Next Article in Journal
Study on Soil Erosion Driving Forces by Using (R)USLE Framework and Machine Learning: A Case Study in Southwest China
Next Article in Special Issue
Effect of Different Tillage and Residue Management Options on Soil Water Transmission and Mechanical Behavior
Previous Article in Journal
Resilience Practices Contribution Enabling European Landscape Policy Innovation and Implementation
Previous Article in Special Issue
The Mineral Biochar Alters the Biochemical and Microbial Properties of the Soil and the Grain Yield of Hordeum vulgare L. under Drought Stress
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Main Land-Use Types on Plant and Microbial Diversity and Ecosystem Multifunctionality in Degraded Alpine Grasslands

1
Qinghai Provincial Key Laboratory of Restoration Ecology in Cold Regions, Northwest Institute of Plateau Biology, Chinese Academy of Sciences, Xining 810001, China
2
College of Resources and Environment, University of Chinese Academy of Sciences, Beijing 100049, China
3
College of Life Sciences, Qinghai Normal University, Xining 810008, China
4
State Key Laboratory of Plateau Ecology and Agriculture, Qinghai University, Xining 810016, China
*
Author to whom correspondence should be addressed.
Land 2023, 12(3), 638; https://doi.org/10.3390/land12030638
Submission received: 13 February 2023 / Revised: 6 March 2023 / Accepted: 6 March 2023 / Published: 8 March 2023
(This article belongs to the Special Issue Tillage Methods on Soil Properties and Crop Growth)

Abstract

Grassland resources occupy an important place in the national economy. However, grasslands in alpine regions of China are severely degraded, and the effects of land-use types on species composition, soil nutrients, and ecosystem multifunctionality of degraded alpine grasslands are less certain. To ascertain the effects of main land-use types (no-tillage reseeding and fertilization) on species diversity and ecosystem multifunctionality in alpine grasslands, we investigated the changes in these factors by subjecting specified areas. Using a standardized field survey, we measured the cover, richness, and evenness of plants. At each site, we measured microbial diversity and twelve soil variables critical for maintaining ecosystem multifunctionality in alpine grasslands. The results showed that: (1) the Margalef, Shannon–Wiener, and Simpson indices of plant community, and fungal diversity indices increased significantly in no-tillage reseeding and fertilization; (2) at the phyla level, the relative abundances of Basidiomycota, Olpidiomycota, and Proteobacteria increased significantly in no-tillage reseeding and fertilization, as well as, at the genus level, those of Coniochaeta, Solirubrobacter, Pseudonocardia, and Microvirga; (3) the soil physicochemical properties (except the C:N of soil) increased significantly in no-tillage reseeding and fertilization; (4) correlation analysis showed that species diversity was mainly correlated with soil nutrients in control check, while it was mainly correlated with soil physical properties in no-tillage reseeding and fertilization; (5) linear regression analysis showed significant positive relationships between Margalef, Shannon–Wiener, and Simpson indices of plant community and ecosystem multifunctionality. In addition, ecosystem multifunctionality was positively related to Pielou, Shannon–Wiener, and Simpson indices of the fungal community and it was positively related to Pielou and Shannon–Wiener indices of bacterial community. These observations indicated that no-tillage reseeding and fertilization of degraded alpine grasslands had the potential to improve ecosystem functions in many ways.

1. Introduction

The grasslands in China cover about 400 million ha or 40.7% of the national territory, a crucial ecological barrier for terrestrial ecosystems [1], which play a central role in maintaining national ecological security and income generation for farmers and herders. For instance, the most widely distributed and largest terrestrial ecosystem in Qinghai is that of alpine grassland, a pivotal and irreplaceable element in local ecological protection. However, climate change, overgrazing, soil erosion, rodent damage, and other phenomena have resulted in various degrees of degradation in alpine grasslands [2]. Such damages have been manifested by changes in soil characteristics, loss of biological diversity, and simplification of ecosystem structure that has significantly affected ecosystem functions, the survival of pastoralists, and development of the livestock industry. Therefore, these reasonable improvement measures in alpine grasslands are key to improving the ecological environment of grasslands and promoting the rational use of grasslands. Measures for managing degraded grasslands in China are mainly reseeding, fertilizing, fencing, and controlling rodent pests. Artificial application of organic fertilizer and no-tillage reseeding are simple measures that require little investment and have a quick impact. They have had obvious effects on increasing species composition and vegetation cover and improving the yield and quality of crops [3,4]. Some studies indicated that organic fertilization could significantly affect the nutrient element contents in soil and improve crop yield and nutrition value in alpine grasslands [5,6,7]. Ma et al. [8] conducted organic fertilizer in alpine pastures, which improved the rhizosphere nutrition conditions of crops as well as the content of soil organic matter, total phosphorus, total potassium, available phosphorus, and available potassium. Jin et al. [9] found that the presence of organic fertilizer enhanced soil physical and chemical properties, as well as improving beneficial bacterial and fungal abundance and diversity. Furthermore, Liu et al. [10] indicated that organic fertilizers could effectively improve crop yield, soil fertility, and the condition of nitrogen limitation in arid and semi-arid areas. No-tillage reseeding could prevent soil erosion and improve the function of grasslands as a carbon sink, shorten the natural recovery process, improve grassland productivity and biodiversity, and restore the multifunctionality and stability of the grassland ecosystem [11,12,13]. In China, no-tillage reseeding was first carried out in the 1980s [14] and then widely applied to grassland types such as arid and semi-arid grassland, temperate grassland, desert grassland, lowland meadow, and mountain meadow, etc. Research on no-tillage reseeding has mainly focused on studying the effects on grassland productivity, plant diversity, and vegetation community characteristics. For example, Duan et al. [15] selected five native grasses in alpine meadows on the Qinghai–Tibet Plateau for no-tillage reseeding, which improved community stability and production; Wu et al. [16] selected native species in the desert grassland of Ningxia for no-tillage reseeding, which increased the aboveground biomass of the grassland community and improved community stability; Sun et al. [17] used no-tillage reseeding of Leymus chinensis (Trin.) Tzvel. and Medicago falcata L. in Hulunbuir grassland to maintain the species diversity and richness of grassland ecosystem at a high level and increase the importance of Fabaceae and Poaceae in degraded grassland. In Qinghai, the main land-use types of degraded alpine grasslands are the artificial application of organic fertilizer based on no-tillage reseeding [18]. Duan et al. [19] also showed that the combination of no-tillage reseeding and organic fertilizer increased plant diversity and soil nutrient content more significantly than the experimental treatments alone. However, most of the studies only investigated the effect of no-tillage reseeding and organic fertilizer as separate experimental treatments but did not combine the two, and the relationships among plant, microorganisms, and ecosystem multifunctionality in degraded grasslands under no-tillage reseeding and fertilization are not clear. We hypothesized that no-tillage reseeding and fertilization had positive effects on plant diversity, microbial diversity, and ecosystem functions and species diversity indices were positively correlated with ecosystem multifunctionality in no-tillage reseeding and fertilization. Therefore, in this study, we selected the typical degraded alpine grasslands in Gangcha County, Qinghai Province, and conducted no-tillage reseeding and fertilization to investigate (a) the changes in plant communities, microbial communities, and ecosystem functions, and (b) the relationships between species diversity and ecosystem multifunctionality.

2. Materials and Methods

2.1. Study Site

The study area was located in Jiermeng Township, Gangcha County, Haibei Tibetan Autonomous Prefecture, Qinghai Province (99°28′53″ E, 37°18′27″ N, about 3400 m above sea level), at the junction of three counties in Haibei Gangcha County, Haixi Tianjun County, and Hainan Gonghe County. The climate type is plateau continental climate, with a long cold period, and short cool temperate period, no obvious four seasons, windy, and a big temperature difference between day and night. The annual average temperature is −0.6~5.7 °C, the annual average precipitation is 324.5–522.3 mm, the annual evaporation is 1500.6–1847.8 mm and the annual sunshine hours are 3 037 h, cold in winter, warm and cool in summer and autumn, and there is no absolute frost-free period. The natural grassland type is mainly alpine grassland. The soil type was subalpine grassland soil, with a thickness of 25–30 cm. The dominant species were Stipa purpurea Griseb, Carex alatauensis S. R. Zhang, Elymus breviaristatus (Keng) Keng f, Sibbaldianthe bifurca (L.) Kurtto and T. Erikss, and Knorringia sibirica (Laxm.) Tzvelev.

2.2. Experimental Design

Based on the classification criteria of degraded grasslands specified by Ma et al. [20], light to moderately degraded grassland with vegetation cover of 30–50%, slope less than 25°, thick soil layer, and obvious degradation characteristics were selected for the study. The field plots were set up for two treatments: no-tillage reseeding and fertilization and control check without any addition. Each treatment had three replicates (5 ha each), and a total of six plots. No-tillage reseeding methods were as follows: (1) no-tillage seeder and high-horsepower power machine were used for operation in late April 2021; (2) the seeding method was cross-seeding and the operation was carried out twice; (3) the seeds were selected from a mixture of Elymus breviaristatus (Keng) Keng f. and Poa araratica Trautv. in a ratio of 3:1, which were native grasses in Qinghai Province; (4) the total seeding amount was 60 kg·ha−1 and the seeding depth was 0.5–2 cm. Fertilizer type was organic fertilizer (organic matter ≥ 45%, total nutrients (N + P2O5 + K2O) ≥ 5%, water ≤ 30%): 922.5 kg·ha−1 [18].

2.3. Sampling and Computing Method

2.3.1. Plant Diversity

In August 2021, four plant quadrats of 0.5 m × 0.5 m were randomly placed in each treatment for a survey, and the name, coverage, abundance, and height of plant species in the quadrats were recorded. Each index was investigated as follows: coverage was obtained by visual estimation to obtain total community coverage and species coverage; abundance was obtained by investigating the number of plants; natural height was measured by randomly selecting five plants of the same species (if there were less than 5 plants, all of them were measured); plant diversity was expressed using Margalef (H), Shannon–Wiener (H’), Simpson (D), and Pielou evenness (P) [21]:
H = S 1 ln N
H = i = 1 S P i ln P i
D = 1 i = 1 S P i 2
P = H ln S
where S is the number of species, N is the total number of plant individuals in the quadrat, and Pi is the importance value of species i. The importance value of species = (relative coverage + relative height + relative abundance)/3.

2.3.2. Microbial Diversity

After mowing all plants in the quadrats, we used a soil auger (3 cm inner diameter) to collect 0–10 cm of soil by taking three drills along the diagonal. Three replicates were collected from each quadrat, mixed to form a composite soil sample, and stored at −80 °C for DNA extraction. DNA was extracted using a DNA kit (Omega Bio-Tek, Norcross, GA, USA) following the manufacturer’s instructions. The DNA was determined on the platform of Shanghai Paisano Biological Co. for high throughput sequencing, and the DNA concentration and quality were detected using 0.8% agarose gel electrophoresis. For the bacterial community, 338F/806R primer sets (338F: ACTCCTACGGGAGGCAGCA; 806R: GGACTACHVGGGTWTCTAAT) were used to amplify (triplicate reactions for each sample) the 16S V3–V4 region. For the fungal community, the ITS5f/ITS2 primer pair (ITS5F: GGAAGTAAAAGTCGTAACAAGG; ITS2R: GCTGCGTTCTTCATCGATGC) was selected to amplify the ITS_V1 region of the rRNA gene. The amplification conditions were pre-denaturation at 95 °C for 5 min, denaturation at 95 °C for 15 s, and annealing at 60 °C for 30 s, for a total of 40 cycles [22]. The 16S rRNA amplicons and ITS amplicons were pooled separately and then sequenced with the Illumina MiSeq instrument. The sequence data were filtered, chimera checked and operational taxonomic unit (OTU) clustered, and taxonomy assignment was performed by QIIME (v1.9.0) pipeline. The sequence information of each treatment was categorized according to barcodes and clustered into OTUs for species classification, and the OTU similarity was set to 97%. Taxonomy was identified for each OTU using the Ribosomal Database Project Classifier trained on the Greengenes and UNiversal Intracellular Targeted Expression databases for bacterial and fungal sequences [23].

2.3.3. Selection of Ecosystem Functions

In recent studies on ecosystem multifunctionality, the selection of evaluation indicators mostly refers to Maestre et al. [24]. Since soil–vegetation was an interdependent and reciprocal feedback complex, and soil was the nutrient and seed bank of the ecosystem, soil indicators can largely reflect multiple functions of the ecosystem. The indicators related to soil fertility maintenance are OC, TN, TP, AN, AP, AMN, and NN; indicators related to water conservation are SWC and CP. The indicators related to nutrient transformation and cycling are pH, C:N, and BP [25]. These indicators are simple and easy to measure in production practices and relate to various aspects of soil water, fertilizer, gas, heat, and multiple ecosystem functions [26].

2.3.4. Measurement of Ecosystem Functions

We used a soil auger (5 cm inner diameter) to collect 0–10 cm of soil by taking three drills along the diagonal. Three replicates were collected from each quadrat, mixed to form a composite soil sample, stones and plant roots were removed, and then returned to the laboratory for determination of the soil’s physicochemical properties. Soil organic carbon (g·kg−1, OC), total nitrogen (g·kg−1, TN), total phosphorus (g·kg−1, TP), available nitrogen (mg·kg−1, AN), available phosphorus (mg·kg−1, AP), ammonia nitrogen (mg·kg−1, AMN), nitric nitrogen (mg·kg−1, NN), soil water content (%, SWC), capillary porosity (%, CP), pH, C:N, and bulk porosity (%, BP) were measured using standard methods [27].

2.3.5. Assessing Ecosystem Multifunctionality

Before calculating the ecosystem multifunctionality, we standardized the ecosystem functions to be between 0 and 1 with min–max normalization and then used the average method to calculate the ecosystem multifunctionality [28,29]. The calculation formula is as follows:
F ( x i ) = x i m i n m a x m i n
where xi represents the original value of ecosystem function i, max is the maximum value of ecosystem function i, and min is the minimum value of ecosystem function i.
E M F = i = 1 n F ( x i ) n
where F(xi) represents the standardized value of ecosystem function i, n is the number of ecosystem functions.

2.3.6. Statistical Analysis

The Kolmogorov–Smirnov test and Shapiro–Wilk test were used to test whether the data conformed to the normal distribution, and for the data that obeyed the normal distribution, the independent samples T test was used to compare the differences between treatments, and for the data that did not obey the normal distribution, the nonparametric Mann–Whitney test was used, with the significance level set at p < 0.05. Correlation analysis was performed between plant and microbial diversity and ecosystem functions. We also analyzed the relationship between species diversity and ecosystem multifunctionality using linear regression. All analyses were performed in the software SPSS 25.0. The visualization of the data was performed using Origin 2021.

3. Results

3.1. Effects of Main Land-Use Types on Plant Diversity, Microbial Diversity, and Soil Microbial Community Structure

Plant diversity, microbial diversity, and soil microbial community structure varied widely between treatments. Compared with control check, the Margalef, Shannon–Wiener, and Simpson indices of plant community increased significantly in no-tillage reseeding and fertilization (p < 0.05). However, there were no significant differences in the Pielou index of plant community between treatments (p > 0.05, Table 1). The results showed that the coverage of soil microbial community ranged from 99.06 to 99.98%, indicating that the sequencing results represent the true picture of the microorganisms in samples. The fungal diversity indices in no-tillage reseeding and fertilization were significantly higher than those in control check (p < 0.05), but the changes in bacterial diversity indices in different treatments were not significant (p > 0.05, Table 2). In no-tillage reseeding and fertilization, the Margalef index of plant community showed a positive correlation with the Shannon–Wiener index of the bacterial community (p < 0.05). In the control check, the Margalef, Shannon-Wiener, and Simpson indices of the plant community were positively correlated with the Pielou, Shannon–Wiener, and Simpson indices of the microbial community (p < 0.05) (Table 3).
Most of fungal sequences belonged to the phyla Ascomycota, Basidiomycota, and Mortierellomycota. At the fungal phyla level, the relative abundance of Ascomycota decreased significantly in no-tillage reseeding and fertilization (p < 0.05). In addition, the abundance of Kickxellomycota and Zoopagomycota presented in CK and did not present in no-tillage reseeding and fertilization (Figure 1A). At the genus level, the dominant fungi included Archaeorhizomyces, Mortierella, Acremonium, Didymella, and Pseudogymnoascus. An abundance of Gibberella, Alternaria, Coniochaeta, Ilyonectria, Cephalotrichum, Didymella, and Tricharina presented in the control check, whereas Dermoloma presented in no-tillage reseeding and fertilization (Figure 1B). Moreover, the relative abundance of Coniochaeta increased significantly in no-tillage reseeding and fertilization (p < 0.05). Most of bacterial sequences belonged to the phyla Actinobacteria, Proteobacteria, and Acidobacteria. The relative abundance of Proteobacteria increased significantly in no-tillage reseeding and fertilization (p < 0.05). Moreover, the relative abundance of Chloroflexi increased significantly in control check (Figure 1C). At the genus level, the dominant bacteria differed significantly in treatments. For example, the relative abundance of Solirubrobacter, Pseudonocardia, and Microvirga increased significantly, whereas KD4-96 decreased significantly in no-tillage reseeding and fertilization (p < 0.05) (Figure 1D).

3.2. Effects of Main Land-Use Types on Ecosystem Functions and Multifunctionality

Twelve ecosystem functions were examined in this study. The no-tillage reseeding and fertilization had significant positive effects on ecosystem functions related to soil fertility maintenance, i.e., OC, TN, TP, AN, AP, AMN, and NN. In no-tillage reseeding and fertilization, the indices of soil fertility maintenance increased by 82.25%, 73.79%, 66.01%, 65.15%, 39.21%, 28.96%, and 22.58%, respectively (p < 0.05) (Figure 2A,B,D–H). Compared with the control check, the indices of water conservation increased in no-tillage reseeding and fertilization, i.e., CP and SWC increased by 22.70% and 15.44%, respectively (p < 0.05) (Figure 2J,L). The pH and BP related to nutrient transformation and cycling decreased by 6.67% and increased by 11.03%, respectively (p < 0.05) (Figure 2I,K). In addition, the differences between treatments in the three main functions of soil fertility maintenance, water conservation, and nutrient transformation and cycling were not significant. Meanwhile, ecosystem multifunctionality showed a nonsignificant response in no-tillage reseeding and fertilization (p > 0.05) (Figure 3A–D).

3.3. Correlation Analysis of Plant and Microbial Diversity and Ecosystem Functions

We also analyzed the relationships between plant and microbial diversity indices and ecosystem functions. The Pearson correlation heatmap showed significant positive relationships between plant and microbial diversity indices and organic carbon, ammonia nitrogen, and nitric nitrogen in control check (Figure 4A,C). The Simpson and Pielou indices of the bacterial community were positively related to pH, and the Chao1 index of the bacterial community was positively related to CP in the control check (Figure 4C). In addition, Shannon–Wiener, Margalef, and Pielou indices of plant community were positively related to CP and SWC in no-tillage reseeding and fertilization. The Shannon–Wiener and Margalef indices of plant community were negatively related to pH in no-tillage reseeding and fertilization (Figure 4B). The microbial diversity indices were positively related to OC in no-tillage reseeding and fertilization. Meanwhile, Shannon–Wiener and Simpson indices of the bacterial community were negatively related to BP in no-tillage reseeding and fertilization (Figure 4D).

3.4. Relationship of Plant and Microbial Diversity with Ecosystem Multifunctionality

Possible relationships between plant diversity, microbial diversity, and ecosystem multifunctionality were further uncovered based on linear regression analysis (Figure 5 and Figure 6). The linear regression analysis showed significant positive relationships between Margalef, Shannon–Wiener, and Simpson indices of plant community and ecosystem multifunctionality (p < 0.05) (Figure 5A,C,D). Overall, ecosystem multifunctionality varied with plant diversity. When evaluating the relationship between microbial diversity and ecosystem multifunctionality, we observed ecosystem multifunctionality was positively related to Pielou, Shannon–Wiener, and Simpson indices of the fungal community (p < 0.05) (Figure 6B–D). In addition, ecosystem multifunctionality was positively related to Pielou and Shannon–Wiener indices of bacterial community (p < 0.05). The Chao1 and Simpson indices of the bacterial community had significant positive relationships with ecosystem multifunctionality in CK (p < 0.05).

4. Discussion

4.1. Response of Plant Diversity, Microbial Diversity to No-Tillage Reseeding and Fertilization

How plant and microbial community diversity changes during no-tillage reseeding and fertilization is critical to maintaining sustainable ecosystem development. Our results showed that plant diversity increased significantly in no-tillage reseeding and fertilization. Consistent with other studies [30,31], the increase in Margalef index was mainly because no-tillage reseeding added new grass species, broke the ecological niche of original species, and changed the spatial pattern of plant community, increasing the number of species and making the community composition relatively complex. The Shannon–Wiener and Simpson indices of the plant community increased in no-tillage reseeding and fertilization, which could be explained by the reseeded plants. In detail, the reseeded plants were more adaptable and grew well because they were native grasses in Qinghai Province [32]. In addition, Chen et al. [33] showed that fertilizer application can increase the soil nutrient content in grassland, thus promoting the rhizosphere environment and improving the survival rate and diversity of crops [34].
Microbes are the main decomposers of organic matter and play an important role in the ecosystem nutrient cycle. Previous studies have reported that bacteria are the main component of the soil microbial community in artificial grassland [35,36], which was consistent with our results. The fungal diversity indices were higher in no-tillage reseeding and fertilization than in the control check. This could be because soil microbial community structure was affected by restoration of alpine grasslands, and the fungal community was more sensitive to grassland succession than the bacterial community [37]. Moreover, plant diversity had significant positive correlations with most of the microbial diversity indices in our study. The growth of plants might promote the accumulation of litter and sufficient nutrients in the soil, which provides more nutrient resources to soil microbes [38,39].

4.2. Response of Soil Microbial Community Composition to No-Tillage Reseeding and Fertilization

Fungal communities were overwhelmingly dominated by Ascomycota and Basidiomycota. Ascomycota and Basidiomycota were the predominant fungal phylum, playing an important role in the lignin decomposition process and nutrient cycles [40]. The finding was consistent with Rong et al. [41]. The relative abundance of Ascomycota increased in the control check. This observation could be explained by the Ascomycota’s physiological ability to break down the biochemical structure of plant litter in the degraded alpine steppes [42]. Moreover, Kickxellomycota and Zoopagomycota only existed in control check, which might be due to the soil available nutrients and water content changed in no-tillage reseeding and fertilization, resulting in a change in the soil pH; changes in these soil indices might reduce the importance of certain fungal community in the nutrient uptake process of the plant, resulting in plant response to fungal changes in community composition [43,44]. The change in Proteobacteria may be because the bacteria involved in the nitrogen cycle were increased categories would vary depending on the habitat, and their relative abundance might also have a relationship with the surrounding environmental conditions [45]. However, the denitrification dominated by Chloroflexi likely caused the loss of nitrogen nutrients in the soil and accelerated grassland degradation; therefore, Chloroflexi was more abundant in degraded grassland [46]. Meanwhile, the relative abundance of Solirubrobacter, Pseudonocardia, Microvirga, and KD4-96 in Actinobacteria varied greatly between different treatments. These dominant bacteria are Gram-positive bacteria that have good adaptability to soil properties and vegetation changes in no-tillage reseeding and fertilization.

4.3. No-Tillage Reseeding and Fertilization Impacts on Ecosystem Functions and Multifunctionality

Soil, as the basis for a plant’s survival, affects the composition of the plant community and the structure and function of the ecosystem [47]. Our study showed that the application of organic fertilizer was beneficial to increasing the OC content and promoting plant growth, which was consistent with the results of other studies [19,48]. Meanwhile, the dense vegetation growth and high plant diversity developed in the alpine grassland after no-tillage reseeding could reduce the rate of soil erosion caused by wind and water while increasing the sequestration of carbon [49]. Wang et al. [50] found that fertilization increased the content of plant roots and root exudates and increased the TN content in soil, which is consistent with our findings. The study areas of control check were degraded, and the above-ground vegetation coverage and biomass were decreased, resulting in the protective effect on soil particles also diminishing. Consequently, the impact of wind erosion gradually rose, which led to a reduction in the TP content [51]. Our results indicated moderate jamming facilitated the compensatory growth of plants, which accelerated the mineralization rate of carbon, nitrogen, and phosphorus in the soil, thus increasing AP and AN. This implication agrees with the conclusions made by Shao et al. [52]. The indices for the SWC and CP were increased in no-tillage reseeding and fertilization, which were consistent with the data obtained by Ji et al. [53] because no-tillage reseeding disturbed the surface of the soil, resulting in reduced soil compactness and enhanced capillary porosity. Huo et al. [54] found, in the study of alkali–saline in Jingyuan County, Gansu Province, that adding organic fertilizer could significantly improve soil physical properties, reduced soil bulk density, and increased soil total porosity. At the same time, plant diversity rose after reseeding, reducing the area of exposed soil as well as causing the loss of surface soil water from evaporation. Moreover, pH and BP, which are related to nutrient transformation and cycling, differed between treatments. Notably, pH decreased during no-tillage reseeding, which is consistent with the results recorded by Li et al. [55] regarding the influence of global conservation tillage on pH. Hong et al. [56] also found that the soil pH treated with organic fertilizer showed a downward trend. BP in no-tillage reseeding and fertilization areas was higher, which was beneficial to the growth of plant roots. This study’s findings showed there were no differences in soil fertility, water content, nutrient conversion, and ecosystem multifunctionality. The calculation method used here may weaken the effect of no-tillage reseeding and fertilization on soil single functions, resulting in nonsignificant changes to the ecosystem [57].

4.4. The Roles of Plant and Microbial Diversity in Mediating Ecosystem Functions and Multifunctionality

Some surveys have posited that ecosystem functions expand with increasing species diversity [58]. From our study, it was concluded the ecosystem functions of soil water, fertilizer, gas, and heat had different correlations with species diversity depending on treatment. There was a strong correlation between plant diversity in the control check and functional indices related to soil fertility, but not with those related to either water conservation or nutrient transformation and cycling. This might be because plant communities with higher species diversity tend to also have higher productivity and increase the input of rhizosphere microbial carbon sources [59]. By contrast, plant diversity in no-tillage reseeding and fertilization areas was positively correlated with pH, CP, and SWC. This meant plant diversity in degraded alpine grasslands was easily restricted by soil water and nutrient functional indices, resulting in limited plant growth and development, species settlement, and colonization [24,60]. Published work has observed that not only is microbial diversity related to community productivity and stability, but also to soil functions [61,62]. Our analysis led to the conclusion that microbial diversity is closely interrelated with the physical and chemical properties of soil, which was consistent with conclusions made in other studies [63,64,65]. Experimental data showed soil functions played a role in affecting the microbial community related to soil fertility, which agrees with the work of Luo et al. [66], who reported microbial participation in multiple ecosystem functions when influenced by global changes.
Except for the direct effect on ecosystem functions, no-tillage reseeding and fertilization also mediate ecosystem multifunctionality by affecting plant and microbial diversity. In this study, the plant diversity indices were positively correlated with ecosystem multifunctionality in no-tillage reseeding and fertilization. It was necessary to pay attention to plant diversity because the positive correlation between this property and multifunctionality was also confirmed in temperate grassland, microbial, and aquatic communities [67]. Ecosystem multifunctionality of the alpine grassland ecosystem was predominantly affected by the abundance and uniformity of the plant community after reseeding and fertilization. This might have been caused by the community with more species possessing different ecological niches when using limited resources, and the uniform distribution of species could make the complementary use of resources more reasonable, thus enhancing ecosystem multifunctionality [61]. However, when microbial diversity indices were considered, the Shannon–Wiener and Pielou indices of the microbial community were positively correlated with ecosystem multifunctionality, which was consistent with other studies [28,68]. This could be attributed to the fact that richer microbial diversity promoted the decomposition rate of waste material, increased soil organic matter content and microbial activity, and accelerated organic decomposition and nutrient accumulation [69]. The Pielou index is often neglected, but in our study, the Pielou index was considered to be critical for maintaining ecosystem multifunctionality, and microbes contributed to the improvement of soil physicochemical properties through the rational use of spatial distribution patterns and changing the distribution of resources. Meanwhile, the Simpson index of fungal community and Chao1 index of bacterial community were both positively correlated with ecosystem multifunctionality in the control treatment. This relationship implies the number of dominant species in the fungal and bacterial communities in alpine degraded grasslands is a key limiting factor affecting ecosystem functions and stability.

5. Conclusions

No-tillage reseeding and fertilization significantly improved the diversity of plant species and fungal communities, as well as the ecosystem functions of degraded alpine grasslands. These effects indicate a positive contribution to the soil environment and grassland plant community of such regions, which can arise from a reasonable improvement from reseeding and fertilizer. Although environmental factors did not directly affect ecosystem multifunctionality, they could do so indirectly by influencing species diversity indices. In the field of ecosystem management, the results of this study can provide a reference for biodiversity conservation and measures to improve ecosystem multifunctionality by regulating biodiversity in degraded alpine grasslands in Qinghai province.

Author Contributions

The conception of the study, H.Z.; investigation, Z.Z., R.Q., H.L. and T.C.; data analysis, H.S., L.M., H.A., Z.S. and Y.S.; visualization, H.S., J.W., X.H. and C.Z.; manuscript preparation, H.S.; funding acquisition, H.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This study was funded by the Qinghai Natural Science Fund Innovation Team Project (2021-ZJ-902), the National Natural Science Foundation of China Joint Fund Project (U21A20186 and U20A2006), the Second Tibetan Plateau Scientific Expedition and Research Program (2019QZKK0302), and the Joint Research Project of Three–River–Resource National Park funded by Chinese Academy of Sciences and Qinghai Provincial People’s Government (LHZX-2020-08).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Acknowledgments

We sincerely thank Xiaojun Zhao from Grassland Workstation in Haibei Prefecture, Qinghai Province for his guidance and help on sampling, and thanks also go to Tongqing Guo for his help in formatting the essay during writing.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Zhang, Y.; Zhou, J.; Yang, G.; Jing, J.; Liu, N. Theory and application of no-tillage reseeding in degraded grasslands. Chin. Sci. Bull. 2020, 65, 1546–1555. [Google Scholar] [CrossRef] [Scilit]
  2. Du, J.; Wang, G.; Li, Y. Rate and causes of degradation of alpine grassland in the source regions of the Yangtze and Yellow Rivers during the last 45 years. Acta Pratac. Sin. 2015, 24, 5–15. [Google Scholar]
  3. Wu, G.; Liu, Z.; Zhang, L.; Hu, T.; Chen, J. Effects of artificial grassland establishment on soil nutrients and carbon properties in a black-soil-type degraded grassland. Plant Soil 2010, 333, 469–479. [Google Scholar] [CrossRef] [Scilit]
  4. Chen, Z.; Tian, F.; Wu, G.; Niu, J. Effects of Overseeding Grass on Aboveground Biomass of Different Economic Group in Maqu Alpine Desertified Meadow Pasture. Chin. J. Grass 2011, 4, 58–62. [Google Scholar]
  5. Wang, L.; Shi, J.; Shi, H.; Ou, W.; Wang, C.; Xing, Y. Effects of nitrogen and phosphorus addition on forage and soil nutrients in alpine grasslands around Qinghai Lake. Pratac. Sci. 2019, 12, 3065–3075. [Google Scholar]
  6. Liu, W.; Zhang, Y.; Shi, S.; Sun, J.; Wei, X. Effect of variety, fertilization and mixture sowing on oat biomass allocation in the alpine cultivated pasture. J. Plant Nutr. Fertil. 2017, 2, 398–407. [Google Scholar]
  7. Dang, Y. Effect of organic fertilizer on biomass and species diversity in Alpine meadow. Chin. Qinghai J. Anim. Vet. Sci. 2015, 6, 4–6. [Google Scholar]
  8. Ma, X.; Jia, Z.; Zhang, Y.; Zhang, R. Effects of Bio-organic Fertilizers on Oat Production and Soil Fertility in Alpine Region of Qinghai-Tibet Plateau. Acta Agrestia Sin. 2019, 6, 1759–1765. [Google Scholar]
  9. Jin, L.; Jin, N.; Wang, S.; Li, J.; Meng, X.; Xie, Y.; Wu, Y.; Luo, S.; Lyu, J.; Yu, J. Changes in the Microbial Structure of the Root Soil and the Yield of Chinese Baby Cabbage by Chemical Fertilizer Reduction with Bio-Organic Fertilizer Application. Microbiol. Spectr. 2022, 6, e0121522. [Google Scholar] [CrossRef] [Scilit]
  10. Liu, Q.; Xu, H.; Yi, H. Impact of Fertilizer on Crop Yield and C:N:P Stoichiometry in Arid and Semi-Arid Soi. Int. J. Environ. Res. Public Health 2021, 8, 4341. [Google Scholar] [CrossRef] [Scilit]
  11. Zhang, Y.; Yang, G.; Liu, N.; Chang, S.; Wang, X. Review of grassland management practices for carbon sequestration. Acta Pratac Sin. 2013, 22, 290–299. [Google Scholar]
  12. Song, C.; Wang, N.; Peng, W.; Ji, Q. Research progress on effects of reseeding on grassland vegetation. Anim. Husb. Feed Sci. 2005, 6, 32–34. [Google Scholar]
  13. Adil, M.; Zhang, S.; Wang, J.; Shah, A.N.; Tanveer, M.; Fiaz, S. Effects of fallow management practices on soil water, crop yield and water use efficiency in winter wheat monoculture system: A Meta-Analysis. Front. Plant Sci. 2022, 13, 825309. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Han, Y.; Xu, X.; Liu, D. A trial of shallow reseeding pasture in arid grassland. J. Inner. Mong. Inst. Agric. Anim. Husb. 1981, 1, 53–58. [Google Scholar]
  15. Duan, L.; Liu, X.; Han, B.; Wei, X.; Cai, R.; Shao, X. Effects of Native Species Reseeding on the Community Stability of Alpine Meadow in the Tibet Plateau. Acta Agrestia Sin. 2021, 29, 1793–1800. [Google Scholar]
  16. Wu, W.; Ma, H.; Lu, Q.; Zhou, Y.; Su, T.; Zhu, L. Effects of supplementary sowing on plant community and soil physical and chemical properties in Ningxia desert steppe. Pratac. Sci. 2020, 37, 1959–1969. [Google Scholar]
  17. Sun, W.; Liu, Y.; Wang, D.; Zhao, M.; Yang, H.; Song, Q.; Xiao, H.; Wang, K.; Cao, J.; Rong, Y. Effects of Reseeding Leymus chinensis (Trin.) Tzvel. and Medicago falcata L. on Plant Community Characteristics of Degraded Meadow Steppe. Acta Agrestia Sin. 2021, 29, 1809–1817. [Google Scholar]
  18. Shi, J. No-tillage reseeding technology protocol for degraded alpine grasslands. Qinghai Voc. Tech. Inst. Anim. Husb. Vet. DB63/T 1442-2015, 2015-12-21.
  19. Duan, C.; Li, X.; Chai, Y.; Xu, W.; Su, L.; Ma, P.; Yang, X. Effects of different rehabilitation measures on plant community and soil nutrient of degraded alpine meadow in the Yellow River Source. Acta Ecol. Sin. 2022, 18, 7652–76662. [Google Scholar]
  20. Ma, Y.; Lang, B.; Li, Q.; Shi, J.; Dong, Q. Study on rehabilitating and rebuilding technologies for degenerated alpine meadow in the Changjiang and Yellow River source region. Pratac. Sci. 2002, 19, 1–5. [Google Scholar]
  21. Kindt, R.; Coe, R. Tree Diversity Analysis. A Manual and Software for Common Statistical Methods for Ecological and Biodiversity Studies; World Agroforestry Centre: Nairobi, Kenya, 2005; pp. 55–71. [Google Scholar]
  22. Walker, N.J. Real-time and quantitative PCR: Applications to mechanism-based toxicology. J. Biochem. Mol. Toxicol. 2001, 15, 121–127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Wang, Q.; Garrity, G.M.; Tiedje, J.M.; Cole, J.R. Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Appl. Environ. Microbiol. 2007, 73, 5261–5267. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Maestre, F.T.; Quero, J.L.; Gotelli, N.J.; Escudero, A.; Ochoa, V.; Delgado-Baquerizo, M.; Garcia-Gomez, M.; Bowker, M.A.; Soliveres, S.; Escolar, C.; et al. Plant species richness and ecosystem multifunctionality in global drylands. Science 2012, 335, 214–218. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Yang, Z.; Wen, C.; Yang, L.; Li, Z.; Wei, W.; Zhang, Q. Effects of different restoration methods on ecosystem multifunctionality in the semi-arid loess small watershed. Acta Ecol. Sin 2020, 40, 8606–8617. [Google Scholar]
  26. Pei, S.; Fu, H.; Wan, C. Changes in soil properties and vegetation following exclosure and grazing in degraded Alxa desert steppe of Inner Mongolia, China. Agric. Ecosyst. Environ. 2008, 124, 33–39. [Google Scholar] [CrossRef] [Scilit]
  27. Cha, T. Soil Physical and Chemical Analysis; China Forestry Publishing House: Beijing, China, 2017; pp. 23–146. [Google Scholar]
  28. Gamfeldt, L.; Roger, F. Revisiting the biodiversity-ecosystem multifunctionality relationship. Nat. Ecol. Evol. 2017, 1, 168. [Google Scholar] [CrossRef] [Scilit]
  29. Byrnes, J.E.K.; Gamfeldt, L.; Isbell, F.; Lefcheck, J.S.; Griffin, J.N.; Hector, A.; Cardinale, B.J.; Hooper, D.U.; Dee, L.E.; Emmett Duffy, J.; et al. Investigating the relationship between biodiversity and ecosystem multifunctionality: Challenges and solutions. Methods Ecol. Evol. 2014, 5, 111–124. [Google Scholar] [CrossRef] [Scilit]
  30. Tilman, D. Niche tradeoffs, neutrality, and community structure: A stochastic theory of resource competition, invasion, and community assembly. Proc. Natl. Acad. Sci. USA 2004, 101, 10854–10861. [Google Scholar] [CrossRef] [Scilit]
  31. Zhang, H.; Zhou, X.; Lu, G.; Fan, Y.; Zhou, H.; Dou, S.; Yan, H.; Ma, K.; Zhao, Y. Effect of Organic Fertilizer and Reseeding on Vegetation and Soil in Degraded Artificial Grassland. Chin. J. Grass 2023, 45, 67–75. [Google Scholar]
  32. Sun, L.; Gesang, L.; Wang, X.; Wei, X. Study on the Effect of No-tillage Reseeding in Alpine Degraded Grassland of Amdo County in Northern Tibet. J. Plateau Agric. 2018, 2, 162–167. [Google Scholar]
  33. Chen, W.; Zhao, M.; Li, G.; Wei, Q.; Wang, F.; Liu, Z.; Zhu, L.; Zhang, J.; Sun, F. The Influence of Different Types of Fertilizer Application Level on the Gannan Desertification of Alpine Meadow of Plant Characteristics and the Productive Forces. J. Nat. Resour. 2012, 2, 254–267. [Google Scholar]
  34. Gaurav, B.; Ulf, M.; Annika, K.; Juha, M. Impacts of seven years of experimental warming and nutrient addition on neighbourhood species interactions and community structure in two contrasting alpine plant communities. Eco. Complex. 2018, 33, 31–40. [Google Scholar]
  35. Liao, H.; Zhang, Y.; Zuo, Q.; Du, B.; Chen, W.; Wei, D.; Huang, Q. Contrasting responses of bacterial and fungal community to aggregate-size fractions and long-term fertilizations in soils of northeastern China. Sci. Total Environ. 2018, 635, 784–792. [Google Scholar] [CrossRef] [Scilit]
  36. Rousk, J.; Baath, E.; Brookes, P.C.; Lauber, C.L.; Lozupone, C.; Caporaso, J.G.; Knight, R.; Fierer, N. Soil bacterial and fungal community across a pH gradient in an arable soil. ISME J. 2010, 4, 1340–1351. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Wang, D.; Zhou, H.; Zuo, J.; Chen, P.; She, Y.; Yao, B.; Dong, S.; Wu, J.; Li, F.; Njoroge, D.M.; et al. Responses of Soil Microbial Metabolic Activity and Community Structure to Different Degraded and Restored Grassland Gradients of the Tibetan plateau. Front. Plant Sci. 2022, 13, 770315. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Kuzyakov, Y. Priming effects: Interactions between living and dead organic matter. Soil Biol. Biochem. 2010, 42, 1363–1371. [Google Scholar] [CrossRef] [Scilit]
  39. Prober, S.M.; Leff, J.W.; Bates, S.T.; Borer, E.T.; Firn, J.; Harpole, W.S.; Lind, E.M.; Seabloom, E.W.; Adler, P.B.; Bakker, J.D.; et al. Plant diversity predicts beta but not alpha diversity of soil microbes across grasslands worldwide. Ecol. Lett. 2015, 18, 85–95. [Google Scholar] [CrossRef] [Scilit]
  40. Van der Wal, A.; Van Veen, J.A.; Smant, W.; Boschker, H.T.S.; Bloem, J.; Kardol, P.; Van der putten, W.H.; De Boer, W. Fungal biomass development in a chronosequence of land abandonment. Soil Biol. Biochem 2006, 38, 51–60. [Google Scholar] [CrossRef] [Scilit]
  41. Rong, X.; He, M.; Wang, C.; Li, Y.; Dai, Z.; Liang, Z.; Wan, L.; Gao, Z.; Jiang, K.; Wu, B.; et al. Analysis on the Diversity of Soil Bacterial and Fungal Community in the Degraded Alpine Grassland in Northern Tibet Plateau. Ecol. Environ. Sci. 2018, 27, 1646–1651. [Google Scholar]
  42. Hartmann, M.; Brunner, I.; Hagedorn, F.; Bardgett, R.D.; Stierli, B.; Herzog, C. A decade of irrigation transforms the soil microbiome of a semi-arid pine forest. Mol. Ecol. 2017, 26, 1190–1206. [Google Scholar] [CrossRef] [Scilit]
  43. Lu, X.; Mao, Q.; Gilliam, F.S.; Luo, Y.; Mo, J. Nitrogen deposition contributes to soil acidification in tropical ecosystems. Glob. Chang. Biol. 2014, 20, 3790–3801. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Leff, J.W.; Jones, S.E.; Prober, S.M.; Barberan, A.; Borer, E.T.; Firn, J.L.; Harpole, W.S.; Hobbie, S.E.; Hofmockel, K.S.; Knops, J.M.; et al. Consistent responses of soil microbial community to elevated nutrient inputs in grasslands across the globe. Proc. Natl. Acad. Sci. USA 2015, 112, 10967–10972. [Google Scholar] [CrossRef] [Scilit]
  45. Mukhopadhya, I.; Hansen, R.; El-Omar, E.M.; Hold, G.L. IBD-what role do Proteobacteria play? Nat. Rev. Gastroenterol. Hepatol. 2012, 9, 219–230. [Google Scholar] [CrossRef] [Scilit]
  46. Qiu, L.; Zhang, Q.; Zhu, H.; Reich, p.B.; Banerjee, S.; van der Heijden, M.G.A.; Sadowsky, M.J.; Ishii, S.; Jia, X.; Shao, M.; et al. Erosion reduces soil microbial diversity, network complexity, and multifunctionality. ISME J. 2021, 15, 2474–2489. [Google Scholar] [CrossRef] [Scilit]
  47. Wang, Y.; Han, X.; Jin, Z.; Zhang, C.; Fang, L. Soil Organic Carbon Stocks in Deep Soils at a Watershed Scale on the Chinese Loess plateau. Soil Sci. Soc. Am. J. 2016, 80, 157–167. [Google Scholar] [CrossRef] [Scilit]
  48. Qi, R.; Zhao, B.; Li, J.; Lin, Z.; Li, Y.; Yang, X.; Li, Z. Effects of cattle manure addition on soil organic carbon mineralization and priming effects under long-term fertilization regimes. Trans. Chin. Soc. Agric. Eng. 2016, 32 (Suppl. 2), 118–127. [Google Scholar]
  49. Chen, L.; He, Z.; Zhu, X.; Du, J.; Yang, J.; Li, J. Impacts of afforestation on plant diversity, soil properties, and soil organic carbon storage in a semi-arid grassland of northwestern China. Catena 2016, 147, 300–307. [Google Scholar] [CrossRef] [Scilit]
  50. Wang, D.; Yang, J.; Liao, R.; Yuan, H.; Zhou, H.; Lü, D.; Qin, H.; Li, L. Effects of chemical fertilizers combined with organic fertilizers on root exudates of rape during vegetative growth period. Soil Fertil. Sci. China 2021, 5, 95–102. [Google Scholar]
  51. Wang, X.; Dong, S.; Yang, B.; Li, Y.; Su, X. The effects of grassland degradation on plant diversity, primary productivity, and soil fertility in the alpine region of Asia’s headwaters. Environ. Monit. Assess. 2014, 186, 6903–6917. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. Shao, X.; Shi, Y.; Han, J.; Wang, Z.; Wang, K. Dynamics of Soil Physicochemical Properties during the Natural Restoration and Succession of Typical Steppe in Inner Mongolia Autonomous Region. Acta Agrestia Sin. 2008, 16, 566–571. [Google Scholar]
  53. Ji, W.; Wang, Q. Effects of over-seeding on plant community and soil physical and chemical properties of degraded grassland in Tianzhu County. Pratac. Sci. 2016, 33, 886–890. [Google Scholar]
  54. Huo, L.; Wang, C.; Pang, H.; Yang, S.; Li, Y.; Jiang, W. Effects of combined application of organic and inorganic fertilizers on physical and chemical properties and crop yields in alkali-saline soil. Agric. Res. Arid Areas 2015, 4, 105–111. [Google Scholar]
  55. Li, Y.; Li, Z.; Cui, S.; Jagadamma, S.; Zhang, Q. Residue retention and minimum tillage improve physical environment of the soil in croplands: A global meta-analysis. Soil Tillage Res. 2019, 194, 104292. [Google Scholar] [CrossRef] [Scilit]
  56. Hong, Y.; Wang, F.; Liu, R.; Li, Y.; Zhao, T.; Chen, C. Effects of Long-term Fertilization on Yield and Nitrogen Utilization of Spring Maize in Irrigation Silting Soils. J. Soil Water Conserv. 2017, 2, 248–252. [Google Scholar]
  57. Liang, J.; Crowther, T.W.; picard, N.; Wiser, S.; Zhou, M.; Alberti, G.; Schulze, E.D.; McGuire, A.D.; Bozzato, F.; Pretzsch, H.; et al. Positive biodiversity-productivity relationship predominant in global forests. Science 2016, 354, aaf8957. [Google Scholar] [CrossRef] [Scilit]
  58. Schwartz, M.; Brigham, C.; Hoeksema, J.; Lyons, K.; Mills, M.; Mantgem, P. Linking biodiversity to ecosystem function: Implications for conservation ecology. Oecologia 2000, 122, 297–305. [Google Scholar] [CrossRef] [Scilit]
  59. Lange, M.; Eisenhauer, N.; Sierra, C.A.; Bessler, H.; Engels, C.; Griffiths, R.I.; Mellado-Vazquez, P.G.; Malik, A.A.; Roy, J.; Scheu, S.; et al. Plant diversity increases soil microbial activity and soil carbon storage. Nat. Commun. 2015, 6, 6707. [Google Scholar] [CrossRef] [Scilit]
  60. Wang, Y.; He, X.; Zhou, G. Study on the Responses of Leymus chinensis Steppe to Grazing in Songnen Plain. Acta Agrestia Sin. 2002, 10, 45–49. [Google Scholar]
  61. Kaiser, K.; Wemheuer, B.; Korolkow, V.; Wemheuer, F.; Nacke, H.; Schoning, I.; Schrumpf, M.; Daniel, R. Driving forces of soil bacterial community structure, diversity, and function in temperate grasslands and forests. Sci. Rep. 2016, 6, 33696. [Google Scholar] [CrossRef] [Scilit]
  62. Jin, Y.; Wu, H.; Tang, F.; Zhang, Y. Study on Functional Diversity of Soil Microorganism in Different Mangrove Plants Based on Biolog-ECO Technology. Ecol. Environ. Sci. 2017, 26, 1292–1300. [Google Scholar]
  63. Liu, M.; Li, X.; Zhu, R.; Chen, N.; Ding, L.; Chen, C. Vegetation richness, species identity and soil nutrients drive the shifts in soil bacterial community during restoration process. Environ. Microbiol. Rep. 2021, 13, 411–424. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  64. Rasche, F.; Knapp, D.; Kaiser, C.; Koranda, M.; Kitzler, B.; Zechmeister-Boltenstern, S.; Richter, A.; Sessitsch, A. Seasonality and resource availability control bacterial and archaeal community in soils of a temperate beech forest. ISME J. 2011, 5, 389–402. [Google Scholar] [CrossRef] [Scilit]
  65. Su, S.; Wang, X.; Lin, Z.; Jin, Y.; Xue, Y. The Characteristics of Soil Microbial Functional Diversity of Six Types of Vegetation in Tropical Regions. J. Yunnan Agric. Univ. 2022, 37, 505–514. [Google Scholar]
  66. Luo, G.; Xue, C.; Jiang, Q.; Xiao, Y.; Ling, N. Soil carbon, nitrogen, and phosphorus cycling microbial populations and their resistance to global change depend on soil C: N:P stoichiometry. Msystems 2020, 5, e00162-20. [Google Scholar] [CrossRef] [Scilit]
  67. Lefcheck, J.S.; Byrnes, J.E.K.; Isbell, F.; Gamfeldt, L.; Griffin, J.N.; Eisenhauer, N.; Hensel, M.J.S.; Hector, A.; Cardinale, B.J.; Duffy, J.E. Biodiversity enhances ecosystem multifunctionality across trophic levels and habitats. Nat. Commun. 2015, 6, 6936. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  68. Wang, X.; Ma, Y.; Zhang, G.; Lin, D.; Zhang, D. Relationship between Plant Community Diversity and Ecosystem Multifunctionality During Alpine Meadow Degradation. Acta Agrestia Sin. 2021, 29, 1053–1060. [Google Scholar] [CrossRef] [Scilit]
  69. Delgado-Baquerizo, M.; Maestre, F.T.; Reich, P.B.; Jeffries, T.C.; Gaitan, J.J.; Encinar, D.; Berdugo, M.; Campbell, C.D.; Singh, B.K. Microbial diversity drives multifunctionality in terrestrial ecosystems. Nat. Commun. 2016, 7, 10541. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. The distribution of abundant taxa with relative abundances > 1% in at least one sample. (A), Soil fungal community at phylum level; (B), Soil fungal community at genus level; (C), soil bacterial community at phylum level; (D), soil bacterial community at the genus level. NF: no-tillage reseeding and fertilization. CK: control check.
Figure 1. The distribution of abundant taxa with relative abundances > 1% in at least one sample. (A), Soil fungal community at phylum level; (B), Soil fungal community at genus level; (C), soil bacterial community at phylum level; (D), soil bacterial community at the genus level. NF: no-tillage reseeding and fertilization. CK: control check.
Land 12 00638 g001
Figure 2. Effects of main land-use types on single ecosystem functions. (A), organic carbon; (B), total nitrogen; (C), C:N; (D), total phosphorus; (E) available nitrogen; (F), available phosphorus; (G), ammonia nitrogen; (H), nitric nitrogen; (I), pH; (J), capillary porosity; (K) bulk porosity; (L), soil water content. a/b: Different lowercase letters represent significant differences between NF and CK (p < 0.05).
Figure 2. Effects of main land-use types on single ecosystem functions. (A), organic carbon; (B), total nitrogen; (C), C:N; (D), total phosphorus; (E) available nitrogen; (F), available phosphorus; (G), ammonia nitrogen; (H), nitric nitrogen; (I), pH; (J), capillary porosity; (K) bulk porosity; (L), soil water content. a/b: Different lowercase letters represent significant differences between NF and CK (p < 0.05).
Land 12 00638 g002aLand 12 00638 g002b
Figure 3. Effects of main land-use types on ecosystem functions. (A), soil fertility maintenance; (B), water conservation; (C), nutrient transformation and cycling; (D), ecosystem multifunctionality. a: Same lowercase letters represent nonsignificant differences between NF and CK (p > 0.05).
Figure 3. Effects of main land-use types on ecosystem functions. (A), soil fertility maintenance; (B), water conservation; (C), nutrient transformation and cycling; (D), ecosystem multifunctionality. a: Same lowercase letters represent nonsignificant differences between NF and CK (p > 0.05).
Land 12 00638 g003
Figure 4. Correlation analysis between species diversity indices and single ecosystem functions in NF and CK. * p < 0.05, ** p < 0.01. (A), correlation analysis between plant diversity indices and single ecosystem functions in CK; (B), correlation analysis between plant diversity indices and single ecosystem functions in NF; (C), correlation analysis between bacterial diversity indices and single ecosystem functions in CK; (D), correlation analysis between bacterial diversity indices and single ecosystem functions in NF. H, H’, D, and P: Margalef index of the plant community, Shannon–Wiener index of the plant community, Simpson index of the plant community, and Pielou index of the plant community. C(F), P(F), H’(F), D(F), C(B), P(B), H’(B), and D(B): the Chao1 index of fungal community, Pielou index of fungal community, Shannon–Wiener index of fungal community, Simpson index of fungal community, Chao1 index of the bacterial community, Pielou index of the bacterial community, Shannon–Wiener index of the bacterial community, Simpson index of the bacterial community. OC, TN, C:N, TP, AN, AP AMN, NN, pH, CP, BP, and SWC: organic carbon, total nitrogen, C:N, total phosphorus, available nitrogen, available phosphorus, ammonia nitrogen, nitric nitrogen, pH, capillary porosity, bulk porosity, and soil water content.
Figure 4. Correlation analysis between species diversity indices and single ecosystem functions in NF and CK. * p < 0.05, ** p < 0.01. (A), correlation analysis between plant diversity indices and single ecosystem functions in CK; (B), correlation analysis between plant diversity indices and single ecosystem functions in NF; (C), correlation analysis between bacterial diversity indices and single ecosystem functions in CK; (D), correlation analysis between bacterial diversity indices and single ecosystem functions in NF. H, H’, D, and P: Margalef index of the plant community, Shannon–Wiener index of the plant community, Simpson index of the plant community, and Pielou index of the plant community. C(F), P(F), H’(F), D(F), C(B), P(B), H’(B), and D(B): the Chao1 index of fungal community, Pielou index of fungal community, Shannon–Wiener index of fungal community, Simpson index of fungal community, Chao1 index of the bacterial community, Pielou index of the bacterial community, Shannon–Wiener index of the bacterial community, Simpson index of the bacterial community. OC, TN, C:N, TP, AN, AP AMN, NN, pH, CP, BP, and SWC: organic carbon, total nitrogen, C:N, total phosphorus, available nitrogen, available phosphorus, ammonia nitrogen, nitric nitrogen, pH, capillary porosity, bulk porosity, and soil water content.
Land 12 00638 g004
Figure 5. The relationship between plant diversity and ecosystem multifunctionality. Yellow and red colored dots indicate NF and CK, respectively. The translucent areas indicate 95% confidence intervals. (A), Margalef index of plant diversity; (B), Pielou index of plant diversity; (C), Shannon–Wiener index of plant diversity; (D), Simpson index of plant diversity.
Figure 5. The relationship between plant diversity and ecosystem multifunctionality. Yellow and red colored dots indicate NF and CK, respectively. The translucent areas indicate 95% confidence intervals. (A), Margalef index of plant diversity; (B), Pielou index of plant diversity; (C), Shannon–Wiener index of plant diversity; (D), Simpson index of plant diversity.
Land 12 00638 g005
Figure 6. The relationship between microbial diversity and ecosystem multifunctionality. Yellow and red colored dots indicate NF and CK, respectively. The translucent areas indicate 95% confidence intervals. (A), Chao1 index of fungal diversity; (B), Pielou index of fungal diversity; (C), Shannon–Wiener index of fungal diversity; (D), Simpson index of fungal diversity; (E), Chao1 index of bacteria diversity; (F), Pielou index of bacteria diversity; (G), Shannon–Wiener index of bacteria diversity; (H), Simpson index of bacteria diversity.
Figure 6. The relationship between microbial diversity and ecosystem multifunctionality. Yellow and red colored dots indicate NF and CK, respectively. The translucent areas indicate 95% confidence intervals. (A), Chao1 index of fungal diversity; (B), Pielou index of fungal diversity; (C), Shannon–Wiener index of fungal diversity; (D), Simpson index of fungal diversity; (E), Chao1 index of bacteria diversity; (F), Pielou index of bacteria diversity; (G), Shannon–Wiener index of bacteria diversity; (H), Simpson index of bacteria diversity.
Land 12 00638 g006aLand 12 00638 g006b
Table 1. Changes in plant diversity under main land-use types (mean ± SD).
Table 1. Changes in plant diversity under main land-use types (mean ± SD).
TreatmentIndex
MargalefShannon–WienerSimpsonPielou
NF1.34 ± 0.17 a1.81 ± 0.18 a0.80 ± 0.06 a0.88 ± 0.05 a
CK0.67 ± 0.22 b1.16 ± 0.25 b0.65 ± 0.10 b0.88 ± 0.07 a
Notes: NF: no-tillage reseeding and fertilization. CK: control check. Different lowercase letters within the same column represent significant differences between different treatments (p < 0.05).
Table 2. Changes in microbial diversity under main land-use types (mean ± SD).
Table 2. Changes in microbial diversity under main land-use types (mean ± SD).
CategoryTreatmentIndex
Chao1PielouShannon–WienerSimpsonCoverage/%
FungiNF460.22 ± 29.56 a0.69 ± 0.03 a6.08 ± 0.18 a0.95 ± 0.01 a99.98
CK351.14 ± 60.73 b0.64 ± 0.07 b5.33 ± 0.51 b0.93 ± 0.02 b99.97
BacteriaNF4299.04 ± 431.27 a0.90 ± 0.01 a10.76 ± 0.04 a1.00 ± 0.00 a99.18
CK3986.51 ± 550.43 a0.89 ± 0.01 a10.61 ± 0.25 a0.99 ± 0.00 a99.06
Note: different lowercase letters within the same column represent significant differences between NF and CK (p < 0.05).
Table 3. Correlation analysis of plant diversity with microbial diversity under main land-use types.
Table 3. Correlation analysis of plant diversity with microbial diversity under main land-use types.
TreatmentIndexC(F)P(F)H’(F)D(F)C(B)P(B)H’(B)D(B)
NFMargalef−0.330.430.430.40−0.280.430.633 *0.31
Shannon–Wiener−0.130.270.300.18−0.080.240.45−0.03
Simpson−0.030.180.210.050.020.130.33−0.16
Pielou−0.160.130.120.11−0.170.200.230.10
CKMargalef−0.430.68 *0.62 *0.72 **0.79 **0.81 **0.81 **0.76 **
Shannon–Wiener−0.510.78 **0.71 **0.84 **0.85 **0.80 **0.85 **0.72 **
Simpson−0.540.74 **0.65 *0.81 **0.72 **0.67 *0.72 **0.58 *
Pielou0.050.320.370.270.140.080.130.15
Notes: * p < 0.05, ** p < 0.01. C(F), P(F), H’(F), D(F), C(B), P(B), H’(B), and D(B): Chao1 index of fungal community, Pielou index of fungal community, Shannon–Wiener index of fungal community, Simpson index of fungal community, Chao1 index of the bacterial community, Pielou index of the bacterial community, Shannon–Wiener index of the bacterial community, Simpson index of the bacterial community, respectively.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Su, H.; Ma, L.; Chang, T.; Qin, R.; Zhang, Z.; She, Y.; Wei, J.; Zhou, C.; Hu, X.; Shi, Z.; et al. Effects of Main Land-Use Types on Plant and Microbial Diversity and Ecosystem Multifunctionality in Degraded Alpine Grasslands. Land 2023, 12, 638. https://doi.org/10.3390/land12030638

AMA Style

Su H, Ma L, Chang T, Qin R, Zhang Z, She Y, Wei J, Zhou C, Hu X, Shi Z, et al. Effects of Main Land-Use Types on Plant and Microbial Diversity and Ecosystem Multifunctionality in Degraded Alpine Grasslands. Land. 2023; 12(3):638. https://doi.org/10.3390/land12030638

Chicago/Turabian Style

Su, Hongye, Li Ma, Tao Chang, Ruimin Qin, Zhonghua Zhang, Yandi She, Jingjing Wei, Chenyu Zhou, Xue Hu, Zhengchen Shi, and et al. 2023. "Effects of Main Land-Use Types on Plant and Microbial Diversity and Ecosystem Multifunctionality in Degraded Alpine Grasslands" Land 12, no. 3: 638. https://doi.org/10.3390/land12030638

APA Style

Su, H., Ma, L., Chang, T., Qin, R., Zhang, Z., She, Y., Wei, J., Zhou, C., Hu, X., Shi, Z., Adi, H., Li, H., & Zhou, H. (2023). Effects of Main Land-Use Types on Plant and Microbial Diversity and Ecosystem Multifunctionality in Degraded Alpine Grasslands. Land, 12(3), 638. https://doi.org/10.3390/land12030638

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop