions comprising a denaturation step of 3 min at 95 °C, followed by 30 amplification cycles (denaturation for 45 s at 95 °C, annealing for 45 s at 60 °C, and elongation for 90 s at 72 °C) and a final elongation step at 72 °C for 10 min. Each PCR reaction contained a 2-ng template DNA, 1-μM required primers, and 0.2-mM each deoxyribonucleotide in a volume of 25 μL of 2 × PCR mix containing 1.5-mM MgCl2 (Tiangen). The At. ferrooxidans DC Nramp coding region was amplified from chromosomal DNA preparations with a forward primer (F1) and reverse primer (R1). PCR product was purified from agarose gels with a DNA purification kit (Tiangen Biotech, Beijing, China) and sequenced by Sangon Biotech (Shanghai, China).

2.5. RNA Extraction and Reverse Transcription Quantitative Real-Time PCR (RT-qPCR)

Total RNA was extracted from At. ferrooxidans DC grown to the mid-exponential phase in 9-Ks medium in the presence of ferrous ion (Fe2+: 1, 10, 100, 300, and 600 mM) using the RNAprep Pure Cell/Bacteria Kit (Tiangen Biotech, Beijing, China) according to manufacturer instructions. Then, the RNA was immediately inversed-transcribed to the cDNA in a volume of 20 μL by a Quantscript RT Kit (Tiangen Biotech, Beijing, China). One microgram of total RNA was used for each reaction. The RNA integrality was evaluated by 2.0% agarose gel electrophoresis, and its purity and ratio of absorbance at 260 nm to 280 nm (A260/A280 ratio) were measured with the NanoDrop®ND-1000 Spectrophotometer (NanoDrop Technologies, Montchanin, DE, USA). RNA was temporarily stored at −80 °C, and the resulting cDNA was stored in aliquots at −20 °C until further use.
The integrity of the total cellular RNA was checked by formaldehyde agarose gel electrophoresis and ethidium bromide staining. The definition of the 23S and 16S bands was very high, and the luminance ratio between 23S and 16S was 2/1. The A260/A280, which was quantified with the NanoDrop®ND-1000 Spectrophotometer (NanoDrop Technologies, Montchanin, DE, USA), was about 1.75–2.0. These results indicated that the purity and integrity of the total cellular RNA was sufficient for this study.
To confirm that the RNA does not contain DNA, only RNA was used as a negative control in qPCR with other samples. The negative control did not produce a fluorescence signal, indicating that the RNA was not contaminated with DNA. The melt curve had only one peak, so there was no nonspecific product or primer dimer in the PCR products.
Primers for RT-qPCR assays [39] and amplicon size are listed in Table 1. The real-time PCR reactions were performed in the iCycler iQ real-time PCR detection system (Bio-Rad) using the RealMasterMix SYBR Green Kit (Tiangen Biotech, Beijing, China). Each 25-μL reaction contained 1 μL of cDNA template, 12.5 μL of real master mix, including the SyberGreen I fluorescent dye, enabling the monitoring of the PCR amplification, and the gene-specific primer pair at a final concentration of 200 nM for each primer. The cycling protocol was as follows: initial denaturation for 3 min at 95 °C, followed by 40 cycles of 15 s at 95 °C, 20 s at 59 °C, and 35 s at 68 °C. Fluorescence was measured after the extension phase at 68 °C. The PCR products were subjected to a melting curve analysis, which was followed by 80 consecutive cycles of 55 °C for 10 s, with each cycle increased by 0.5 °C. Specific amplification was confirmed by a single peak in the melting curve. The reactions for each target gene were performed in triplicate and the same PCR run.
The reverse-transcribed product (cDNA) 10-fold dilutions (ranging from 10−4 to 10−9) were used to generate a 6-point standard curve for every gene by using the quantification cycle (Cq, previously known as the threshold cycle (Ct)) value versus the logarithm of each dilution factor. Transcript quantities were calculated from the standard curve by the software accompanying the iCycler iQ real-time PCR detection System (Bio-Rad) set with default parameters. Each experiment included no template control, a negative control (RNA template), and a positive control (DNA template). Every sample was performed in triplicate.

2.6. Bioinformatic Analysis

A candidate Nramp gene of At. ferrooxidans DC was sequenced and identified by BLASTP (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The translated protein was further characterized using the following bioinformatics software or tools available online: primary structure identity and similarity by ClustalX 2.0 and the weblogo server (http://weblogo.berkeley.edu/logo.cgi), subcellular localization by the PSORTb v.3.0 server (http://www.psort.org/psortb/index.html), transmembrane protein analysis by the TMHMM v2.0 server (http://www.cbs.dtu.dk/services/TMHMM-2.0/), and transport motif recognition (http://myhits.isb-sib.ch/cgi-bin/motif_scan).

2.7. Expression Stability of Candidate Reference Genes

According to the methods of Vandesompele and Andersen implemented in the Visual Basic Application geNorm, the expression of the 7 selected reference genes (map, gmk, rplL, gyrA, recA, era, and rpoC) [40] at six different Fe2+ concentration were analyzed. A value of M results in a rank, where the best genes are those with the lowest M value [41]. TIGRFAMs were used to classify the reference genes by function (Table 2) [42]. Relative gene expression levels were normalized based on multiple reference genes. The ΔΔCt-based method (GeNorm software) was used to normalize the expression of AFE_2126 by correlating their Ct values of samples grown in the presence of different concentrations of ferrous iron to the Ct values of the reference genes.

2.8. Nucleotide Sequence Accession Number

The nucleotide sequence of the AFE_2126 gene and 7 selected reference genes (map, gmk, rplL, gyrA, recA, era, and rpoC) from At. ferrooxidans DC reported in this paper have been deposited in the National Center of Biotechnology Information of America nucleotide sequence database with accession numbers KC677728, KJ854561, KJ854563, KJ854559, KJ854562, KJ854560, KJ854557, and KJ854558.

3. Results

3.1. Identification and Sequencing of AFE_2126 Gene from At. Ferrooxidans DC

At. ferrooxidans DC was confirmed as At. ferrooxidans by the 16S ribosomal RNA gene (gi:209405433) fragment comparison with At. ferrooxidans ATCC23270 (gi:28194033). Based on the sequence of the At. ferrooxidans ATCC23270 chromosome, two primers, F1 and R1, were designed to amplify the putative open reading frame (ORF) encoding AFE_2126 from the genomic DNA of At. ferrooxidans DC. The amplified product was purified and confirmed by DNA sequencing. The results showed that AFE_2126 has a predicted length of 1371 nt ORF, encoding 456 amino acid residues (molecular mass 49.5 ku), and an isoelectric point of 6.55. It contains 24 acidic amino acids, 32 basic, 94 polar, and 306 nonpolar, covering 19 kinds of amino acids but Cys (cysteine). The percentages were calculated as 5.3% acidic residues, 7.0% basic, 20.6% polar, and 67.1% nonpolar.

3.2. Bioinformatic Analysis of the AFE_2126 from At. Ferrooxidans DC

Ten sequences were aligned with AFE_2126 amino acid sequences in At. ferrooxidans DC, by use of the Vector NTI Advance 10, and scores were calculated for pairwise comparisons (Table 3). Five expressed sequence tags from extreme acidophile (Acidithiobacillus ferrooxidans ATCC 53993, Acidithiobacillus ferrooxidans ATCC 23270, Alicyclobacillus acidocaldarius LAA1, Acidiphilium cryptum JF5, and Candidatus Methanosphaerula palustris E19c) were identified that share considerable identity with AFE_2126 amino acid sequences (100%, 88%, 60%, 52%, and 43%, respectively). However, another five expressed sequence tags from moderate bacteria (Escherichia coli O111:H-str. 11128), plants (Arabidopsis thaliana), yeast (Saccharomyces cerevisiae S288c), mouse (NRAMP1), and homo sapiens (NRAMP2) were identified that share identity with AFE_2126 amino acid sequences in the range of 15–20%. A transmembrane protein analysis indicated that the N-terminus of AFE_2126 was cytoplasmic and followed by 11 transmembrane segments and that the C-terminus was periplasmic, together with the loops between transmembrane segments (TMS)1/2, 3/4, 5/6, 7/8, and 9/10 (Figure 1). After transport motif recognition, there was a conserved transport motif (5’-QVIASIFMPAAMLFLLMLLNDREIMGSYVNRR-3’) in the AFE_2126 protein sequence from At. ferrooxidans DC, common among NRAMP homologs [43], and an intracytoplasmic consensus transport signature between transmembrane segments 10 and 11. The subcellular localization of the AFE_2126 protein was predicted to lie in the cytoplasmic membrane (Supplementary File S1) based on analysis by the PSORTb v.3.0 server [44] and its sequence indicated the presence of eleven internal helices (Figure 1 and Supplementary File S2) by the TMHMM v2.0 server [45].

3.3. Prediction of Conserved Sites and Domains of the NRAMP Homolog

Multiple sequence alignment analysis revealed that there were many conserved sites and domains (Figure 2). As shown in Figure 2a, TMS1 (transmembrane segments) contained a motif GP(G/A). The predicted extracytoplasmic loop 1 (between TM1 and TM2) contains the Nramp conserved motif D(P/A)G(N/G) (Figure 2b). Motif DAGG extracytoplasmic loop 1 existed in At. ferrooxidans DC and most prokaryotes, and motif DPGN existed in most eukaryotes and few prokaryotes (Supplementary File S3). Intracytoplasmic loop 2 contained a motif Qx(L/M)xxxxGxxTxxx(L/H)xxx(C/I) (Figure 2c), extracytoplasmic loop 2 contained a motif E(V/F)xG (Figure 2d), and TMS 6 contained a motif GxxxxP(H/W)xx(F/Y) (Figure 2e).
Multiple sequence alignment analysis revealed that there were many conserved sites and domains (Figure 2), which may be provided with specific roles. Some of them were studied and clarified by some authors, and the others were unclear in function. After multiple sequence alignments from bacteria to humans, the results showed that there were many invariant and variant sites, which may be important for the function of iron transport and the apparent transporter affinity for H+.

3.4. Selection and Evaluation of Reference Genes

We studied the mRNA expression levels of seven candidate reference genes from At. ferrooxidans DC in six different Fe2+ concentrations using RT-qPCR and evaluated their expression stabilities. In short, the geNorm method is based on the pairwise comparison method. It depends on the calculation of an M value, which is defined as the average pairwise variation of a particular gene from all other genes [41]. The M values are less than 1.5, which satisfy the requirements for the stability evaluation of the candidate reference genes (Supplementary File S4). According to geNorm, era, gmk, and rpoC showed the least variability in expression in all conditions evaluated (Supplementary File S5). Descending order of the expression stabilities was era, gmk, rpoC, gyrA, recA, map, and rplL. We chose the first three candidate reference genes (era, gmk, and rpoC) as reference genes of this study to ensure the results were more reliable.

3.5. Expression of NRAMP in At. Ferrooxidans DC in Different Growth Conditions

RT-qPCR experiment was designed to measure NRAMP mRNA levels. We chose three candidate reference mRNA (era, gmk, and rpoC) as reference genes to normalize the expression of AFE_2126 mRNA, because they showed the least variability in ferrous iron concentrations. Then, we got a different expression level of AFE_2126 mRNA in different ferrous iron concentrations. In order to easily identify the change trends, we set the minimum value as one and others greater than one (Figure 3). Figure 3 shows that, when the ferrous iron concentration was 600 mM, the expression level of AFE_2126 mRNA was the least. The relative expression of different ferrous ion concentrations: 300 mM, 100 mM, 10 mM, 1 mM, and 0 mM, compared to 600 mM, were 1.1, 2.3, 11.7, 13.6, and 18.5-fold, respectively (Figure 3 and Supplementary File S6). The results showed that AFE_2126 mRNA levels in At. ferrooxidans DC were upregulated in response to decreases in the ambient Fe2+. According to an unpaired t-test at 95% confidence, we found that there was no significant change in the relative expressions at growth conditions of 600-mM and 300-mM ferrous ion concentrations. The ferrous ion concentration may be too high, indicating that it was no longer the limiting factor for bacterial growth. Instead, it became a toxic factor, which limited the expression of ferrous ion uptake genes.

4. Discussion

4.1. The AFE_2126 Protein Belongs to the NRAMP Family of Membrane Transporters

The NRAMP family is a novel family of functionally related proteins that is defined by a common conserved hydrophobic core of ten transmembrane domains and either one or two nonconserved, highly hydrophobic TM domains [43,46]. The AFE_2126 protein sequence indicated the presence of eleven internal helices. AFE_2126 amino acid sequences share identity with eukaryotes in the range of 15–20%. Still, they have many remote homologies based on discrete sequence motifs, which are highly conserved between many members of the Nramp family (Figure 2). On the basis of these analyses, it is proposed that the AFE_2126 protein belongs to the NRAMP family of membrane transporters.

4.2. AFE_2126 Protein has Many Conserved Motifs Associated with Metal Ion Transport

The predicted extracytoplasmic loop 1 (between TM1 and TM2) contains the Nramp conserved motif D(P/A)G(N/G) (Figure 2), which is of importance for the proper function of the transporter [7]. When DMT1 residue Gly88 was replaced by Ala, it led to abolishing both the Me2+ uptake (55Fe2+, 54Mn2+ and 60Co2+) and metal-state currents [47]. The motif DAGG extracytoplasmic loop 1 existed in At. ferrooxidans DC and most prokaryotes, and motif DPGN existed in most eukaryotes and few prokaryotes (Supplementary File S3). As shown in Figure 2, TMS1 (transmembrane segments) contained a motif GP(G/A), the extracytoplasmic loop 2 contained a motif E(V/F)xG, TMS 6 contained a motif GxxxxP(H/W)xx(F/Y), and intracytoplasmic loop 2 contained a motif Qx(L/M)xxxxGxxTxxx(L/H)xxx(C/I). The functions of these conserved sites were unclear in At. ferrooxidans DC, so the function will be studied through mutagenesis approaches and a toxicity assay [48] in the future.

4.3. AFE_2126 Protein Mediates the Uptake of Fe2+

The results showed that AFE_2126 mRNA levels in At. ferrooxidans DC were upregulated in response to decreases in the ambient Fe2+. Navarro et al. [49] suggested that the gene coded for the potential efflux system, due to the increase of gene expressions with the rise of the metal ion concentrations. In contrast, the results in Figure 3 suggest that AFE_2126 is more probably related to a Fe2+ import protein rather than to a Fe2+ efflux protein, as had been previously proposed through a bioinformatic prediction and in the reports of other organisms [50]. The cytoplasmic membrane expression of mRNA is increased in iron deficiency, which indicates that the microorganisms take up necessary iron to maintain the normal metabolism of life by increasing the expression of specific functional genes to survive. In the future, we will use the markerless mutagenesis strategy [51,52] to further verify the function of AFE_2126 through the mutant responses under various ferrous ion stresses.

4.4. AFE_2126 Protein is a Symporter of H+ and Iron (Fe2+)

As known to all, the growth-medium pH of At. ferrooxidans is between 1.5–2.5 [20,53], while the periplasm pH is around 3.5 [54], and the cytoplasm pH is thought to be 6.5 [20]. The AFE_2126 gene was predicted to lie in the cytoplasmic membrane (between the cytoplasm and the periplasm). From the results of these analysis, it suggests that AFE_2126 functions to transport Fe2+ from the periplasm to the cytoplasm (Figure 4). Overall, these results also conclude that Fe2+ is transported in the direction identical to that of the H+ gradient, i.e., symport (Figure 4), as demonstrated for Nramp2 [55], rather than antiport, as demonstrated for Nramp1 in Xenopus laevis [56]. This finding is consistent with the function in the iron transport from the acidified lumen of the endosomes into the cytoplasm [57]. In this case, the energy transported is provided by an electrochemical proton gradient, rather than directly driven by ATP hydrolysis [58,59]. For the Nramp1 function, ATP hydrolysis is maintained by the activity of the vesicular ATPase [60]. In the normally acidic late-endosomal/lysosomal compartment, Nramp1’s function is to transport Fe2+ and other metal ions from a high pH (cytoplasmic) to a low pH (intravesicular) [56]. Unusually, the proton uptake drives cation symports [60]. Gu et al. [55] indicated that the cotransport of H+ could lead to a slight decrease of pH on the inner membrane surface, resulting in maintaining the dissolution of iron before its binding to intracellular proteins. The transfer of ferrous iron into cells may be used to synthesize functional materials such as magnetosomes [34,61].

5. Conclusions

After genome sequencing and sequence-similarity analyses, it is speculated that AFE_2126 of At. ferrooxidans DC belongs to the Nramp family, its N-terminus is cytoplasmic, followed by 11 transmembrane segments, and the C-terminus is periplasmic, and the loops between TMS1/2, 3/4, 5/6, 7/8, and 9/10. The transporter property of AFE_2126 was studied by indirect measurement (RT-qPCR), and the results presented that AFE_2126 mRNA was upregulated in response to an iron deficiency, showing it can mediate the uptake of Fe2+. Based on the ΔpH of the cytoplasmic membrane between the cytoplasm and the periplasm, it can be concluded that the AFE_2126 protein is a symporter of H+ and iron (Fe2+). Fe2+ and H+ diffuse through the porins of the outer membrane (OM) and are subsequently transported into the cytoplasm by NRAMP anchored in the inner membrane (IM). The establishment of its expression pattern in bacteria and its subcellular localization will help elucidate the function of the NRAMP protein in bacteria.

Supplementary Materials

The following are available online at https://www.mdpi.com/2075-163X/10/6/544/s1, S1. PSORTb v.3.0 server results. S2. TMHMM results. S3. CLUSTAL 2.0.12 MULTIPLE SEQUENCE ALIGNMENT. S4. The M value calculated from raw data by geNorm. S5. Expression stability of candidate reference genes. S6. Fold expression calculations.

Author Contributions

Conceptualization, B.M., X.L., and X.W.; data curation, B.M.; project administration, X.L. and X.W.; writing—original draft, B.M.; and writing—review and editing, L.S. and W.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by The National Key Basic Research Program of China, grant number 2010CB630901, the Natural Science Foundation of Hunan Province, grant number 2015JJ2165, and National Natural Science Foundation of China (31570113).

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Gruenheid, S.; Cellier, M.; Vidal, S.; Gros, P. Identification and characterization of a second mouse Nramp gene. Genomics 1995, 25, 514–525. [Google Scholar] [CrossRef]
  2. Cellier, M.F.; Bergevin, I.; Boyer, E.; Richer, E. Polyphyletic origins of bacterial Nramp transporters. Trends Genet. 2001, 17, 365–370. [Google Scholar] [CrossRef]
  3. Williams, L.E.; Pittman, J.K.; Hall, J.L. Emerging mechanisms for heavy metal transport in plants. Biochim. et Biophys. Acta 2000, 1465, 104–126. [Google Scholar] [CrossRef]
  4. Vidal, S.; Belouchi, A.M.; Cellier, M.; Beatty, B.; Gros, P. Cloning and characterization of a second human NRAMP gene on chromosome 12q13. Mamm. Genome 1995, 6, 224–230. [Google Scholar] [CrossRef]
  5. Bozzi, A.T.; Bane, L.B.; Weihofen, W.A.; Singharoy, A.; Guillen, E.R.; Ploegh, H.L.; Schulten, K.; Gaudet, R. Crystal structure and conformational change mechanism of a bacterial Nramp-family divalent metal transporter. Structure 2016, 24, 2102–2114. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  6. Yanatori, I.; Kishi, F. DMT1 and iron transport. Free. Radic. Biol. Med. 2019, 133, 55–63. [Google Scholar] [CrossRef] [PubMed]
  7. Courville, P.; Chaloupka, R.; Cellier, M.F. Recent progress in structure-function analyses of Nramp proton-dependent metal-ion transporters. Biochem. Cell Biol. 2006, 84, 960–978. [Google Scholar] [CrossRef]
  8. Peracino, B.; Wagner, C.; Balest, A.; Balbo, A.; Pergolizzi, B.; Noegel, A.A.; Steinert, M.; Bozzaro, S. Function and mechanism of action of Dictyostelium Nramp1 (Slc11a1) in bacterial infection. Traffic 2006, 7, 22–38. [Google Scholar] [CrossRef]
  9. Lam-Yuk-Tseung, S.; Govoni, G.; Forbes, J.; Gros, P. Iron transport by Nramp2/DMT1: pH regulation of transport by 2 histidines in transmembrane domain 6. Blood 2003, 101, 3699–3707. [Google Scholar] [CrossRef] [Green Version]
  10. Cohen, A.; Nelson, H.; Nelson, N. The family of SMF metal ion transporters in yeast cells. J. Biol. Chem. 2000, 275, 33388–33394. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  11. Vidal, S.M.; Malo, D.; Vogan, K.; Skamene, E.; Gros, P. Natural resistance to infection with intracellular parasites: Isolation of a candidate for Bcg. Cell 1993, 73, 469–485. [Google Scholar] [CrossRef]
  12. Li, J.; Wang, L.; Zheng, L.; Wang, Y.; Chen, X.; Zhang, W. A functional study identifying critical residues involving metal transport activity and selectivity in natural resistance-associated macrophage protein 3 in Arabidopsis thaliana. Int. J. Mol. Sci. 2018, 19, 1430. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  13. Curie, C.; Alonso, J.M.; Le Jean, M.; Ecker, J.R.; Briat, J.F. Involvement of NRAMP1 from Arabidopsis thaliana in iron transport. Biochem. J. 2000, 347 Pt 3, 749–755. [Google Scholar] [CrossRef]
  14. Thomine, S.; Wang, R.; Ward, J.; Crawford, N.; Schroeder, J. Cadmium and iron transport by members of a plant metal transporter family in Arabidopsis with homology to Nramp genes. Proc. Natl. Acad. Sci. USA 2000, 97, 4991–4996. [Google Scholar] [CrossRef] [Green Version]
  15. Agranoff, D.; Monahan, I.M.; Mangan, J.A.; Butcher, P.D.; Krishna, S. Mycobacterium tuberculosis expresses a novel pH-dependent divalent cation transporter belonging to the Nramp family. J. Exp. Med. 1999, 190, 717–724. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  16. Osorio, H.; Martinez, V.; Veloso, F.A.; Pedroso, I.; Valdes, J.; Jedlicki, E.; Holmes, D.S.; Quatrini, R. Iron homeostasis strategies in acidophilic iron oxidizers: Studies in Acidithiobacillus and Leptospirillum. Hydrometallurgy 2008, 94, 175–179. [Google Scholar] [CrossRef]
  17. Mangold, S.; Potrykus, J.; Bjorn, E.; Lovgren, L.; Dopson, M. Extreme zinc tolerance in acidophilic microorganisms from the bacterial and archaeal domains. Extremophiles 2013, 17, 75–85. [Google Scholar] [CrossRef] [PubMed]
  18. Potrykus, J.; Jonna, V.R.; Dopson, M. Iron homeostasis and responses to iron limitation in extreme acidophiles from the Ferroplasma genus. Proteomics 2011, 11, 52–63. [Google Scholar] [CrossRef] [PubMed]
  19. Ai, C.B.; Yan, Z.; Chai, H.S.; Gu, T.Y.; Wang, J.J.; Chai, L.Y.; Qiu, G.Z.; Zeng, W.M. Increased chalcopyrite bioleaching capabilities of extremely thermoacidophilic Metallosphaera sedula inocula by mixotrophic propagation. J. Ind. Microbiol. Biot. 2019, 46, 1113–1127. [Google Scholar] [CrossRef]
  20. Rawlings, D.E. Characteristics and adaptability of iron- and sulfur-oxidizing microorganisms used for the recovery of metals from minerals and their concentrates. Microb. Cell Factories 2005, 4, 13. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  21. Zhang, Y.; Zhao, H.; Zhang, Y.; Liu, H.; Yin, H.; Deng, J.; Qiu, G. Interaction mechanism between marmatite and chalcocite in acidic (microbial) environments. Hydrometallurgy 2020, 191, 105217. [Google Scholar] [CrossRef]
  22. Ma, L.; Wang, X.; Feng, X.; Liang, Y.; Xiao, Y.; Hao, X.; Yin, H.; Liu, H.; Liu, X. Co-culture microorganisms with different initial proportions reveal the mechanism of chalcopyrite bioleaching coupling with microbial community succession. Bioresour. Technol. 2017, 223, 121–130. [Google Scholar] [CrossRef] [PubMed]
  23. Ma, L.Y.; Wang, X.J.; Tao, J.M.; Feng, X.; Zou, K.; Xiao, Y.H.; Liang, Y.L.; Yin, H.Q.; Liu, X.D. Bioleaching of the mixed oxide-sulfide copper ore by artificial indigenous and exogenous microbial community. Hydrometallurgy 2017, 169, 41–46. [Google Scholar] [CrossRef]
  24. Gao, X.Y.; Liu, X.J.; Fu, C.A.; Gu, X.F.; Lin, J.Q.; Liu, X.M.; Pang, X.; Lin, J.Q.; Chen, L.X. Novel strategy for improvement of the bioleaching efficiency of Acidithiobacillus ferrooxidans based on the AfeI/R quorum sensing system. Minerals-Basel 2020, 10, 222. [Google Scholar] [CrossRef] [Green Version]
  25. Ai, C.; Liang, Y.; Miao, B.; Chen, M.; Zeng, W.; Qiu, G. Identification and analysis of a novel gene cluster involves in Fe2+ oxidation in Acidithiobacillus ferrooxidans ATCC 23270, a typical biomining acidophile. Curr. Microbiol. 2018, 75, 818–826. [Google Scholar] [CrossRef]
  26. Liu, H.C.; Xia, J.L.; Nie, Z.Y.; Zheng, L.; Ma, C.Y.; Zhao, Y.D. Differential utilization and speciation transformation of orthorhombic alpha-S-8 and amorphous mu-S by substrate-acclimated mesophilic Acidithiobacillus ferrooxidans. Trans. Nonferrous Met. Soc. China 2015, 25, 3096–3102. [Google Scholar] [CrossRef]
  27. Ma, L.; Wang, X.; Tao, J.; Feng, X.; Liu, X.; Qin, W. Differential fluoride tolerance between sulfur- and ferrous iron-grown Acidithiobacillus ferrooxidans and its mechanism analysis. Biochem. Eng. J. 2017, 119, 59–66. [Google Scholar] [CrossRef]
  28. Braun, V.; Killmann, H. Bacterial solutions to the iron-supply problem. Trends Biochem. Sci. 1999, 24, 104–109. [Google Scholar] [CrossRef]
  29. Touati, D. Iron and oxidative stress in bacteria. Arch. Biochem. Biophys. 2000, 373, 1–6. [Google Scholar] [CrossRef]
  30. Velayudhan, J.; Hughes, N.J.; McColm, A.A.; Bagshaw, J.; Clayton, C.L.; Andrews, S.C.; Kelly, D.J. Iron acquisition and virulence in Helicobacter pylori: A major role for FeoB, a high-affinity ferrous iron transporter. Mol. Microbiol. 2000, 37, 274–286. [Google Scholar] [CrossRef]
  31. Schalk, I.J.; Yue, W.W.; Buchanan, S.K. Recognition of iron-free siderophores by TonB-dependent iron transporters. Mol. Microbiol. 2004, 54, 14–22. [Google Scholar] [CrossRef] [PubMed]
  32. Chen, A.; Hao, X.; Xiao, Y.; Zou, K.; Liu, H.; Liu, X.; Yin, H.; Qiu, G.; Liang, Y. Responses of Acidithiobacillus thiooxidans A01 to Individual and Joint Nickel (Ni2+) and Ferric (Fe3+). Minerals-Basel 2019, 9, 82. [Google Scholar] [CrossRef] [Green Version]
  33. Zhang, S.; Yan, L.; Li, H.Y.; Liu, H.T. Optimal conditions for growth and magnetosome formation of Acidithiobacillus ferrooxidans. Afr. J. Microbiol. Res. 2012, 6, 6142–6151. [Google Scholar] [CrossRef]
  34. Liu, W.B.; Wu, H.Y.; Liu, X.D.; Liu, X.X. Influence of different Fe sources and concentrations on formation of magnetosomes in Acidithiobacillus ferrooxidans. T. Nonferr. Metal Soc. 2008, 18, 1379–1385. [Google Scholar] [CrossRef]
  35. Lin, W.; Pan, Y.; Bazylinski, D.A. Diversity and ecology of and biomineralization by magnetotactic bacteria. Environ. Microbiol. Rep. 2017, 9, 345–356. [Google Scholar] [CrossRef] [PubMed]
  36. Su, Y.B.; Wang, F.X.; Zhang, J.; Tong, R.A.; Chong, S.K.; Wang, W.; Wang, C.A.; Chen, C.F. A monocrystal Fe3O4@ultrathin N-doped carbon core/shell structure: From magnetotactic bacteria to Li storage. J. Mater. Chem. A 2019, 7, 20899–20904. [Google Scholar] [CrossRef]
  37. Zhang, Y.; Wu, X.; Liu, D.; Duan, H.; Fan, H. Sequencing and bioinformatics analysis of the metal-related genes in Acidithiobacillus ferrooxidans strain DC. Folia Microbiol. (Praha) 2013, 58, 551–560. [Google Scholar] [CrossRef]
  38. Silverman, M.P.; Lundgren, D.G. Studies on the chemoautotrophic iron bacterium Ferrobacillus ferrooxidans: I. An improved medium and a harvesting procedure for securing high cell yields. J. Bacteriol. 1959, 77, 642–647. [Google Scholar] [CrossRef] [Green Version]
  39. Nolan, T.; Hands, R.; Bustin, S. Quantification of mRNA using real-time RT-PCR. Nat. Protoc. 2006, 1, 1559–1582. [Google Scholar] [CrossRef]
  40. Pamela, N.; Paulo, C.; Eugenia, J.; David, H.; Raquel, Q. Selection and evaluation of reference genes for improved interrogation of microbial transcriptomes: Case study with the extremophile Acidithiobacillus ferrooxidans. BMC Mol. Biol. 2009, 10, 1–11. [Google Scholar] [CrossRef] [Green Version]
  41. Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome. Biol. 2002, 3, RESEARCH0034. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  42. Gil, R.; Silva, F.J.; Pereto, J.; Moya, A. Determination of the core of a minimal bacterial gene set. Microbiol. Mol. Biol. Rev. 2004, 68, 518–537. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  43. Cellier, M.; Prive, G.; Belouchi, A.; Kwan, T.; Rodrigues, V.; Chia, W.; Gros, P. Nramp defines a family of membrane proteins. Proc. Natl. Acad. Sci. USA 1995, 92, 10089–10093. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  44. Yu, N.Y.; Wagner, J.R.; Laird, M.R.; Melli, G.; Rey, S.; Lo, R.; Dao, P.; Sahinalp, S.C.; Ester, M.; Foster, L.J.; et al. PSORTb 3.0: Improved protein subcellular localization prediction with refined localization subcategories and predictive capabilities for all prokaryotes. Bioinformatics 2010, 26, 1608–1615. [Google Scholar] [CrossRef] [PubMed]
  45. Moller, S.; Croning, M.D.R.; Apweiler, R. Evaluation of methods for the prediction of membrane spanning regions. Bioinformatics 2001, 17, 646–653. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  46. Nevo, Y.; Nelson, N. The NRAMP family of metal-ion transporters. Biochim. et Biophys. Acta 2006, 1763, 609–620. [Google Scholar] [CrossRef] [Green Version]
  47. Cohen, A.; Nevo, Y.; Nelson, N. The first external loop of the metal ion transporter DCT1 is involved in metal ion binding and specificity. Proc. Natl. Acad. Sci. USA 2003, 100, 10694–10699. [Google Scholar] [CrossRef] [Green Version]
  48. Bozzi, A.T.; Bane, L.B.; Weihofen, W.A.; McCabe, A.L.; Singharoy, A.; Chipot, C.J.; Schulten, K.; Gaudet, R. Conserved methionine dictates substrate preference in Nramp-family divalent metal transporters. Proc. Natl. Acad. Sci. USA 2016, 113, 10310–10315. [Google Scholar] [CrossRef] [Green Version]
  49. Navarro, C.A.; Orellana, L.H.; Mauriaca, C.; Jerez, C.A. Transcriptional and functional studies of Acidithiobacillus ferrooxidans genes related to survival in the presence of copper. Appl. Environ. Microbiol. 2009, 75, 6102–6109. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  50. Wei, W.; Chai, T.; Zhang, Y.; Han, L.; Xu, J.; Guan, Z. The Thlaspi caerulescens NRAMP homologue TcNRAMP3 is capable of divalent cation transport. Mol. Biotechnol. 2009, 41, 15–21. [Google Scholar] [CrossRef]
  51. van Zyl, L.J.; van Munster, J.M.; Rawlings, D.E. Construction of arsB and tetH mutants of the sulfur-oxidizing bacterium Acidithiobacillus caldus by marker exchange. Appl. Environ. Microbiol. 2008, 74, 5686–5694. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  52. Wang, H.Y.; Liu, X.M.; Liu, S.S.; Yu, Y.Y.; Lin, J.Q.; Lin, J.Q.; Pang, X.; Zhao, J. Development of a markerless gene replacement system for Acidithiobacillus ferrooxidans and construction of a pfkB mutant. Appl. Environ. Microbiol. 2012, 78, 1826–1835. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  53. Yu, Z.J.; Yu, R.L.; Liu, A.J.; Liu, J.; Zeng, W.M.; Liu, X.D.; Qiu, G.Z. Effect of pH values on extracellular protein and polysaccharide secretions of Acidithiobacillus ferrooxidans during chalcopyrite bioleaching. Trans. Nonferr Metal Soc China 2017, 27, 406–412. [Google Scholar] [CrossRef]
  54. Kai, M.; Yano, T.; Fukumori, Y.; Yamanaka, T. Cytochrome oxidase of an acidophilic iron-oxidizing bacterium, Thiobacillus ferrooxidans, functions at pH 3.5. Biochem. Biophys. Res Commun. 1989, 160, 839–843. [Google Scholar] [CrossRef]
  55. Gunshin, H.; Mackenzie, B.; Berger, U.V.; Gunshin, Y.; Romero, M.F.; Boron, W.F.; Nussberger, S.; Gollan, J.L.; Hediger, M.A. Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature 1997, 388, 482–488. [Google Scholar] [CrossRef] [PubMed]
  56. Goswami, T.; Bhattacharjee, A.; Babal, P.; Searle, S.; Moore, E.; Li, M.; Blackwell, J.M. Natural-resistance-associated macrophage protein 1 is an H+/bivalent cation antiporter. Biochem. J. 2001, 354, 511–519. [Google Scholar] [CrossRef] [PubMed]
  57. Garrick, M.D.; Gniecko, K.; Liu, Y.; Cohan, D.S.; Garrick, L.M. Transferrin and the transferrin cycle in Belgrade rat reticulocytes. J. Biol. Chem. 1993, 268, 14867–14874. [Google Scholar]
  58. Nelson, N. Energizing porters by proton-motive force. J. Exp. Biol. 1994, 196, 7–13. [Google Scholar]
  59. Ehrnstorfer, I.A.; Manatschal, C.; Arnold, F.M.; Laederach, J.; Dutzler, R. Structural and mechanistic basis of proton-coupled metal ion transport in the SLC11/NRAMP family. Nat. Commun. 2017, 8, 14033. [Google Scholar] [CrossRef] [Green Version]
  60. Nelson, N.; Sacher, A.; Nelson, H. The significance of molecular slips in transport systems. Nat. Rev. Mol. Cell Biol. 2002, 3, 876–881. [Google Scholar] [CrossRef]
  61. Wu, L.B.; Yang, B.J.; Wang, X.X.; Wu, B.Q.; He, W.L.; Gan, M.; Qiu, G.Z.; Wang, J. Effects of single and mixed energy sources on intracellular nanoparticles synthesized by Acidithiobacillus ferrooxidans. Minerals-Basel 2019, 9, 163. [Google Scholar] [CrossRef] [Green Version]
Minerals 10 00544 g001 550
Figure 1. TMHMM posterior probabilities predictions for the transmembrane helices of the AFE_2126 protein from At. ferrooxidans of the Dachang Copper Mine (DC). A transmembrane protein analysis indicated that the N-terminus of AFE_2126 was cytoplasmic and followed by 11 transmembrane segments and that the C-terminus was periplasmic, together with the loops between transmembrane segments (TMS)1/2, 3/4, 5/6, 7/8, and 9/10.
Figure 1. TMHMM posterior probabilities predictions for the transmembrane helices of the AFE_2126 protein from At. ferrooxidans of the Dachang Copper Mine (DC). A transmembrane protein analysis indicated that the N-terminus of AFE_2126 was cytoplasmic and followed by 11 transmembrane segments and that the C-terminus was periplasmic, together with the loops between transmembrane segments (TMS)1/2, 3/4, 5/6, 7/8, and 9/10.
Minerals 10 00544 g001
Minerals 10 00544 g002a 550Minerals 10 00544 g002b 550
Figure 2. Comparison of the web logos of the Nramp family from bacteria to humans. All the logos are based on an alignment of 26 sequences (Supplementary File S3). The height of the entire vertical axis is 4 bits for all the logos. Specific sites of At. ferrooxidans DC are indicated by boldface letters in each picture bottom. (a) TM1, (b) extracytoplasmic loop 1, (c) intracytoplasmic loop 2, (d) extracytoplasmic loop 2, and (e) TM6.
Figure 2. Comparison of the web logos of the Nramp family from bacteria to humans. All the logos are based on an alignment of 26 sequences (Supplementary File S3). The height of the entire vertical axis is 4 bits for all the logos. Specific sites of At. ferrooxidans DC are indicated by boldface letters in each picture bottom. (a) TM1, (b) extracytoplasmic loop 1, (c) intracytoplasmic loop 2, (d) extracytoplasmic loop 2, and (e) TM6.
Minerals 10 00544 g002aMinerals 10 00544 g002b
Minerals 10 00544 g003 550
Figure 3. RT-qPCR analysis of the expression profile of AFE_2126 in response to different concentrations of ferrous ion (Fe2+). Data are shown as relative expressions compared to the pooled cDNA sample (the highest concentration of ferrous ion) used as the reference for the microarray experiment. The relative expressions of different ferrous ion concentrations: 600 mM, 300 mM, 100 mM, 10 mM, 1 mM, and 0 mM were 1, 1.1, 2.3, 11.7, 13.6, and 18.5.
Figure 3. RT-qPCR analysis of the expression profile of AFE_2126 in response to different concentrations of ferrous ion (Fe2+). Data are shown as relative expressions compared to the pooled cDNA sample (the highest concentration of ferrous ion) used as the reference for the microarray experiment. The relative expressions of different ferrous ion concentrations: 600 mM, 300 mM, 100 mM, 10 mM, 1 mM, and 0 mM were 1, 1.1, 2.3, 11.7, 13.6, and 18.5.
Minerals 10 00544 g003
Minerals 10 00544 g004 550
Figure 4. Proposed model for NRAMP-mediated Fe2+ uptake. Fe2+ and H+ diffuse through the porins of the outer membrane (OM) and are subsequently transported into the cytoplasm by NRAMP anchored in the inner membrane (IM).
Figure 4. Proposed model for NRAMP-mediated Fe2+ uptake. Fe2+ and H+ diffuse through the porins of the outer membrane (OM) and are subsequently transported into the cytoplasm by NRAMP anchored in the inner membrane (IM).
Minerals 10 00544 g004
Table
Table 1. Reference genes, qPCR primers, and reaction parameters.
Table 1. Reference genes, qPCR primers, and reaction parameters.
Loci*Forward Primer (5’ > 3’)Reverse Primer (5’ > 3’)Amplicon Size (bp)Q-PCR Linear Correlation Coefficient
AFE_2126 (NRAMP)CTCTGGTGGTGCTGATTCATGAATATGGAAGCGATTACCT761.000
AFE_2121 (map)CTTTCCCAAATCCGTCTGGATAGCCATCCTTGATAACC1220.995
AFE_2475 (gmk)GATGCGTTAGCCGACTTGACTGTTAATACCGAGGAGATTC1081.000
AFE_2714 (rplL)TGGAAGAACAGACCGAATAGACCAAGACCAGTGATG970.999
AFE_2150 (gyrA)CGTATCGCCATTGAACTCTTGATATTGAACACGCTCTG950.997
AFE_2114 (recA)GCTCACCGCCAATATCTCGGACTGCCATACATCACC870.998
AFE_1680 (era)CAATCTGCGGTTTATGGCCGTGTCGTAGGGTAGTTC790.990
AFE_2711 (rpoC)GGTGAACGCTATAACAAGTACACGGTATCCTTACTG950.999
*AFE_2126 (NRAMP) is a gene of interest (GOI); others are candidate reference genes.
Table
Table 2. The characteristics of seven candidate reference genes from At. ferrooxidans DC.
Table 2. The characteristics of seven candidate reference genes from At. ferrooxidans DC.
TIGR LocusGene SymbolCommon Name TIGRBiological ProcessFunctional Category
AFE_2121mapmethionine aminopeptidase, type IProtein processingProtein posttranslational modification
AFE_2475gmkguanylate kinaseEnergetic and intermediary metabolismBiosynthesis of nucleotides
AFE_2714rplLribosomal protein L7/L12Protein processingSynthesis and modification of ribosomal proteins:
AFE_2150gyrADNA gyrAse, A subunitDNA MetabolismBasic replication machinery
AFE_2114recArecA proteinDNA MetabolismDNA replication, recombination, and repair
AFE_1680eraGTP-binding protein EraRNA MetabolismTranslation: ribosome function, maturation, and modification
AFE_2711rpoCDNA-directed RNA polymerase, β subunitRNA MetabolismBasic transcription machinery
The Institute for Genomic Research (TIGR).
Table
Table 3. Percent similarity and identity (in parentheses) scores were calculated between AFE_2126 from At. ferrooxidans of the Dachang Copper Mine (DC) and Nramp-related proteins.
Table 3. Percent similarity and identity (in parentheses) scores were calculated between AFE_2126 from At. ferrooxidans of the Dachang Copper Mine (DC) and Nramp-related proteins.
GI NumberOrganismsProtein Symbol and Protein DescriptionSimilarity
gi:218667514 (456 aa)Acidithiobacillus ferrooxidans ATCC 23270NRAMP family100 (100)
gi:198282304 (456 aa)Acidithiobacillus ferrooxidans ATCC 53993NRAMP family95 (88)
gi:218288940 (448 aa)Alicyclobacillus acidocaldarius LAA1NRAMP family75 (60)
gi:148244067 (457 aa)Acidiphilium cryptum JF5NRAMP family72 (52)
gi:219850775 (425 aa)Candidatus Methanosphaerula palustris E19cNRAMP family64 (43)
gi:260869095 (412 aa)Escherichia coli O111:H-str. 11128manganese/divalent cation transporter MntH40 (20)
gi: 6468012
(509 aa)		Arabidopsis thalianametal transporter Nramp336 (17)
gi:6321841
(549 aa)		Saccharomyces cerevisiae S288cSmf2 (probable NRAMP divalent cation transporter)35 (18)
gi:295293167 (590 aa)Homo sapiensNramp2 (multiple divalent cation transporter for Fe2+, Mn2+, and Zn2+)34 (18)
gi:730193
(548 aa)		MouseNramp1, divalent transition metal (iron and manganese) transporter32 (17)

Share and Cite

MDPI and ACS Style

Miao, B.; Shen, L.; Liu, X.; Zeng, W.; Wu, X. Bioinformatics and Transcriptional Study of the Nramp Gene in the Extreme Acidophile Acidithiobacillus ferrooxidans Strain DC. Minerals 2020, 10, 544. https://doi.org/10.3390/min10060544

AMA Style

Miao B, Shen L, Liu X, Zeng W, Wu X. Bioinformatics and Transcriptional Study of the Nramp Gene in the Extreme Acidophile Acidithiobacillus ferrooxidans Strain DC. Minerals. 2020; 10(6):544. https://doi.org/10.3390/min10060544

Chicago/Turabian Style

Miao, Bo, Li Shen, Xueduan Liu, Weimin Zeng, and Xueling Wu. 2020. "Bioinformatics and Transcriptional Study of the Nramp Gene in the Extreme Acidophile Acidithiobacillus ferrooxidans Strain DC" Minerals 10, no. 6: 544. https://doi.org/10.3390/min10060544

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop