Next Article in Journal
Enhancing Ecological Network Connectivity Through Urban–Rural Gradient Zoning Optimization of Ecological Process Flow
Previous Article in Journal
Stakeholder Strategies and Factors Influencing the Pilot Reform of Building Rental Housing on Collectively Owned Land: An Evolutionary Game Methodology
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Land
Volume 14
Issue 4
10.3390/land14040667
land-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Soil Fungal Communities in the Rhizosphere of Sauvignon Blanc Grapes Subjected to Various Agricultural Management Practices

by
Nativ Rotbart
1,*,
Tirza Doniger
2,
Itaii Applebaum
2 and
Yosef Steinberger
2,*
1
Shamir Research Institute, University of Haifa, Haifa 3498838, Israel
2
The Mina & Everard Goodman Faculty of Life Sciences, Bar-Ilan University, Ramat Gan 5290002, Israel
*
Authors to whom correspondence should be addressed.
Land 2025, 14(4), 667; https://doi.org/10.3390/land14040667
Submission received: 27 January 2025 / Revised: 17 March 2025 / Accepted: 19 March 2025 / Published: 21 March 2025
Browse Figures
Versions Notes

Abstract

:
The quality and production of viticulture are profoundly shaped by climate and soil, which are vital for enhancing plant growth, maximizing productivity, and facilitating carbon sequestration and phytoremediation. Any degradation in soil quality resulting from production practices—such as salinization and increased acidity—jeopardizes the long-term sustainability of vineyard operations. It is crucial that we prioritize the health of our soil to ensure the future success of our vineyards. This study aims to (1) assess soil fungal diversity under various management practices, (2) compare the relative abundance of sequence reads for different taxa in response to these practices, and (3) analyze shifts in functional guild composition in relation to these management practices. In this investigation, the fungal community composition was analyzed using molecular tools across five locations with distinct land management practices on the same basaltic soil. The findings indicate that vineyard management practices had a substantial impact on fungal diversity, as evidenced by taxonomic alpha diversity metrics, with significant differences observed in comparison to natural pasture and open field conditions. A permutational analysis of variance (PERMANOVA) revealed a highly significant effect of management practices (p < 0.0001) on fungal community structure. The land management practices were found to induce significant (p < 0.05) differences in species diversity between organic sites (organic and conventional) and the natural control site. Furthermore, the composition and functionality of the fungal communities appear to be shaped by the distinct abiotic factors associated with different management strategies that increase the abundance of total soil microorganisms that are affecting the grape yield and its quality.

1. Introduction

Agro management of vineyards on basaltic soils in cooler, drier climates has become increasingly prevalent in Israel’s Golan Heights. Basalt has a vital role in shaping soil quality, especially in viticultural areas. While basalt bedrock underlies the landscape, most vineyards thrive in soils that have evolved from loess and glacial flood sediments rather than directly from basalt [1]. However, in select regions, basalt and its weathering products become key soil components [2]. Through the process of mechanical ripping, the mineralogy and chemical composition are transformed, leading to significant enhancements in iron concentration. This interplay between basalt and vineyard soils is crucial for exceptional grape cultivation.
Additionally, basalt soils have a relatively high calcium content, crucial for vine growth and essential for optimal vine function, yield, and quality [3,4]. As reported by Pogue [5], the percentage of vineyards planted on basalt-derived soils are among the highest in viticulture regions, including the Pacific Northwest USA and globally. Key compounds such as tannins, polymeric, and total anthocyanins, along with the composition and diversity of the soil biota community, have been identified as major contributors to vine production quality [6,7,8].
Soil biota communities within the rhizosphere and around vine roots are crucial for controlling soil phytopathogens and play vital roles in terrestrial ecosystems by significantly enhancing the availability of soil nutrients to plants [9,10]. These beneficial associations help plants manage abiotic stresses, such as nutrient deficiencies in different soils and growing conditions. By using root exudates to selectively recruit microbes, plants enhance their nutrition, health, and overall productivity. The addition of organic matter from sources such as manure and mulching increases soil fertility, which in turn boosts microbial biomass and diversity in the root zone, creating a “biota island” that is rapidly colonized by bacteria and fungi [11,12]. The interaction between the plant rhizosphere and soil microflora plays a crucial role in nutrient uptake, plant health, and overall soil biota, helping plants cope with abiotic stress, diseases, and overall ecosystem functioning [13].
Soil fungi are a highly diverse group of organisms that provide a wide range of ecosystem services, including organic matter decomposition, nutrient cycling, plant protection through beneficial symbiosis, and bioremediation, and serve as indicators of conservation value [14,15]. Soil fungi can be categorized into three functional guilds based on the substrates they utilize: saprotrophs, symbiotrophs, and pathotrophs. Their functions are closely linked to abiotic factors, which are strongly influenced by soil system heterogeneity [16,17,18]. Agricultural management practices greatly affect soil organic matter. Additionally, the prolonged use of organic, conventional, and foliar treatments leads to changes in the diversity and composition of fungal communities [19,20]. The role of fungal communities includes investigating their diversity and composition within the soil milieu. By analyzing the contributions of these fungal communities to nutrient cycling and soil structure, we can gain insights into how different agricultural practices affect soil health and their economic implications [21]. This study aimed to investigate soil fungal community structure from both taxonomic and functional perspectives under three long-term grape varieties of Sauvignon blanc vineyard management practices and two natural management systems on basaltic soils in Northern Israel. Despite similar abiotic conditions across all sites, we expected that management practices would have a significant impact on fungal diversity and functional groups. Our hypotheses were as follows: (a) overall soil fungal abundance and diversity would be higher under organic management compared to conventional management; (b) organic management would favor saprophytic fungi, while conventional management would favor pathogenic fungi; and (c) mulching, primarily contributing to soil moisture conservation, would increase the diversity of symbiotrophic taxa.
To address these hypotheses, we utilized high-throughput sequencing technology to determine fungal community structure, diversity, and functionality in soil samples collected from organic, conventional, foliar fertilization, and control sites. This study focuses on two key research questions: (a) How are the diversity and community composition of soil fungi affected by the different management practices? (b) What impact do vineyard management practices of Sauvigon blanc grape variety have on the composition of fungal functional guilds?

2. Materials and Methods

The study area is located on a dormant volcano in the Golan Heights (33°04′10″ N 35°46′11″ E) next to Mount Shifon at 820 m above sea level. The climate in the region is classified as humid Mediterranean with mean multi-annual rainfall of 760 mm y-1 that is confined to the winter season (October–May 2022). Mean annual temperature is 15 °C, the winter minimum air temperature of the coldest month (January) is 2 °C, and the mean soil temperature in this period is 10 °C [22]. The plateau vegetation is characterized by open grassland dominated by herbaceous plant species with short lifecycles (e.g., Trifolium species, Dactylis glomerata, Eryngium glomeratum; [23]. The soil in the study area is classified as the order Molisuls, suborder Xerolls (available online: https://experience.arcgis.com/experience/a3e2530b0f474f43bb5c7b14e7d27010/?locale=he#data_s=id%3AdataSource_1-193863037f3-layer-1%3A10461 (accessed on 20 September 2020)) [24]. The primary soil clay is kaolinite, based on cation exchange capacity (CEC) [25].
Soil sampling (Table 1) was performed on 14 December 2021 at five sites: (1) Merom Golan Organic Vineyard (MO) (33°03′50.9″ N 35°45′10.6″ E), a certified organic vineyard that was planted in 2014. Fertilization is based on compost, applied once every 2 years, and the use of confusion strings and hormones traps. (2) Merom Golan Intensive Conventional Vineyard (MI) (33°03′29.5″ N 35°44′57.4″ E), an intensive vineyard that was planted in 2017. Fertilization was applied according to leaf analysis and compost was applied on demand. Heliun (a long-lasting herbicide) was applied 1 year ago. (3) Natural pasture (NP) (33°03′44.4″ N 35°45′06.9″ E). (4) Foliar fertilization (FF) (33°04′45.8″ N 35°46′21.8″ E). This vineyard was planted in 2014. It uses drip irrigation—1 hanged drip emitter. Fertilization was based on foliar application of mainly N, K, and micro-Mg, Zn, and compost application, without herbicide application. Mowing treatment: Crushing the pruning in the middle of the row to provide a substrate for comfortable growth. (5) Open field (OF) (33°04′45.6″ N 35°46′22.5″ E), the natural control site.

2.1. Soil Sampling

Soil samples were randomly collected from each of the five sites (MO, MI, NP, FF, and OF) at a depth of 0–10 cm soil surface in the rows between two grapevines at the plant rhizosphere (roots-rhizomes) near the drippers with three replicates per site. Each replicate was a composite sample from four different locations within the site. The soil samples obtained from the grapevine rhizosphere (rhizomes) were placed in individual bags, stored in an insulated container to prevent overheating, and transported to the laboratory. The soil samples obtained from the grapevine rhizosphere were separated from the roots (rhizomes) and used further for physicochemical and biological analyses.
Before conducting physicochemical and biological analyses, each sample was sieved using a 2 mm mesh to remove stones, roots, and other organic debris. The samples were then divided into two portions: one was stored at −20 °C for genetic analysis, and the other was stored at 4 °C for abiotic analysis. All abiotic and biotic measurements were completed within two weeks of field sampling.

2.2. Soil Abiotic Variable Determination

Soil moisture (SM) was determined gravimetrically by drying the soil samples at 105 °C for 48 h. For soil organic matter (SOM) determination, a dry soil sample was placed in a muffle furnace at 400 °C for 8 h. Soil pH was determined with a glass electrode using a 1:2 soil:water ratio, followed by shaking for 10 min (160 rpm) and incubation overnight at room temperature. Electrical conductivity (EC) was measured in a soil water suspension (soil:double-distilled water 1:10) and determined using an auto-ranging EC/temp meter (TH2400, El Hamma, Israel) [26].

2.3. Soil Biotic Components Analysis

The DNA was extracted from 0.5 g soil using an Exgene soil DNA mini kit from GeneAll (Seoul, Korea), as per the kit’s instructions. No soil sample extracts were used as negative controls [25].
The DNA was amplified using a SimpliAmpTM thermal cycler (Thermo Fisher Scientific, Walham, MA, USA) by mixing 12.5 μL HS Taq Mix Red (PCR Biosystems, London, UK), 9.5 μL ultrapure water, 1.0 μL extracted DNA, 1.0 μL CS1-ITS2 (ACACTGACGACATGGTTCTACAGCATCGATGAAGAACGCAGC), and 1.0 μL CS2-ITS4 (TACGGTAGCAGAGACTTGGTCTTCCTCCGCTTATTGATATGC). The thermal cycling program was set to 95 °C for 2 min, followed by 40 cycles at 95 °C for 15 s, 50 °C for 30 s, 72 °C for 30 s, and, after the cycles, 72 °C for 3 min. Sequencing (Miseq) was performed at the Hylabs Laboratory Ltd. (Rehovot, Israel; www.hylabs.co.il) sequencing facility using an Illumina sequencing platform (Illumina Inc., San Diego, CA, USA).

3. Data Analysis

The soil abiotic results present in [26] show that a late-autumn sampling period was strategically selected to ensure minimal variability between treatments and sites. The analysis revealed significant differences among the treatments, while the abiotic variable measurements across the five treatment locations showed no noteworthy discrepancies. Organic matter percentages varied impressively, ranging from 2.98% in the MI (intensive management) to a robust 6.85% in the FF (organic vineyard), illustrating a clear trend of decreasing organic content: FF > MO > NO > OF > MI. Soil pH was consistently measured between 6.4 and 7.2, and the calcium carbonate (CaCO3) content remained stable with a mean of 4.4%. Notably, mean soil salinity (EC) exhibited a decreasing gradient, starting at a substantial 2.88 DS/m in the FF treatment and transitioning through OF and MO, ultimately declining to 0.92 DS/m in the MI samples. These data underscore the pronounced impact of management practices on soil health and the environment.

Phylogenetic Marker and Diversity

The sequencing data were de-multiplexed using the Illumina base space cloud to generate two FASTQ files for each sample. The FASTQ files were imported into CLC-bio and analyzed as follows: reads were trimmed for quality and adaptor sequences, merged, and then subjected to OTU (operational taxonomic unit) picking to generate abundance tables. The Unite V7.2 database at 97% was used for OTU generation and classification.
All analyses were conducted in the R software environment v4.1.0 [27,28]. Alpha and beta diversity analyses, including PERMANOVA (permutational analysis of variance) and PCoA (principal coordinate analysis), were performed using functions available in the R package “vegan” v2.5-7 [29].
The open annotation tool FUNGuild [15] was used for fungal functional group identification and analysis within the fungal communities. The FUNGuild database and script FUNGuild v1.0 is a flat database hosted by GitHub (available online: https://github.com/UMNFuN/FUNGuild), making it accessible for use and able to be annotated by any interested party under the GNU General Public License. The database currently contains a total of 9476 entries, with 66% at the genus level and 34% at the species level.
The FUNGuild tool was used to classify fungal taxa into the three ecological trophic modes: saprotrophs (feeding on nonliving organic matter), symbiotrophs (symbiotic relationship between organisms), and pathotrophs (deriving nourishment from pathogens). The OTUs were assigned confidence rankings of highly probable, probable, or possible, and only the retained OTUs in taxa with confidence levels of “probable” or “highly probable” in guild assignments were included in downstream analysis [30]. Within these trophic modes, we designated a total of 12 categories, broadly referred to as guilds (in alphabetical order: animal pathogens, arbuscular mycorrhizal fungi (AMF), ectomycorrhizal fungi, ericoid mycorrhizal fungi, foliar endophytes, lichenicolous fungi, lichenized fungi, mycoparasites, plant pathogens, undefined root endophytes, undefined saprotrophs, and wood saprotrophs) [18].
Guild assignments of OTUs that demonstrated ≥93% sequence similarity with a reference sequence were kept, as this conservatively reflects the genus boundaries with the ITS (internal transcribed spacer) gene region for many fungi [31].

4. Results

Soil moisture (SM) ranged from 12.5% to 26.0%, with no significant differences observed except between MI (conventional vineyard) and FF (foliage fertilization) (p < 0.05) and between OF (open field) and FF (p < 0.05) (Figure 1). The pH levels showed significant differences (p < 0.05) between the organic vineyard (MO) and OF, as well between NP (natural pasture) and FF (p < 0.05), NP and MI (p < 0.05), and NP and MO (0.01) (Figure 1).
Asterisks indicate significant differences between the different management practices as determined using Student’s t-test (* p < 0.05, ** p < 0.01, *** p < 0.001). MO—organic management; MI—conventional management; NP—natural pasture; FF—foliage management; OF—open field.
Organic matter ranged between 3.1 and 8.2%, where significant differences at p < 0.05 were obtained only between MI and FF and between OF and FF. Electrical conductivity at MI and NP was significantly lower (p < 0.05) than at MO (MI only) and FF (Figure 1).

4.1. Phylogenetic Markers and Diversity

A total of 11 phyla were found, as well as 1 unidentified phylum. Their relative taxonomic abundance is presented in Figure 2a. The most abundant fungal phylum in the soil samples was the Ascomycota, which is known as a widespread plant pathogen, with a mean value ranging from 66% for FF to 72% for OF, of the total OTU (Figure 2a). This was followed by the Basidiomycota with less than 20%, Chytridiomycota with less than 10%, and Mortierellomycota with less than 5%. All of the other phyla (Rozellomycota, Glomeromycota, Mucoromycota) were present at less than 1%.
Of the total eleven phyla detected, one was unique to the NP site, one was shared by MO and MI, and nine taxa were present under all management practices. A different picture was obtained at the class level, where 33 taxa (Figure 2b) were obtained, with a total of 837 OTUs detected. Constructing a Venn Diagram identified the core microbiome for the five management practices (Figure 3), where 104 OTUs were common taxa detected in the soil samples of all five management practices and 343 OTUs (120, 54, 30, 75 and 64, for NP, OF, FF, MO and MI, respectively) were unique. Approximately 50% of all of the OTUs detected were shared by at least two management practices. The most widely shared families detected in all samples were as follows: Mycosphaerellaceae, Pleosporaceae, Aspergillaceae, Ascobolaceae, Plectosphaerellaceae, Chaetomiaceae, Lasiosphaeriaceae, Psathyrellaceae, Bulleribasidiaceae, and Mortierellaceae.
At the species level, we found a total of 512 species, of which 112 were unidentified. Species richness, which represents the number of species in the community in each treatment (p-value, Table 1), was significantly higher in OF and NP than in MO, MI, and FF.
The Shannon Index H’ (p-value, Table 1) was highest in NP and lowest in FF, within no differences between the other three treatments. These results show that species diversity and H’ are relatively higher under “natural” management practices than agricultural management practices, although H’ was lower in OF than in NP. Potential species richness (S. chao), the mean number of species present in a community based on their abundance and alpha diversity (S.ACE), take into account the rare OTUs that appear in the samples with some similarity to the Chao determination, interpreting the species richness estimators [32,33] (Table 2). The data obtained for each index describe the difference between treatments by also taking into account the rare OTUs present in the sample. The trends in Chao1 and ACE are similar to that of species richness and H’, where the sites under “natural” management practices (NP, OF) display higher diversity than the sites under agricultural management practices: Chao1 was significantly higher at NP and OF than at MO and FF (Table 2 [32,33]), while ACE was highest at NP and lowest at FF and MO, and higher at OF than at MO and FF (p-value, Table 1).
Beta diversity differences in species’ OTU levels (Figure 4) were visualized with a principal coordinate analysis (PCoA) based on the Bray–Curtis dissimilarity metric of the fungal abundance data. This analysis distinguished among the five sites with a relatively high degree of success. We observed a separation between the fungal communities of the two long-term vineyard management practices, MO and MI, and these two were different from the other three management practices OF, FF, and NP. The MO and MI treatments demonstrated more positive PCo1 values, which we may consider the management effect; this effect was stronger for MI. Overall, this analysis showed that the different management practices generated total fungal communities whose composition differed significantly from each other at the species level (PERMANOVA, F = 3.54, p < 0.001; Table 3). Using RDA to test the effect of the abiotic variables showed a significant effect from EC (electrical conductivity) and pH on beta diversity (Figure 5), expressed mainly along PC2.

4.2. Fungal Trophic Group and Guild Assignment

In total, 20,555 sequences were detected from the different soil samples collected from the different management practices, where 33% were unassigned, 17.9% were obtained from MO, 21.3% from MI, 20.6% from NP, 19.5% from FF, and 20.7% from OF. No significant differences were found in the total OTUs among the different management practices. The OTUs with highly probable functional assignments from FUNGuild were used for the functional analysis. The three guilds (pathotrophs, saprotrophs, and symbiotrophs) for each of the agro-management practices are presented in Table 4.
The two-to-three-fold higher percentage of saprotrophs compared to pathotrophs and over 60-fold higher percentage of saprotrophs compared to symbiotrophs demonstrates the relatively high involvement of fungi in organic matter decomposition. In MI and FF, there was less than 1% of symbiotrophs, significantly lower than in NP, MO, and OF. Pathotrophs were over 30% more abundant in MI, MO, and OF than in NP and FF. The symbiotroph:saprotroph ratio was highest in NP. It was seven-to-eighteen-fold higher in MI, NP, and OF than in FF, and at least two-fold higher in MI, NP, and FF than in MO.
Regarding the number of OTUs, i.e., the richness in each trophic mode (Table 5), the number of unassigned trophic modes in all management practices ranged from 28% to 32%. The richest trophic mode was the saprotrophs, ranging from 39% of total observed OTU richness in MO to 43% in FF.
There were no differences in pathotroph richness among management practices for the highly probable ranking. For the probable ranking, NP had the highest richness and FF the lowest, with insignificant differences in richness among the intermediate MI, MO, and OF. In the possible ranking, richness was lowest in FF and did not differ among the other four management practices.
Saprotroph richness was lowest in the highly probable ranking, with no differences in richness among management practices. In the probable ranking, FF had the lowest richness, slightly below MI and MO, with higher richness in OF and NP. This indicates that, regardless of the applied treatment, the cultivation of grapevines reduces saprotroph richness. Richness was higher in NP than in OF, indicating that grazing increases saprotroph richness. In the possible ranking, there were no differences in richness among the management practices.
Symbiotroph richness in the highly probable ranking was higher for MO, NP, and OF than for MI and FF. In the possible ranking, the differences among management practices were very small, with FF having the lowest richness and NP and OF having the highest richness. In the probable ranking, FF showed the lowest richness and NP showed the highest richness.

5. Discussion

In the present study, we characterized the soil fungal community composition in vineyards under five agro-management practices which share the same basalt soil in the Golan Heights in Northern Israel. The fungal community is known to play a fundamental role in all ecosystems, comprising major decomposers of organic matter, mutualists, and pathogens, and having a strong influence on plant health through its regulation of the soil carbon balance [32]. Analysis of the fungal community in the soil in the vicinity of the grapevine rhizosphere using ITS regions was found to be as effective as in studies by Hart [34] and Likar et al. [6,35]. Due to their high plasticity and ability to adjust to different unfavorable conditions, fungi can be found in and under different substrates and environments. Changes in land use strongly impact their basic functions and their interactions with available organisms, affecting both carbon and nutrient levels [36,37,38].
The differences in fungal community composition among the different sites and management practices, classified using OTUs, could be the effect of dissolution of minerals or basaltic glass fluid–rock ratios, as described by [39], through their metabolism-induced biomineralization, providing a significant source of Ca. Moreover, CO2–water–basalt interactions mineralize a relatively high amount of CO2, which is effective when the pH of the soil solution is close to 6.5. The availability of Fe, Mg, and Ca causes a decrease in carbonate formation [40], which we believe drives the changes in the fungal community in the open (OF) and natural (NP) sites compared to the other sites. Soil pH and moisture levels are shared drivers of soil fungal community composition and diversity due to the high resistance of the fungal community to changes in these parameters, owing to their high drought tolerance, prolific hyphal growth, and osmoregulation capabilities [41,42]. In soil systems where the soil pH range tend to change in response to moisture availability, high levels of pH in dryer regions’ species richness will be less variable and, in contrast, in high moisture regions, lower pH species richness will increase.
Our results are similar to those reported from a neotropical rainforest in Panama, with partial support for our hypothesis regarding the effect of management on fungal diversity and community composition in the soils of the five sites.
Regarding our first hypothesis, the soil fungal communities under each of the five agro-management practices differed in community distribution and composition, where Ascomycota (69.1%) had the greatest relative abundance, followed by Basidiomycota (16.2%) and Chytridiomycota (7.2%), which were common phyla in all managements. The abundance of Ascomycota was similar to the abundance found in other field studies. They are easily dispersed by spore and hyphal fragments and can exploit multiple niches [43,44]. Basidiomycota prefers to colonize root niches and exhibited higher values in organic managements such as MO, MI, and NP, similar to the findings of [26,45], while the abundance of Chytridiomycota was higher under the organic and foliage management practices than under the other three management practices. This may be related to its reproduction feature [46]. Based on the results, we assume that our predictions were consistent. Moreover, significant differences (p < 0.05) in species diversity (Shannon Index H’) were found between the organic and natural sites, as also reported by Yin et al. [47].
The management practice determines the composition of the overall soil biota community management in general, and crop cover determines the composition of the overall soil biota community, particularly the fungal community and the fungal guilds. Saprotrophs were the dominant guild across all treatments, reaching a maximum in the FF treatment, emphasizing their role in plant tissue decomposition. However, according to Soonvald et al. [48], some of these saprotrophs act as pathogens under certain management practices. Our conclusion regarding the saprophytic guild and its strong response to organic input is that a positive response to organic and foliage management can affect beneficial colonization of arbuscular mycorrhizal fungi (AMF) [49,50].
In general, it seems that FF had the lowest fungal richness in the highly probable and probable rankings. This may indicate that FF supports a more specialized soil fungal community [51]. The only difference between MO and MI seems to be in the highly probable symbiotrophic fungal community. The difference in highly probable symbiont richness can be largely attributed to the richness of fungi from the Glomeromycota (AMF) phylum. The richness of this phylum was similar across MO, NP, and OF (14, 11, 10, respectively) and was higher under these practices than under MI and FF (4 and 2, respectively). This indicates that the agricultural practices used in MI and FF might harm AMF richness, but the ones used in MO do not.
A more comprehensive study is necessary to fully understand the multiple interactions between agro-management practices and the diversity, composition, and functionality of the soil fungal community as a function of plant development and phenology. Such knowledge of the fungal community will yield beneficial information for the improvement of vineyard management in particular and agricultural management in general.

6. Conclusions

The intricate relationships between soil composition, particularly the presence of cations like iron (Fe), magnesium (Mg), and calcium (Ca), and the contributions of organic matter significantly enhance our understanding of carbonate formation in vineyard soils. This formation is crucial, as it impacts soil quality and supports diverse bacterial communities essential for vineyard health. Implementing effective soil management strategies is vital to maintaining cation balance, as adjusting the ratios of calcium, magnesium, potassium (K), and sodium (Na) over time can lead to sustainable soil practices that promote both plant growth and microbial vitality. The importance of these factors cannot be overstated, as they collectively underpin the success of vineyard ecosystems.

Author Contributions

Conceptualization, Y.S.; Methodology, I.A. and Y.S.; Validation, N.R. and T.D.; Investigation, I.A. and Y.S.; Data curation, T.D., I.A. and Y.S.; Writing—original draft, N.R., T.D., I.A. and Y.S.; Writing—review & editing, Y.S.; Supervision, N.R.; Project administration, N.R. All authors have read and agreed to the published version of the manuscript.

Funding

This research was sponsored by the Grapevine Council in Israel and by the Faculty of Life Sciences at Bar-Ilan University by providing funds for an M.Sc. student project.

Institutional Review Board Statement

This research does not involve human subjects, as it does not include data, specimens, or identifiable private information from individuals. Therefore, it is exempt from IRB approval.

Data Availability Statement

The NCBI accession for the data submission is: PRJNA856448: Effect of Basaltic Soil on Fungal Community under Vineyard Agro-management.

Acknowledgments

We would like to thank Ido Bar from the Merom Golan vineyard and Steve Applebaum from the Ortal vineyard for kindly allowing us to use their vineyard 346 for our study and for providing us with relevant information. We are greatly appreciative of Chen Sherman and May Levy for their useful help, suggestions, and support in the lab work.

Conflicts of Interest

The authors declare that there are no conflicts of interest.

References

  1. Vega-Avila, A.D.; Gumiere, T.; Andrade, P.A.M. Bacterial communities in the rhizosphere of Vitis vinifera L. cultivated under distinct agricultural practices in Argentina. Antonie Leeuwenhoek 2015, 107, 575–588. [Google Scholar] [CrossRef] [PubMed]
  2. Cohen, J.; Bershaw, J.; Hugo, R. Volcanic Glass as a Proxy for Paleotopography Suggests New Features in Late-Miocene Oregon. Atmosphere 2024, 15, 561. [Google Scholar] [CrossRef]
  3. Ashley, R. Grape Wine Nutrition—An Australian Perspective; University of California Agriculture and Natural Resources: Davis, CA, USA, 2011. [Google Scholar]
  4. White, P.J.; Brown, P.H. Plant nutrition for sustainable development and global health. Ann. Bot. 2010, 105, 1073–1080. [Google Scholar] [CrossRef]
  5. Pogue, K.R. Folds, floods, and fine wine: Geologic influences on the terroir of the Columbia Basin. In Volcanoes to vineyards: Geologic field trips through the dynamic landscape of the Pacific Northwest; Geological Society of America: Boulder, CO, USA, 2009; Volume 15, p. 1. [Google Scholar]
  6. Berlanas, C.; Berbegal, M.; Elena, G.; Laidani, M.; Cibriain, J.F.; Sagües, A.; Gramaje, D. The fungal and bacterial rhizosphere microbiome associated with grapevine rootstock genotypes in mature and young vineyards. Front. Microbiol. 2019, 10, 1142. [Google Scholar] [CrossRef]
  7. Karakis, S. Terroir Studies in Washington and Wisconsin American Viticultural Areas. Ph.D. Thesis, The University of Wisconsin-Milwaukee, Milwaukee, WI, USA, 2017. [Google Scholar]
  8. Schreiner, R.P.; Lee, J.; Skinkis, P.A. N, P, and K supply to Pinot Noir grapevines: Impact on vine nutrient status, growth, physiology, and yield. Am. J. Enol. Vitic. 2013, 64, 26–38. [Google Scholar] [CrossRef]
  9. Adl, S.M. The Ecology of Soil Decomposition; CABI International: Wallingford, UK, 2003. [Google Scholar]
  10. Holland, T.C.; Reynolds, A.G.; Bowen, P.A.; Bogdanoff, C.P.; Marciniak, M.; Brown, R.B.; Hart, M.M. The response of soil biota to water availability in vineyards. Pedobiologia 2013, 56, 9–14. [Google Scholar] [CrossRef]
  11. Ren, X.; Cai, T.; Chen, X.; Zhang, P.; Jia, Z. Effect of rainfall concentration with different ridge widths on winter wheat production under semiarid climate. Eur. J. Agron. 2016, 77, 20–27. [Google Scholar] [CrossRef]
  12. Zhang, H.; Xiong, X.; Wu, J.; Zhao, J.; Zhao, M.; Chu, G.; Hui, D.; Zhou, G.; Deng, Q.; Zhang, D. Changes in soil microbial biomass, community composition, and enzyme activities after half-century forest restoration in degraded tropical lands. Forests 2019, 10, 1124. [Google Scholar] [CrossRef]
  13. Reinhold-Hurek, B.; Bünger, W.; Burbano, C.S.; Sabale, M.; Hurek, T. Roots shaping their microbiome: Global hotspots for microbial activity. Annu. Rev. Phytopathol. 2015, 53, 403–424. [Google Scholar] [CrossRef]
  14. Heilmann-Clausen, J.; Barron, E.S.; Boddy, L.; Dahlberg, A.; Griffith, G.W.; Nordén, J.; Ovaskainen, O.; Perini, C.; Senn-Irlet, B.; Halme, P. A fungal perspective on conservation biology. Conserv. Biol. 2015, 29, 61–68. [Google Scholar] [CrossRef]
  15. Weißbecker, C.; Wubet, T.; Lentendu, G.; Kühn, P.; Scholten, T.; Bruelheide, H.; Buscot, F. Experimental evidence of functional group-dependent effects of tree diversity on soil fungi in subtropical forests. Front. Microbiol. 2018, 9, 2312. [Google Scholar] [CrossRef]
  16. Marriott, E.E.; Wander, M.M. Total and labile soil organic matter in organic and conventional farming systems. Soil Sci. Soc. Am. J. 2006, 70, 950–959. [Google Scholar] [CrossRef]
  17. Nguyen, N.H.; Song, Z.; Bates, S.T.; Branco, S.; Tedersoo, L.; Menke, J.; Schilling, J.S.; Kennedy, P.G. FUNGuild: An open annotation tool for parsing fungal community datasets by ecological guild. Fungal Ecol. 2016, 20, 241–248. [Google Scholar] [CrossRef]
  18. van der Linde, S.; Suz, L.M.; Orme, C.D.L.; Cox, F.; Andreae, H.; Asi, E.; Atkinson, B.; Benham, S.; Carroll, C.; Cools, N.; et al. Environment and host as large-scale controls of ectomycorrhizal fungi. Nature 2018, 558, 243–248. [Google Scholar] [CrossRef]
  19. Lupatini, M.; Korthals, G.W.; de Hollander, M.; Janssens, T.K.S.; Kuramae, E.E. Soil microbiome is more heterogeneous in organic than in conventional farming system. Front. Microbiol. 2017, 7, 2064. [Google Scholar] [CrossRef]
  20. Potter, T.S.; Vereecke, L.; Lankau, R.A.; Sanford, G.R.; Silva, E.M.; Ruark, M.D. Long-term management drives divergence in soil microbial biomass, richness, and composition among upper Midwest, USA cropping systems. Agric. Ecosyst. Environ. 2022, 325, 107718. [Google Scholar] [CrossRef]
  21. van Rijssel, S.Q.; Veen, G.F.; Koorneef, G.J.; Bakx-Schotman, J.M.T.; Ten Hooven, F.C.; Geisen, S.; van der Putten, W.H. Soil microbial diversity and community composition during conversion from conventional to organic agriculture. Mol. Ecol. 2022, 31, 4017–4030. [Google Scholar] [CrossRef] [PubMed]
  22. Gat, Z.; Horovitz, T.; Chechik, F. Winter Climate Regime at the Golan Heights: Topoclimatology, Frost and Dynamic Model Chilling Portions; Agromet Rep. 2; Division of Agricultural Meteorology, Israel Meteorological Service: Bet Dagan, Israel, 2001.
  23. Ben-Asher, M.; Haviv, I.; Roering, J.J.; Crouvi, O. The influence of climate and microclimate aspect on soil creep efficiency: Cinder cone morphology and evolution along the eastern Mediterranean Golan Heights. Earth Surf. Process. Landf. 2017, 42, 2649–2662. [Google Scholar] [CrossRef]
  24. Curtis, M.; Michaeli, E.; Aburto, F.; Itkin, D. Soil classification as a tool for contributing to sustainability at the landscape scale and forecasting impacts of management practices in agriculture and forestry. Soil Tillage Res. 2024, 244, 10216. [Google Scholar]
  25. Singer, A.; Zarei, M.; Lange, F.M.; Stahr, K. Halloysite characteristics and formation in the northern Golan Heights. Geoderma 2004, 123, 279–295. [Google Scholar] [CrossRef]
  26. Steinberger, Y.; Doniger, T.; Applebaum, I.; Sherman, C.; Rotbart, N. Effects of Vineyard Agro-management Practices on Soil Bacterial Community Composition, and Diversity. Microb. Ecol. 2024, 87, 17. [Google Scholar] [CrossRef]
  27. Vestergaard, G.; Schulz, S.; Schöler, A.; Schloter, M. Making big data smart—How to use metagenomics to understand soil quality. Biol. Fertil. Soils 2017, 53, 479–484. [Google Scholar] [CrossRef]
  28. R Core Team. R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing, Vienna, Austria. Available online: https://www.R-project.org/ (accessed on 18 March 2025).
  29. Oksanen, J.; Blanchet, F.G.; Friendly, M.; Kindt, R.; Legendre, P.; McGlinn, D.; Minchin, P.R.; O’hara, R.B.; Simpson, G.L.; Solymos, P. Vegan: Community Ecology Package; R Package Version 2.0-2, 17 January 2017; R: Vienna, Austria, 2017. [Google Scholar]
  30. Day, N.J.; Dunfield, K.E.; Johnstone, J.F.; Mack, M.C.; Turetsky, M.R.; Walker, X.J.; White, A.L.; Baltzer, J.L. Wildfire severity reduces richness and alters composition of soil fungal communities in boreal forests of western Canada. Glob. Chang. Biol. 2019, 25, 2310–2324. [Google Scholar] [CrossRef]
  31. Nilsson, R.H.; Kristiansson, E.; Ryberg, M.; Hallenberg, N.; Larsson, K.H. Intraspecific ITS variability in the Kingdom Fungi as expressed in the international sequence databases and its implications for molecular species identification. Evol. Bioinform. 2008, 2008, 193–201. [Google Scholar] [CrossRef]
  32. He, Y.; Zhou, B.J.; Deng, G.H.; Jiang, X.T.; Zhang, H.; Zhou, H.W. Comparison of microbial diversity determined with the same variable tag sequence extracted from two different PCR amplicons. BMC Microbiol. 2013, 13, 208. [Google Scholar] [CrossRef]
  33. Kim, B.R.; Shin, J.; Guevarra, R.B.; Lee, J.H.; Kim, D.W.; Seol, K.H.; Lee, J.H.; Kim, H.B.; Isaacson, R.E. Deciphering diversity indices for a better understanding of microbial communities. J. Microbiol. Biotechnol. 2017, 27, 2089–2093. [Google Scholar] [CrossRef]
  34. Hart, M.M. Evaluating the diversity of soil microbial communities in vineyards relative to adjacent native ecosystems. Appl. Soil. Ecol. 2016, 100, 91–103. [Google Scholar] [CrossRef]
  35. Likar, M.; Stres, B.; Rusjan, D.; Potisek, M.; Regvar, M. Ecological and conventional viticulture gives rise to distinct fungal and bacterial microbial communities in vineyard soils. Appl. Soil. Ecol. 2017, 113, 86–95. [Google Scholar] [CrossRef]
  36. Baldrian, P.; Bell-Dereske, L.; Lepinay, C.; Větrovský, T.; Kohout, P. Fungal communities in soils under global change. Stud. Mycol. 2022, 103, 1–24. [Google Scholar] [CrossRef]
  37. Frac, M.; Hannula, S.E.; Belka, M.; Jȩdryczka, M. Fungal biodiversity and their role in soil health. Front. Microbiol. 2018, 9, 707. [Google Scholar] [CrossRef]
  38. Žifčáková, L.; Větrovský, T.; Howe, A.; Baldrian, P. Microbial activity in forest soil reflects the changes in ecosystem properties between summer and winter. Environ. Microbiol. 2016, 18, 288–301. [Google Scholar] [CrossRef] [PubMed]
  39. Kleine, B.I.; Stefánsson, A.; Kjartansdóttir, R.; Prause, S.; Weisenberger, T.B.; Reynolds, H.I.; Sveinbjörnsdóttir, Á.E.; Jackson, M.D.; Gudmundsson, M.T. The Surtsey volcano geothermal system: An analogue for seawater-oceanic crust interaction with implications for the elemental budget of the oceanic crust. Chem. Geol. 2020, 550, 119702. [Google Scholar] [CrossRef]
  40. Gysi, A.P.; Stefánsson, A. CO2–water–basalt interaction. Numerical simulation of low temperature CO2 sequestration into basalts. Geochim. Cosmochim. Acta 2011, 75, 4728–4751. [Google Scholar] [CrossRef]
  41. Coleman, D.C.; Crossley, D.A., Jr.; Hendrix, P.F. Fundamentals of Soil Ecology, 2nd ed.; Elsevier Academic Press: San Diego, CA, USA, 2004. [Google Scholar]
  42. Blomberg, A.; Adler, L. Physiology of osmotolerance in fungi. In Advances in Microbial Physiology; Academic Press Ltd.: San Diego, CA, USA, 1992; Volume 33. [Google Scholar]
  43. Schappe, T.; Albornoz, F.E.; Turner, B.L.; Jones, F.A. Co-occurring fungal functional groups respond differently to tree neighborhoods and soil properties across three tropical rainforests in Panama. Microb. Ecol. 2020, 79, 675–685. [Google Scholar] [CrossRef]
  44. Kutos, S.; Barnes, E.M.; Bhutada, A.; Lewis, J.D. Preferential associations of soil fungal taxa under mixed compositions of eastern American tree species. FEMS Microbiol. Ecol. 2022, 98, 1–12. [Google Scholar] [CrossRef]
  45. Talbot, J.M.; Bruns, T.D.; Smith, D.P.; Branco, S.; Glassman, S.I.; Erlandson, S.; Vilgalys, R.; Peay, K.G. Independent roles of ectomycorrhizal and saprotrophic communities in soil organic matter decomposition. Soil. Biol. Biochem. 2013, 57, 282–291. [Google Scholar] [CrossRef]
  46. James, T.Y.; Kauff, F.; Schoch, C.L.; Matheny, P.B.; Hofstetter, V.; Cox, C.J.; Celio, G.; Gueidan, C.; Fraker, E.; Miadlikowska, J.; et al. Reconstructing the early evolution of Fungi using a six-gene phylogeny. Nature 2006, 443, 818–822. [Google Scholar] [CrossRef]
  47. Yin, Y.; Yuan, Y.; Zhang, X.; Huhe; Cheng, Y.; Borjigin, S. Comparison of the responses of soil fungal community to straw, inorganic fertilizer, and compost in a farmland in the loess plateau. Microbiol. Spectr. 2022, 10, e02230-21. [Google Scholar] [CrossRef] [PubMed]
  48. Soonvald, L.; Loit, K.; Runno-Paurson, E.; Astover, A.; Tedersoo, L. Characterising the effect of crop species and fertilisation treatment on root fungal communities. Sci. Rep. 2020, 10, 18741. [Google Scholar] [CrossRef]
  49. Fracchia, S.; Garcia-Romera, I.; Godeas, A.; Ocampo, J.A. Effect of the saprophytic fungus Fusarium oxysporum on arbuscular mycorrhizal colonization and growth of plants in greenhouse and field trials. Plant Soil 2000, 223, 177–186. [Google Scholar] [CrossRef]
  50. Cai, X.-B.; Peng, Y.-L.; Yang, M.-N.; Zhang, T.; Zhang, Q. Grassland degradation decrease the diversity of arbuscular mycorrhizal fungi species in Tibet Plateau. Not. Bot. Horti Agrobot. Cluj Napoca 2014, 42, 333–339. [Google Scholar] [CrossRef]
  51. Li, X.; Gai, J.; Cai, X.; Li, X.; Christie, P.; Zhang, F.; Zhang, J. Molecular diversity of arbuscular mycorrhizal fungi associated with two co-occurring perennial plant species on a Tibetan altitudinal gradient. Mycorrhiza 2014, 24, 95–107. [Google Scholar] [CrossRef] [PubMed]
Land 14 00667 g001
Figure 1. Box plots showing variation in abiotic variables among the agro-management treatments: soil moisture (SM%), organic matter (OM%), pH, and electrical conductivity (EC) (µS/cm). (Significance differences: * < 0.05; ** < 0.01; NS—Non Significant).
Figure 1. Box plots showing variation in abiotic variables among the agro-management treatments: soil moisture (SM%), organic matter (OM%), pH, and electrical conductivity (EC) (µS/cm). (Significance differences: * < 0.05; ** < 0.01; NS—Non Significant).
Land 14 00667 g001
Land 14 00667 g002
Figure 2. The relative taxonomic distribution of various fungal (a) phyla (b) classes in each of the five management practices. MO—organic management; MI—conventional management; NP—natural pasture; FF—foliage management; OF—open field.
Figure 2. The relative taxonomic distribution of various fungal (a) phyla (b) classes in each of the five management practices. MO—organic management; MI—conventional management; NP—natural pasture; FF—foliage management; OF—open field.
Land 14 00667 g002
Land 14 00667 g003
Figure 3. Venn diagram of fungal communities that shows the number of 97% sequence identities that were shared or not shared by the five different management practices. MO—organic management; MI—conventional management; NP—natural pasture; FF—foliage management; OF—open field.
Figure 3. Venn diagram of fungal communities that shows the number of 97% sequence identities that were shared or not shared by the five different management practices. MO—organic management; MI—conventional management; NP—natural pasture; FF—foliage management; OF—open field.
Land 14 00667 g003
Land 14 00667 g004aLand 14 00667 g004b
Figure 4. Beta diversity is represented by a principal coordinate analysis. This distance between points in the plot represents the similarity of species composition between the different points (sampling locations). A shorter distance between points represents higher similarity. MO—organic management; MI—conventional management; NP—natural pasture; FF—foliage management; OF—open field. (Significance differences: * < 0.05; NS—Non-Significant).
Figure 4. Beta diversity is represented by a principal coordinate analysis. This distance between points in the plot represents the similarity of species composition between the different points (sampling locations). A shorter distance between points represents higher similarity. MO—organic management; MI—conventional management; NP—natural pasture; FF—foliage management; OF—open field. (Significance differences: * < 0.05; NS—Non-Significant).
Land 14 00667 g004aLand 14 00667 g004b
Land 14 00667 g005
Figure 5. Redundancy analysis of beta diversity, including the following abiotic variables (soil properties): SM (soil moisture), OM (organic matter), EC (electrical conductivity) and pH. A longer arrow represents a stronger effect. MO—organic management; MI—conventional management; NP—natural pasture; FF—foliage management; OF—open field.
Figure 5. Redundancy analysis of beta diversity, including the following abiotic variables (soil properties): SM (soil moisture), OM (organic matter), EC (electrical conductivity) and pH. A longer arrow represents a stronger effect. MO—organic management; MI—conventional management; NP—natural pasture; FF—foliage management; OF—open field.
Land 14 00667 g005
Table 1. Sampling site locations.
Table 1. Sampling site locations.
Site NameLabelCoordination
Merom Golan Organic VineyardMO33°03′50.9″ N 35°45′10.6″ E
Merom-Golan Intensive Conventional VineyardMI33°03′29.5″ N 35°44′57.4″ E
Natural pastureNP33°03′44.4″ N 35°45′06.9″ E
Foliar fertilizationFF33°04′45.8″ N 35°46′21.8″ E
Open fieldOF33°04′45.6″ N 35°46′22.5″ E
Table 2. Estimated species richness (S. chao1), alpha diversity (S.ACE), and Shannon Index in soil samples under different management practices (MO—organic management; MI—conventional management; NP—natural pasture; FF—foliage management; OF—open field).
Table 2. Estimated species richness (S. chao1), alpha diversity (S.ACE), and Shannon Index in soil samples under different management practices (MO—organic management; MI—conventional management; NP—natural pasture; FF—foliage management; OF—open field).
Species RichnessShannon IndexS. Chao1S.ACE
MI234 ± 15.53 b4.04 ± 0.1 b313 ± 26.1 ab302 ± 17.7 bc
MO235 ± 17.21 b4.05 ± 0.12 b275 ± 23.0 b283 ± 19.5 c
OF269 ± 11.24 a4.22 ± 0.07 b343 ± 36.9 a345 ± 17.8 ab
FF209 ± 18.93 b3.72 ± 0.17 c274 ± 46.9 b281 ± 40.5 c
NP291 ± 17.47 a4.45 ± 0.12 a350 ± 32.4 a358 ± 22.9 a
The letters after the values represent statistically significant differences (p < 0.05) between the different managements.
Table 3. Results of the PERMANOVA applied to community composition under the different management practices.
Table 3. Results of the PERMANOVA applied to community composition under the different management practices.
DfSum of SquaresMean SquaresFR2Pr (>F)
Sample location41.440.3603.540.5860.0001
Residuals101.020.102 0.414
Total142.46 1.00
Table 4. Fungal trophic modes (%) assigned using FUNGuild (MO—organic management; MI—conventional management; NP—natural pasture; FF—foliage management; OF—open field).
Table 4. Fungal trophic modes (%) assigned using FUNGuild (MO—organic management; MI—conventional management; NP—natural pasture; FF—foliage management; OF—open field).
MOMINPFFOF
Pathotroph34.339.229.225.033.9
Saprotroph (SA)64.560.368.874.965.3
Symbiotroph (SY)1.20.52.00.10.8
SY/SA1.820.8102.950.1641.17
Table 5. Number of OTUs (OTU richness) in each of the trophic modes and confidence rankings according to FUNGuild (MO—organic management; MI—conventional management; NP—natural pasture; FF—foliage management; OF—open field).
Table 5. Number of OTUs (OTU richness) in each of the trophic modes and confidence rankings according to FUNGuild (MO—organic management; MI—conventional management; NP—natural pasture; FF—foliage management; OF—open field).
Trophic ModeConfidence RankingMOMINPFFOF
Unassigned 136125169107132
Unassigned% 3230.732.430.428.3
Saptotrophs% of total39.239.839.043.441.5
PathotrophHighly Probable45344
Possible5249593750
Probable4953763957
SaprotrophHighly Probable1314141614
Possible1019810391110
Probable10610015292124
SymbiotrophHighly Probable17916614
Possible7267786278
Probable111220515
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Rotbart, N.; Doniger, T.; Applebaum, I.; Steinberger, Y. Soil Fungal Communities in the Rhizosphere of Sauvignon Blanc Grapes Subjected to Various Agricultural Management Practices. Land 2025, 14, 667. https://doi.org/10.3390/land14040667

AMA Style

Rotbart N, Doniger T, Applebaum I, Steinberger Y. Soil Fungal Communities in the Rhizosphere of Sauvignon Blanc Grapes Subjected to Various Agricultural Management Practices. Land. 2025; 14(4):667. https://doi.org/10.3390/land14040667

Chicago/Turabian Style

Rotbart, Nativ, Tirza Doniger, Itaii Applebaum, and Yosef Steinberger. 2025. "Soil Fungal Communities in the Rhizosphere of Sauvignon Blanc Grapes Subjected to Various Agricultural Management Practices" Land 14, no. 4: 667. https://doi.org/10.3390/land14040667

APA Style

Rotbart, N., Doniger, T., Applebaum, I., & Steinberger, Y. (2025). Soil Fungal Communities in the Rhizosphere of Sauvignon Blanc Grapes Subjected to Various Agricultural Management Practices. Land, 14(4), 667. https://doi.org/10.3390/land14040667

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop