Next Article in Journal
Towards Participatory River Governance Through Citizen Science
Previous Article in Journal
Sea-Level Rise and Saltwater Intrusion: Economic Estimates of Impacts of Nature-Based Mitigation Policies Under Uncertainty
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Water
Volume 17
Issue 9
10.3390/w17091357
water-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Efficacy of a Novel Selection of Bacillus spp. on Reducing Off-Flavor Compounds and Improving Flesh Quality

by
Tianyu Liu
1,†,
Nattida Boonpeng
1,†,
Kang Li
1,2,3,*,
Li Yan
1,2,3,
Justice Frimpong Amankwah
1,2,3,
Kriengkrai Satapornvanit
4,
Russell Borski
5 and
Liping Liu
1,2,3,*
1
China-ASEAN Belt and Road Joint Laboratory of Mariculture Technology (Shanghai), Shanghai Ocean University, Shanghai 201306, China
2
Center for Ecological Aquaculture (CEA), Shanghai Ocean University, Shanghai 201306, China
3
Shanghai Engineering Research Center of Aquaculture, Shanghai Ocean University, Shanghai 201306, China
4
Department of Fishery Biology, Faculty of Fisheries, Kasetsart University, Chatuchak, Bangkok 10900, Thailand
5
Department of Biological Sciences, North Carolina State University, Raleigh, NC 27695-7617, USA
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Water 2025, 17(9), 1357; https://doi.org/10.3390/w17091357
Submission received: 26 March 2025 / Revised: 20 April 2025 / Accepted: 28 April 2025 / Published: 30 April 2025
(This article belongs to the Section Water, Agriculture and Aquaculture)
Browse Figures
Versions Notes

Abstract

Geosmin (GSM) and 2-methylisoborneol (2-MIB), microbial-derived terpenoid compounds prevalent in aquaculture systems, impair fillet quality and disrupt physiological homeostasis in aquatic species by inducing oxidative stress and lipid peroxidation. Despite their significant impact, effective strategies for eliminating these compounds from fish tissues remain underexplored. In this study, we employed primer-mediated PCR amplification to identify strains that produce 2-MIB and GSM and evaluated the efficacy of Bacillus licheniformis strain BL23 (BL23) in suppressing S. thermocarboxydus (ST), a key contributor to terpenoid synthesis. Experimental fish were allocated to three groups (n = 30 per group): Group C (control, standard feed), Group T1 (BL23-supplemented feed), and Group T2 (BL23 + ST coculture). Probiotic concentrations in the tanks were maintained at 106 CFU/mL under controlled conditions (30 °C). Tissue and aqueous samples were collected at intervals for the analysis of texture, growth performance, and terpenoid concentrations, with measurements in triplicate. Subsequently, B. licheniformis strain BL23 (BL23), which exhibits inhibitory effects against S. thermocarboxydus (ST) growth, was cultured and introduced into both fish specimens and aqueous systems. The outcomes of strain inoculation and cultivation experiments demonstrated the emergence of an inhibition zone surrounding the actinomycetes inoculated with BL23. The results from liquid coculture assays revealed a reduction in the concentration of ST from 106 CFU/mL at 48 h to 101 CFU/mL at 72 h post-coculture with BL23 for an initial 48 h period. An analysis of fish tissue and aqueous samples confirmed that BL23 exhibited a significant inhibitory effect on the growth of ST, leading to a substantial decrease in GSM content (p < 0.05). However, no statistically significant improvements were observed in fish growth performance (weight gain, feed conversion rate) or meat texture quality parameters (hardness, elasticity). These findings present a novel approach to mitigating geosmin-induced off-flavors in aquaculture products, highlighting its potential utility in water management and aquatic food production systems. The results are particularly pertinent for the development of biological control strategies targeting microbial-derived odorants in recirculating aquaculture systems.

1. Introduction

Aquaculture has consistently represented an important part of the global food supply and is projected to meet the progressively escalating demand for aquatic products in the forthcoming years [1]. While aquatic products are prized for their distinctive flavors, textures, and nutritional values [2,3], persistent challenges such as off-flavor contamination threaten their marketability and consumer acceptance [4,5]. Among the most pervasive off-flavor compounds are geosmin (GSM) and 2-methylisoborneol (2-MIB) [6,7], lipophilic metabolites produced by cyanobacteria and actinomycetes that accumulate in fish tissues via gill uptake [8]. These compounds not only affect fish flesh quality but also disrupt the physiological processes of fish [9]. Therefore, it is crucial for the aquaculture industry to seek appropriate methods for the removal of GSM and 2-MIB from water bodies.
Current remediation strategies, including activated carbon adsorption and electrochemical oxidation, face limitations such as high operational costs, incomplete contaminant removal, and unintended impacts on water chemistry. For instance, activated carbon requires frequent regeneration due to competitive adsorption of organic matter [10], while electrochemical methods risk generating toxic byproducts like chlorinated hydrocarbons, such as Ti/RuO2-Pt anodes with sodium chloride as a reactant [11]. Purge-out practices—transferring fish to clean water prior to harvest—partially reduce GSM/2-MIB levels but compromise growth performance and nutritional quality through prolonged fasting [12]. Many of these methods are costly and inefficient, potentially reducing the commercial value of aquatic products and even causing toxic effects.
Given the ecological and operational limitations of conventional remediation strategies, microbial regulation has emerged as a sustainable alternative for aquaculture systems [13]. Moreover, they improve water quality and offer multiple benefits to aquatic organisms, including enhanced pathogen resistance, the direct inhibition of pathogenic microorganisms, nutrient and enzyme provision, and enhanced feed utilization and growth [14,15,16]. Thus, microbial regulation represents a promising strategy for sustainable aquaculture.
A variety of potential probiotics, including bacteria, phages, fungi, and yeasts, have been explored for their applications in aquaculture [17,18,19]. Despite the availability of numerous beneficial probiotics, only a limited number are actively utilized in aquaculture settings. Notable examples include Bactocell (with P. acidilactici) [20] and Aquastar (containing a mixture of Lactobacillus reuteri, Bacillus subtilis, Enterococcus faecium, and Pediococcus acidilactici) [21]. Most probiotics employed for microbial management in aquaculture are derived from intestinal and soil isolates [22], functioning as biological agents to enhance water and sediment quality while improving breeding conditions for fish [23]. They have also shown efficacy in removing heavy metal contaminants, including copper, lead, cadmium, chromium, and arsenic, from aquatic environments [24]. Additionally, these probiotics serve as feed additives that help control bacterial infections in aquatic species, which will reduce the use of antibiotics and minimize antibiotic pollution to the greatest extent [25]. However, research on using probiotics to remove GSM and 2-MIB from water and fish tissues remains in its early stages.
This study aims to screen and identify a beneficial probiotic strain capable of controlling GSM and 2-MIB while evaluating its efficacy in fish culture. The findings may provide actionable insights for developing sustainable strategies to mitigate odor-related challenges in aquaculture production.

2. Materials and Methods

2.1. Ethic Statement

All fish were handled in accordance with the guidelines of the Animal Ethics Committee of Shanghai Ocean University (2016NO. 4) and the Regulations for the Administration of Affairs Concerning Experimental Animals, as approved and authorized by the State Council of the People’s Republic of China.

2.2. Screening and Identification of Bacillus Probiotic for the Inhibition of Actinomycete

The actinomycete strains Streptomyces roseoflavus (BNCC 228869), S. thermocarboxydus (BNCC 153409), and S. cyaneofuscatus (BNCC 152414), known producers of GSM and 2-MIB [26], were purchased from Bena Culture Collection (Beijing, China). Before the experiment, their ability to synthesize GSM and 2-MIB was verified with a biphasic method: (1) genetic confirmation via PCR amplification of the geoA (GenBank accession no. 14343900) and tpc (GenBank accession no. 24959779) genes using primers listed in Table 1, as well as (2) quantitative verification analysis using gas chromatography–mass spectrometry (GC–MS), following the established extraction procedures described below [27].
The previously screened probiotic (effective in RAS water quality improvement) was diluted 10−1 fold serially to 10−6 in sterile saline (0.85% NaCl). Aliquots (100 μL) were plated on Bacillus agar (Qingdao Hope Bio-Technology, Qingdao, China) and incubated at 37 °C for 24–48 h. Four single colonies were transferred on TSA plates (Shanghai Shengsi, Shanghai, China) and screened for actinomycete antagonism via spot assay. For spot assays, probiotics and Streptomyces strains (S. roseoflavus, S. thermocarboxydus, S. cyaneofuscatus) were cultured in TSB at 37 °C for 72 h [28]. Actinomycete lawns were swabbed on TSA, spotted with 10 μL probiotic cultures (triplicate), and incubated at 37 °C for 72 h. Strains showing ≥1 mm inhibition zones (no actinomycete growth) advanced to cross-streak screening.
In cross-streak screening [29], probiotics were streaked centrally on TSA plates, with three perpendicular actinomycete streaks. Plates were incubated at 37 °C, with inhibition zones evaluated at 24, 48, and 96 h (triplicate). Probiotics demonstrating sustained inhibition were selected for identification. The selected strains were identified based on culture characteristics as well as cellular morphology determined by the methods of Gram staining in Bergey’s Manual of Systematic Bacteriology (1994). Biochemical characterization was determined by carbohydrate substance metabolic profiling using API50 CHB medium (bioMérieux, Lyon, France).
BL23 was identified with 16S rRNA sequencing. The 16S rRNA gene of the probiotic was amplified using the primers in Table 1. DNA sequencing of the PCR amplicons was conducted by Sangon Biotech (Shanghai, China). Similarity searches were performed using BLAST software v2.2.25 (http://www.ncbi.nlm.nih.gov/BLAST/ (accessed on 3 Febuary 2025)). Multiple sequence alignment was conducted and a phylogenetic tree was constructed by the neighbor-joining method. The evolutionary history was inferred by using the maximum likelihood method following the Hasegawa–Kishino–Yano model [30]. Evolutionary analyses were conducted in Molecular Evolutionary Genetics Analysis Version 7.0 (MEGA7) [31].

2.3. Fish Culture Experiment

Tilapia (Oreochromis niloticus) were purchased from the Fish Hatchery of Guangdong, China, and were stocked in a fiberglass tank for 7 days and randomly allocated to three treatments, each of which had three 200 L tanks of 30 fish/tank. The average initial weight of Nile tilapia was approximately 25.00 ± 13.83 g. Tilapia were fed the same commercial feed. Different bacteria (T-1, BL23; T-2, BL23; and S. thermocarboxydus) were added to water tanks at a final concentration of 106 CFU/mL every 3 days, without bacteria added to the control tanks. The trial was carried out for 120 days. In this study, there was a separate recirculation system for every treatment. All fish were maintained at 30 °C with 50% water change every 3 days before the addition of bacteria. For water quality control, dissolved oxygen (DO) and temperature were continuously monitored, while ammonia, nitrite, nitrate, carbon dioxide, and pH were measured weekly to ensure optimal water quality C. The dissolved oxygen level was maintained above 6.0 mg/L by setting the air pump. Fish were fed twice daily at 08:00 h and 18:00 h. The daily feeding rate was about 3% of total body weight (g) and was adjusted based on the actual intake of tilapia (Figure 1).
Each month, before GSM and 2-MIB analysis of the fish fillets, tilapia growth parameters were measured, including:
(1)
Specific growth rate (SGR) = 100 × In (Final weight) − In (Initial weight)/Culturing days.
(2)
Feed conversion ratio (FCR) = Total feed given (g)/Total weight gained (g).
(3)
Average daily gain (ADG) = Weight gain (g)/Culturing days.
(4)
Weight gain (WG) = Final weight (g) − Initial weight (g).
(5)
Survival rate (SR) (%) = 100 × (Number of fish harvested/Number of fish stocked).

2.4. Water Quality Determination

The total ammonia nitrogen (TAN), nitrite (NO2-N), and nitrate (NO3-N) were computed by using grab samples filtered through a 0.45 μm filter. The TAN level in water quality was determined using the method of Molayemraftar [32]. Nitrite nitrogen (NO2-N) was examined by using spectrophotometry, and nitrate nitrogen (NO3-N) was examined by using sulfamic acid ultraviolet spectrophotometry.

2.5. Texture Measurement of Fish Flesh

Texture measurements for fish and fish products are important in fish quality control and product development in the seafood industry. Muscle samples were collected from six live fish per treatment, selecting fillets from the left side of each fish for quality assessment using a texture analyzer (Universal TA, Shanghai China). The skin was removed, and four squares of fish muscle, each measured in centimeters (1 cm × 1 cm), were excised from the area near the lateral line. Hardness (g), springiness (mm), cohesiveness, stickiness (g), chewiness (g × mm), and resilience were evaluated. These parameters were analyzed using the Exponent Connect software (https://texturetechnologies.com/software/exponent (accessed on 3 Febuary 2025), QCTech, Hutto, TX, USA).

2.6. Extraction and Determination of GSM and 2-MIB Concentration

2.6.1. Sample Preparation

Bacteria were cultured in TSB medium at 37 °C in a shaking incubator. After the culture was completed, cells were collected by centrifugation (2000× g), washed three times with phosphate-buffered saline (PBS, pH 7.2, Sangon Biotech, Shanghai, China), and then resuspended in the same buffer before use.
Fish (six per group) were taken from each treatment group, stunned, skinned, and filleted. The right and left muscle tissues were separately collected, and approximately 5 g of fish meat was excised, placed in plastic tubes, and stored at −80 °C. Before analysis, the frozen fish samples were thawed and homogenized intermittently using a blender for the analysis of GSM and 2-MIB by microwave distillation (MD) and gas chromatography–mass spectrometry (GC–MS). Simultaneously, approximately 5 g of fish meat was thawed, minced, and placed in a 100 mL bottle, followed by the addition of 45 mL of 200 g/L sodium chloride and 5 g of calcium chloride. The mixture was homogenized for sensory analysis and texture testing [33].
A total of 50 mL of actinomycete culture, known to produce characteristic odors associated with GSM and 2-MIB, was added to a 100 mL vial containing 10 g of sodium chloride and 5 g of calcium chloride. Prior to use, both sodium chloride and calcium chloride were baked at 450 °C for 4 h to remove impurities and ensure an anhydrous state. The vials were processed using a custom-built microwave distillation apparatus (model: KD21C-AN, Media). The experimental parameters are set as follows: microwave power of 800 W, distillation time of 2 min, condenser temperature maintained at 0 °C by a circulating refrigeration device, temperature controller set at 120 °C; nitrogen purge flow rate of 25 mL/min. After starting the microwave program, the liquid fraction was collected in a glass vial for further analysis.

2.6.2. Purge and Trap (P&T)

The P&T system was carried out with a Lumin P&T concentrator (Teledny Tekmar Lumin, Analysen Antec- und Prozesstechnik Company, Sindelsdorf, Germany). Target compounds were purged from 50 mL of distillate and absorbed onto the trap for 11 min. High-purity nitrogen (99.99%) was used as the purge gas at a flow rate of 40 mL/min. The trap temperature was maintained at 20 °C during purging. The trapped components were then desorbed using helium for 4 min and subsequently transferred directly to the GC system. The water manager temperature was set at 80 °C. During the desorption step, the trap temperature was set at 195 °C (with pre-desorption at 185 °C). To clean the purge system, the trap was baked for 10 min. During this baking step, the water manager temperature was set at 240 °C and the trap temperature was set at 215 °C.

2.6.3. Gas Chromatography–Mass Spectrometry (GC–MC)

GSM and 2-MIB analysis of fish samples and bacterial samples were performed using a GC–MS machine (GC system7890B and MSD 5977A, Agilent Technologies, Santa Clara, CA, USA) operated with an HP-5MS UI column (30 m × 0.25 mm × 0.25 µm; Agilent Technologies). The injection temperature was maintained at 220 °C. Helium was used as the carrier gas at a constant flow rate of 1 mL/min. The oven temperature was held at 50 °C for 1 min from injection and raised to 240 °C at 20 °C/min. The final temperature was set at 280 °C and maintained for 3 min. Electron ionization was performed at 70 eV, and the source and GC interface temperatures were set at 230 °C and 280 °C, respectively. The solvent cut time was 5 min, and the selected ion mode (SIM) was adopted. All other parameters were defined by automatic tuning.
Standard GSM and 2-MIB solutions (Supelco, Bellefonte, PA, USA) were used to determine the molecular ion base peaks and retention time. The monitored m/z values were 112, 126, and 182 for GSM and 95, 135, and 168 for 2-MIB

2.7. Statistical Analysis

The survival rates for the pathogenicity of the probiotic were tested by one-way ANOVA. The significance of the differences among all treatments was tested using the Duncan multiple range test at p < 0.05. All statistical analyses were performed with IBM SPSS Statistics v.22 (SPSS, Inc., Chicago, IL, USA).

3. Result

3.1. Confirmation of Streptomyces spp.

All actinomycetes exhibited an earthy/muddy odor in the olfaction test and were confirmed to synthesize either GSM or 2-MIB through both GC–MS and PCR analysis. The results are shown in Table 2. S. roseoflavus, S. thermocarboxydus, and S. cyaneofuscatus produced GSM, and all three species possessed the GSM biosynthetic gene, which can be verified by gel electrophoresis.
The partial nucleotide sequence of geoA in S. roseoflavus shared 98.99% identity with geoA from S. fradiae strain NKZ-259 and S. alfalfae strain ACCC40021. S. thermocarboxydus shared 97.04% identity with geoA from S. griseorubens strain iafE. S. cyaneofuscatus shared 99.05% identity with geoA from S. fradiae strain NKZ-259. Among the tested actinomycetes, S. roseoflavus was the only strain that also produced 2-MIB and possessed the 2-MIB synthase gene (tpc) (Table 2). The nucleotide sequence of tpc in S. roseoflavus shared 99.28% identity with tpc from S. fradiae strain NKZ-259 and S. alfalfae strain ACCC40021.

3.2. Selection and Characterization of Probiotics

The colonies obtained by spot inoculation showed the inhibition zones of BL23 against ST and SC, indicating that BL23 had inhibitory effects on both SC and ST strains. When BL23 was cross-streaked and inoculated into the growth areas of the three longitudinal actinomycetes colonies, the results showed that BL23 exhibited continuous inhibitory effects on both SC and ST strains (Figure 2A).
The antagonistic activity of the BL23 strain against S. thermocarboxydus was tested in a liquid co-culture experiment (Figure 2B). When S. thermocarboxydus was cultured alone, its concentration increased from 102 CFU/mL to 10⁵ CFU/mL within 24 h (Figure 2D) and remained stable for the next 120 h before gradually decreasing. In contrast, when co-cultured with BL23, S. thermocarboxydus significantly decreased after 48 h. Its concentration dropped from 106 CFU/mL at 48 h to 10 CFU/mL at 72 h. After that, its concentration remained at a low level throughout the remaining 240 h culture period. Compared with the single culture, the level of S. thermocarboxydus was significantly reduced when co-cultured with BL23 (p < 0.05). The concentration of BL23 increased from 102 CFU/mL to 1014 CFU/mL within 144 h under both single culture and co-culture conditions. After 144 h, its concentration gradually decreased until the end of the 240 h experiment, regardless of the culture condition (Figure 2C).
The BL23 isolate exhibited a bacillus morphology, and its facultative anaerobic colonies were circular in shape, with a diameter of 2–3 mm. Moreover, the colonies exhibited a pink-red color and tested positive for both catalase and oxidase activity. BL23 was identified as a Gram-positive, motile rod. The API biochemical identification system confirmed BL23 as B. licheniformis with a high identification percentage of 99.7%.
The partial 16S rRNA sequence of BL23 was submitted to GenBank (Accession MT229352) and subjected to BLAST and phylogenetic analyses. The partial 16S rRNA gene sequence of BL23 showed 99% similarity to various members of the Bacillus genus (Figure 2), B. licheniformis BCRC 11702 (NR116023), B. licheniformis DSM 13 (AAU39593), B. haynesii NRRL B-41327 (MRBL01000076), and B. paralicheniformis KJ-16 (LBMN01000156), with the highest similarity to B. licheniformis strain BCRC 11702. Based on this, a phylogenetic tree was constructed using the maximum likelihood method as shown in Figure 3. On the basis of the 16S rRNA sequence and biochemical and morphological characteristics, the BL23 isolate was identified as B. licheniformis BL23.

3.3. Growth Performance of Tilapia

The growth performance results of tilapia (O. niloticus) treated with ST (treatment 1), ST and BL23 (treatment 2), and without ST and BL23 (control) are presented in Table 3. In the case of initial weight and SR, no significant differences (p > 0.05) were observed in this present study. At the end of the feeding trial, fish treated with ST and BL23 (treatment 2) as water additives had significantly (p < 0.05) higher final weight, SGR, ADG, and WG compared with those treated with ST (treatment 1). However, there was no remarkable difference (p > 0.05) compared to the control.

3.4. Texture of Fish Flesh

Compared to the control group (Table 4), T1 and T2 showed no significant differences in muscle hardiness (p > 0.05). No significant differences were observed in springiness, cohesiveness, or resilience (p > 0.05). However, the control group and T2 had significantly higher muscle stickiness and chewiness compared to T1 (p < 0.05).

3.5. Water Quality

No notable differences in the water quality parameters were observed between the probiotic treatment and control groups (Figure 4, Figure 5 and Figure 6). The average ammonia–nitrogen level in all tanks ranged from 0.029 to 0.190 mg/L, which falls within the acceptable limits for tilapia culture. The highest ammonia–nitrogen level was obtained in the control without probiotics at 0.190 mg/L, whereas the lowest level obtained in treatment 2 with BL23 and ST was 0.0294 mg/L. Similarly, the average nitrite level in all tanks ranged from 0.010 to 0.026 mg/L, also within the tilapia tolerance limit. The highest reactive nitrite level was recorded in the control without BL23 and ST at 0.026 mg/L, whereas the lowest level was obtained in treatment 2 with BL23 and ST at 0.010 mg/L. The average nitrate levels in all tanks ranged from 0.103 to 0.167 mg/L, which fall within the limits of tilapia tolerance. The highest and lowest reactive nitrate levels were recorded in the control group without BL23 and ST.

3.6. GSM and 2-MIB Concentration in Fish and Water

A quantitative determination of GSM content in fish and water samples was conducted using microwave distillation (MD) coupled with GC–MS. Statistical analysis and graphical representation using SPSS revealed the following results (Figure 7). In fish samples, GSM levels in experimental groups T1 and T2 exhibited significant reduction (p < 0.05, F (2,6) = 1541), with the co-treatment group T2 (ST combined with BL23) demonstrating a more pronounced decrease compared to the other groups. For water samples, significant differences (p < 0.05, F (2,6) = 75.24) were observed between experimental group T1 and other groups, while treatment group T2 showed no statistically significant differences compared to the control group.
The quantitative determination of 2-MIB content in fish and water samples was conducted using microwave distillation (MD) coupled with GC–MS. Statistical analysis and graphical representation using SPSS revealed the following results (Figure 8). In fish samples, the 2-MIB content in experimental groups T1 and T2 (ST combined with BL23) showed a significant increase compared to the control group, with a statistically significant difference (p < 0.05, F (2,6) = 62.46). In the water samples, no statistically significant differences were observed among the three groups.

4. Discussion

In this study, a BL23 probiotic strain was isolated that could significantly inhibit the growth of ST. After cultivation, the colonies were pink in color and 2–3 mm in size, and single colonies were round with protrusions. The 16S rRNA measurement results showed that the partial 16S rRNA gene sequence of BL23 exhibited 99% similarity with multiple members of the Bacillus genus. Based on the 16S rRNA sequence as well as the biochemical and morphological characteristics, the BL23 isolated strain was identified as B. licheniformis BL23. The results of co-culturing colonies indicated that BL23 could effectively and continuously inhibit the growth of Streptomyces. In the research on the degradation of exogenous substances by probiotics, several studies have demonstrated their potential. For instance, probiotics have been shown to alleviate heavy metal toxicity in fish [34], degrade pollutants such as pesticides through hydrolytic enzymes [35], and metabolize antibiotics in the intestinal tract [36]. In terms of GSM substances, certain bacteria can utilize GSM as a sole organic carbon source for normal metabolism [37,38], with similar findings reported for 2-MIB [39]. These metabolic processes are capable of effectively eliminating these compounds that give rise to odors.
Quantitative analysis revealed significant reductions in GSM levels across experimental groups. In fish samples, GSM concentrations in treatment groups T1 and T2 exhibited statistically significant decreases (p < 0.05), with the combined ST and BL23 treatment (T2) demonstrating a more pronounced reduction. Water sample analysis showed marked differences between T1 and other groups (p < 0.05), while T2 displayed no significant deviation from the control group. These results suggest that BL23 at a certain concentration effectively suppresses actinomycete populations responsible for GSM biosynthesis and enhances GSM degradation. Supporting this mechanism, Ma et al. have previously confirmed that B. subtilis has a strong ability to degrade GSM [40]. When applied to water bodies or fed through formulated feed, it may help to inhibit the production of Streptomyces and GSM.
The results indicated that BL23 probiotics were more effective in reducing the level of GSM but had a limited effect on 2-MIB. Previous studies have shown that S. caelestis of the Streptomyces genus is the main producer of 2-MIB in Fengsheng Waterworks (FSW) in southern Taiwan [41], while cyanobacteria [42], actinomycetes [43], and fungi [44] have also been reported as the main producers of 2-MIB in freshwater systems. The strains used in this study, S. roseoflavus, S. thermocarboxydus, and S. cyaneofuscatus, may differ from the actual strains responsible for 2-MIB production in natural water bodies, which could explain the insignificant inhibitory effect of BL23. Therefore, future studies ought to place emphasis on isolating 2-MIB-producing bacteria from natural water environments to better verify the efficacy of BL23.
Although this study investigated the degradation pathways of GSM and 2-MIB by BL23, as previously reported [45], when there is a co-metabolic carbon source, probiotics belonging to the genus B. idriensis can be promoted to produce enzymes for degrading 2-MIB. Ganegoda, Sathya S. et al. [46] also pointed out that B. subtilis can degrade GSM and 2-MIB within a relatively short period of time, indicating that the BL23 used in this study may also degrade GSM and 2-MIB through a similar pathway as B. subtilis. This is consistent with the viewpoint of this study. Meanwhile, the exploration of the metabolic pathways of GSM and 2-MIB is relatively scarce at present. Relevant experiments will be conducted in the future for further investigation.
Microbial agents hold significant potential for aquaculture applications through dual mechanisms: water quality modulation [47] and the enhancement of antioxidant stress immunity [48]. Additional benefits include the improvement of meat quality [49] and their utility as functional feed additives [50,51]. Under this research framework, we systematically investigated the effects of BL23 probiotics on the growth performance, meat quality parameters, and water quality indicators of fish in recirculating aquaculture systems. This study revealed no significant disparities in the textural attributes of fish flesh between the control group and treatment groups, particularly regarding hardness. In contrast, Cao demonstrated that dietary supplementation with 1 g/kg β-glucan (BG) and 1 × 109 CFU/kg Bacillus spp. (BS) significantly enhanced multiple textural parameters, including hardness, springiness, cohesiveness, gumminess, chewiness, and resilience, compared to the unsupplemented controls [52]. Notably, our findings diverge from previous studies, as the aqueous supplementation of ST and BL23 additives exhibited no measurable improvement in tilapia growth performance.
The lack of a growth-promoting effect observed in this study may primarily be attributed to two key factors. First, the aqueous delivery method likely diluted BL23 concentrations, reducing nutrient absorption efficiency compared to feed-based administration. Secondly, the applied BL23 dose (106 CFU/mL) may have been suboptimal for enhancing nutrient digestive efficiency, as prior work demonstrates growth benefits typically require higher concentration (108–1012 CFU/kg in feed) [50], while that for application to water tends to be higher. The effective concentration of BL23 against S. thermocarboxydus and S. cyaneofuscatus was evaluated here. For BL23, a 105 CFU/mL concentration clearly inhibited S. thermocarboxydus and S. cyaneofuscatus grown at high concentrations (108 CFU/mL). Moreover, we found that BL23 at 106 CFU/mL could reduce the S. thermocarboxydus by 105 CFU/mL within 1 h in broth co-culture. These concentrations of BL23 fall below the effective range found with Bacillus species in a previous work where it was applied to water. B. subtilis B10, B. coagulans B16, and Rhodopseudomonas palustris G06 applied on alternate days at a final concentration of 107 CFU/mL were shown to improve growth performance, serum biochemical profiles, and immune response of tilapia [53]. Other studies show that the application of a mixture of Bacillus species, including B. licheniformis, to RAS water improves the innate immune response and stress tolerance of yellow perch subjected to hypoxia and air-exposure stress [54]. For instance, Tachibana reported that the dietary incorporation of 0.04–0.08% Bacillus blends (B. subtilis and B. licheniformis) enhanced growth metrics and gut microbiota modulation—effects that were absent in our aqueous-delivery model [55]. However, these mechanistic interpretations remain provisional, as the study design did not include direct dose-response assessments or feeding-route comparisons. This represents a key limitation, as the relative contributions of delivery method versus probiotic concentration cannot be disentangled without controlled factorial experimentation. Future studies should systematically evaluate probiotic dosing thresholds and administration routes to optimize both off-flavor reduction and growth benefits.
Multiple factors could explain the absence of performance differences in this study: (1) insufficient evaluation duration to manifest cumulative probiotic effects; (2) inadequate probiotic concentrations to trigger physiological responses; and (3) potential nutrient competition or inhibitory metabolite production in aquaculture systems. Notably, extraneous probiotic interactions in aqueous environments might attenuate their nutritional enhancement capabilities [56]. Additionally, high-density aquaculture conditions known to adversely affect survival rates, growth parameters, and production yields could have further confounded these results [57,58].
In this study, BL23 was applied to the rearing of Nile tilapia, and its removal effects of GSM and 2-MIB were investigated. However, this article was conducted only in the RAS and not in other aquaculture water bodies, so this section discusses the applicability under different rearing conditions. In the research by Opiyo, Mary A. Naiel et al., Bacillus subtilis with a concentration of 1 × 109 CFU g−1 was applied to the rearing of tilapia under the condition of an average water temperature of 25.40 °C and pH value of 8.06 in a pond environment [59]. It was found that it significantly promoted the growth and improved the body composition of tilapia, and it was concluded that the dose of 10 g/kg was the best for tilapia performance. Mohammed A.E. et al. [48] conducted research by applying Geobacillus stearothermophilus probiotic strains with concentrations of 1 or 2 × 105 CFU/mL in a closed water tank environment with water temperatures ranging from 26 to 28 °C and pH values ranging from 7 to 7.4, and found that it promoted the growth and health status of tilapia.
Recent studies regarding the ability of probiotics to enhance the antioxidant capacity and immune responses of fish have indicated that probiotics stimulate digestive enzyme activity through enzymatic production, thereby improving nutrient assimilation [60]. Furthermore, probiotic supplementation has been shown to enhance antioxidant defenses in grass carp (Ctenopharyngodon idella) [61] while exerting beneficial effects on mucosal immunity [62]. This study revealed that the aqueous administration of BL23 and ST additives in recirculating aquaculture systems (RAS) exhibited no measurable impacts on fish growth performance, water quality parameters, or flesh quality. The potential benefits of antioxidant capacity and immune modulation remain to be investigated. Notably, BL23 supplementation at 105 CFU/mL failed to improve fish yield or water quality in RAS. However, BL23 administration demonstrated water quality regulation capabilities during aquaculture operations.

5. Conclusions

This study focused on identifying and screening the BL23 strain by setting up three experimental groups in the RAS. Among the four strains isolated from the probiotic mixture, only BL23 showed an inhibition zone during preliminary screening. It was confirmed that BL23 had antibacterial properties against two actinomycetes, namely S. thermocarboxydus and S. cyaneofuscatus, while showing no effect on S. roseoflavus. Additionally, the study explored the effects of ST and BL23 on GSM removal, fish growth performance, and fish meat quality. The results revealed that supplementation with BL23 and ST did not significantly influence aquaculture performance, water quality parameters, or fish meat quality. While further research is needed to explore additional potential benefits, these findings provide valuable insights for the development of antibiotic alternatives in aquaculture practices and the improvement of seafood quality standards.

Author Contributions

Conceptualization, L.L. and K.L.; formal analysis, T.L. and N.B.; funding acquisition, L.L.; investigation, N.B.; methodology, R.B., L.Y., and K.S.; resources, K.L. and L.L.; supervision, K.L, J.F.A., R.B., K.S., L.Y., and L.L.; visualization, N.B.; writing—original draft, T.L., N.B.; writing—review and editing, K.L. and L.L. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by the National Key Research and Development Program of China: 2022YFE0203900; National Key Research and Development Program of China: 2023YFD2400504; the High-End Foreign Experts Recruitment Program: G2023013033L.

Institutional Review Board Statement

The handling and culture of the animals used in this research study were carried out in compliance with the guidelines established by the Animal Ethics Committee of Shanghai Ocean University (Shanghai, China), following the approved protocol numbers SHOU-DW-2020-017.

Informed Consent Statement

Not applicable.

Data Availability Statement

The datasets generated and/or analyzed during this current study are not publicly available owing to security protocols and privacy regulations but they may be made available on reasonable request to the corresponding author.

Acknowledgments

We would like to express our gratitude to Jun-ming Zhang, Huan Han, Xiangbiao Zeng and Zhenzhu Wei for providing revision suggestions and assistance for this article.

Conflicts of Interest

The authors declare that the research article titled “The Efficacy of a Novel Selection of Bacillus spp. on Reducing Off-Flavor Compounds and Improving Flesh Quality” does not have any conflicts of interest.

References

  1. Lindholm-Lehto, P.C.; Vielma, J.; Pakkanen, H.; Alén, R. Depuration of geosmin- and 2-methylisoborneol-induced off-flavors in recirculating aquaculture system (RAS) farmed European whitefish Coregonus lavaretus. J. Food Sci. Technol. 2019, 56, 4585–4594. [Google Scholar] [CrossRef] [PubMed]
  2. Cai, J.; Leung, P. Unlocking the potential of aquatic foods in global food security and nutrition: A missing piece under the lens of seafood liking index. Glob. Food Secur. 2022, 33, 100641. [Google Scholar] [CrossRef]
  3. Solarin, S.A. Convergence of aquatic products consumption: A disaggregated analysis in European countries. Mar. Policy 2024, 165, 106192. [Google Scholar] [CrossRef]
  4. Liato, V.; Aïder, M. Geosmin as a source of the earthy-musty smell in fruits, vegetables and water: Origins, impact on foods and water, and review of the removing techniques. Chemosphere 2017, 181, 9–18. [Google Scholar] [CrossRef]
  5. Lindholm-Lehto, P.C.; Vielma, J. Controlling of geosmin and 2-methylisoborneol induced off-flavours in recirculating aquaculture system farmed fish—A review. Aquac. Res. 2019, 50, 9–28. [Google Scholar] [CrossRef]
  6. Angioni, A.; Cau, A.; Addis, P. Gas Chromatographic Mass Spectrometry Determination of Geosmin and 2-methylisoborneol Off-Flavor in Mugil cephalus Roe. Food Anal. Methods 2015, 8, 1484–1489. [Google Scholar] [CrossRef]
  7. Nam-Koong, H.; Schroeder, J.P.; Petrick, G.; Schulz, C. Removal of the off-flavor compounds geosmin and 2-methylisoborneol from recirculating aquaculture system water by ultrasonically induced cavitation. Aquac. Eng. 2016, 70, 73–80. [Google Scholar] [CrossRef]
  8. Yuan, B.; Xu, D.; Li, F.; Fu, M.-L. Removal efficiency and possible pathway of odor compounds (2-methylisoborneol and geosmin) by ozonation. Sep. Purif. Technol. 2013, 117, 53–58. [Google Scholar] [CrossRef]
  9. Han, H.; Zhang, J.-M.; Ji, S.; Zeng, X.-B.; Jin, X.-C.; Shen, Z.-Q.; Xie, B.; Luo, X.-N.; Li, K.; Liu, L.-P. Histology and transcriptomic analysis reveal the inflammation and affected pathways under 2-methylisoborneol (2-MIB) exposure on grass carp. Sci. Total Environ. 2024, 938, 173233. [Google Scholar] [CrossRef]
  10. Cook, D.; Newcombe, G.; Sztajnbok, P. The application of powdered activated carbon for mib and geosmin removal: Predicting pac doses in four raw waters. Water Res. 2001, 35, 1325–1333. [Google Scholar] [CrossRef]
  11. Li, M.; Xue, Q.; Zhang, Z.; Feng, C.; Chen, N.; Lei, X.; Shen, Z.; Sugiura, N. Removal of geosmin (trans-1,10-dimethyl-trans-9-decalol) from aqueous solution using an indirect electrochemical method. Electrochim. Acta 2010, 55, 6979–6982. [Google Scholar] [CrossRef]
  12. Schrader, K.K.; Davidson, J.W.; Rimando, A.M.; Summerfelt, S.T. Evaluation of ozonation on levels of the off-flavor compounds geosmin and 2-methylisoborneol in water and rainbow trout Oncorhynchus mykiss from recirculating aquaculture systems. Aquac. Eng. 2010, 43, 46–50. [Google Scholar] [CrossRef]
  13. Olmos, J.; Acosta, M.; Mendoza, G.; Pitones, V. Bacillus subtilis, an ideal probiotic bacterium to shrimp and fish aquaculture that increase feed digestibility, prevent microbial diseases, and avoid water pollution. Arch. Microbiol. 2020, 202, 427–435. [Google Scholar] [CrossRef] [PubMed]
  14. Hoseinifar, S.H.; Sun, Y.Z.; Wang, A.; Zhou, Z. Probiotics as Means of Diseases Control in Aquaculture, a Review of Current Knowledge and Future Perspectives. Front. Microbiol. 2018, 9, 2429. [Google Scholar] [CrossRef]
  15. Kuebutornye, F.K.A.; Abarike, E.D.; Lu, Y. A review on the application of Bacillus as probiotics in aquaculture. Fish Shellfish Immunol. 2019, 87, 820–828. [Google Scholar] [CrossRef]
  16. Van Doan, H.; Hoseinifar, S.H.; Ringø, E.; Ángeles Esteban, M.; Dadar, M.; Dawood, M.A.O.; Faggio, C. Host-Associated Probiotics: A Key Factor in Sustainable Aquaculture. Rev. Fish. Sci. Aquac. 2020, 28, 16–42. [Google Scholar] [CrossRef]
  17. Hai, N.V. The use of probiotics in aquaculture. J. Appl. Microbiol. 2015, 119, 917–935. [Google Scholar] [CrossRef]
  18. Newaj-Fyzul, A.; Austin, B. Probiotics, immunostimulants, plant products and oral vaccines, and their role as feed supplements in the control of bacterial fish diseases. J. Fish Dis. 2015, 38, 937–955. [Google Scholar] [CrossRef]
  19. Verschuere, L.; Rombaut, G.; Sorgeloos, P.; Verstraete, W. Probiotic Bacteria as Biological Control Agents in Aquaculture. Microbiol. Mol. Biol. Rev. 2000, 64, 655–671. [Google Scholar] [CrossRef]
  20. Fugaban, J.I.I.; Vazquez Bucheli, J.E.; Park, Y.J.; Suh, D.H.; Jung, E.S.; Franco, B.D.G.d.M.; Ivanova, I.V.; Holzapfel, W.H.; Todorov, S.D. Antimicrobial properties of Pediococcus acidilactici and Pediococcus pentosaceus isolated from silage. J. Appl. Microbiol. 2022, 132, 311–330. [Google Scholar] [CrossRef]
  21. Standen, B.T.; Rodiles, A.; Peggs, D.L.; Davies, S.J.; Santos, G.A.; Merrifield, D.L. Modulation of the intestinal microbiota and morphology of tilapia, Oreochromis niloticus, following the application of a multi-species probiotic. Appl. Microbiol. Biotechnol. 2015, 99, 8403–8417. [Google Scholar] [CrossRef] [PubMed]
  22. Govindaraj, K.; Samayanpaulraj, V.; Narayanadoss, V.; Uthandakalaipandian, R. Isolation of Lactic Acid Bacteria from Intestine of Freshwater Fishes and Elucidation of Probiotic Potential for Aquaculture Application. Probiotics Antimicrob. Proteins 2021, 13, 1598–1610. [Google Scholar] [CrossRef] [PubMed]
  23. Zorriehzahra, M.J.; Delshad, S.T.; Adel, M.; Tiwari, R.; Karthik, K.; Dhama, K.; Lazado, C.C. Probiotics as beneficial microbes in aquaculture: An update on their multiple modes of action: A review. Vet. Q. 2016, 36, 228–241. [Google Scholar] [CrossRef] [PubMed]
  24. Zoghi, A.; Khosravi-Darani, K.; Sohrabvandi, S. Surface binding of toxins and heavy metals by probiotics. Mini Rev. Med. Chem. 2014, 14, 84–98. [Google Scholar] [CrossRef]
  25. Pereira, W.A.; Mendonça, C.M.N.; Urquiza, A.V.; Marteinsson, V.Þ.; LeBlanc, J.G.; Cotter, P.D.; Villalobos, E.F.; Romero, J.; Oliveira, R.P.S. Use of Probiotic Bacteria and Bacteriocins as an Alternative to Antibiotics in Aquaculture. Microorganisms 2022, 10, 1705. [Google Scholar] [CrossRef]
  26. Rurangwa, E.; Verdegem, M.C.J. Microorganisms in recirculating aquaculture systems and their management. Rev. Aquac. 2015, 7, 117–130. [Google Scholar] [CrossRef]
  27. Gharti, K.; Yan, L.; Li, K.; Boonpeng, N.; Liu, L. Growth and Muscle Quality of Grass Carp (Ctenopharyngodon idella) in In-Pond Raceway Aquaculture and Traditional Pond Culture. Water 2023, 15, 1771. [Google Scholar] [CrossRef]
  28. De Martinis, E.C.; Públio, M.R.; Santarosa, P.R.; Freitas, F.Z. Antilisterial activity of lactic acid bacteria isolated from vacuum-packaged Brazilian meat and meat products. Braz. J. Microbiol. 2001, 32, 32–37. [Google Scholar] [CrossRef]
  29. Rahman, M.A.; Islam, M.Z.; Islam, M.A.U. Antibacterial Activities of Actinomycete Isolates Collected from Soils of Rajshahi, Bangladesh. Biotechnol. Res. Int. 2011, 2011, 857925. [Google Scholar] [CrossRef]
  30. Hasegawa, M.; Kishino, H.; Yano, T.-a. Dating of the human-ape splitting by a molecular clock of mitochondrial DNA. J. Mol. Evol. 1985, 22, 160–174. [Google Scholar] [CrossRef]
  31. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed]
  32. Molayemraftar, T.; Peyghan, R.; Razi Jalali, M.; Shahriari, A. Single and combined effects of ammonia and nitrite on common carp, Cyprinus carpio: Toxicity, hematological parameters, antioxidant defenses, acetylcholinesterase, and acid phosphatase activities. Aquaculture 2022, 548, 737676. [Google Scholar] [CrossRef]
  33. Wang, Z.; Xu, Y.; Shao, J.; Wang, J.; Li, R. Genes associated with 2-methylisoborneol biosynthesis in cyanobacteria: Isolation, characterization, and expression in response to light. PLoS ONE 2011, 6, e18665. [Google Scholar] [CrossRef] [PubMed]
  34. Giri, S.S.; Kim, H.J.; Jung, W.J.; Bin Lee, S.; Joo, S.J.; Gupta, S.K.; Park, S.C. Probiotics in addressing heavy metal toxicities in fish farming: Current progress and perspective. Ecotoxicol. Environ. Saf. 2024, 282, 116755. [Google Scholar] [CrossRef]
  35. Mohammadi, M.; Shadnoush, M.; Sohrabvandi, S.; Yousefi, M.; Khorshidian, N.; Mortazavian, A.M. Probiotics as potential detoxification tools for mitigation of pesticides: A mini review. Int. J. Food Sci. Technol. 2021, 56, 2078–2087. [Google Scholar] [CrossRef]
  36. He, Q.; Lin, Z.; Zhang, X.; Qin, M.; Huang, Y.; Liao, X.; Liu, Y.; Ren, H.; Sun, J. Designing a reengineered probiotic yeast to spontaneously degrade residual antibiotics in gut during antimicrobial therapy. J. Clean. Prod. 2024, 483, 144177. [Google Scholar] [CrossRef]
  37. Xue, Q.; Shimizu, K.; Sakharkar, M.K.; Utsumi, M.; Cao, G.; Li, M.; Zhang, Z.; Sugiura, N. Geosmin degradation by seasonal biofilm from a biological treatment facility. Environ. Sci. Pollut. Res. 2012, 19, 700–707. [Google Scholar] [CrossRef]
  38. Zhou, B.; Yuan, R.; Shi, C.; Yu, L.; Gu, J.; Zhang, C.J.J.o.E.S. Biodegradation of geosmin in drinking water by novel bacteria isolated from biologically active carbon. J. Environ. Sci. 2011, 23, 816–823. [Google Scholar] [CrossRef]
  39. Lauderdale, C.V.; Aldrich, H.C.; Lindner, A.S. Isolation and characterization of a bacterium capable of removing taste- and odor-causing 2-methylisoborneol from water. Water Res. 2004, 38, 4135–4142. [Google Scholar] [CrossRef]
  40. Ma, N.; Luo, G.; Tang, H.; Yao, M.; Wang, X. Kinetic Characteristics of Degradation of Geosmin and 2-Methylisoborneol by Bacillus subtilis (in Chinese with English abstract). Environ. Sci. 2015, 36, 1379–1384. [Google Scholar] [CrossRef]
  41. Tung, S.C.; Lin, T.F.; Tseng, I.C.; Lin, H.M. Identification of 2-MIB and geosmin producers in Feng-Shen reservoir in south Taiwan. Water Supply 2006, 6, 55–61. [Google Scholar] [CrossRef]
  42. Butakova, E.A. Specific features of odor-causing compounds (geosmin and 2-methylisoborneol) as secondary metabolites of cyanobacteria. Russ. J. Plant Physiol. 2013, 60, 507–510. [Google Scholar] [CrossRef]
  43. Asquith, E.A.; Evans, C.A.; Geary, P.M.; Dunstan, R.H.; Cole, B. The role of Actinobacteria in taste and odour episodes involving geosmin and 2-methylisoborneol in aquatic environments. J. Water Supply Res. Technol.-Aqua 2013, 62, 452–467. [Google Scholar] [CrossRef]
  44. Mattheis, J.P.; Roberts, R.G. Identification of geosmin as a volatile metabolite of Penicillium expansum. Appl. Environ. Microbiol. 1992, 58, 3170–3172. [Google Scholar] [CrossRef]
  45. Du, K.; Zhou, B.; Yuan, R. Biodegradation of 2-methylisoborneol by Bacillus idriensis isolated from biological activated carbon. Desalination Water Treat. 2017, 76, 290–299. [Google Scholar] [CrossRef]
  46. Ganegoda, S.S.; Manage, P.M. Isolation and identification of novel, native geosmin and 2-methylisoborneol degrading bacteria. Water Pract. Technol. 2025, 20, 493–507. [Google Scholar] [CrossRef]
  47. El-Kady, A.A.; Magouz, F.I.; Mahmoud, S.A.; Abdel-Rahim, M.M. The effects of some commercial probiotics as water additive on water quality, fish performance, blood biochemical parameters, expression of growth and immune-related genes, and histology of Nile tilapia (Oreochromis niloticus). Aquaculture 2022, 546, 737249. [Google Scholar] [CrossRef]
  48. Naiel, M.A.E.; Abdelghany, M.F.; Khames, D.K.; Abd El-hameed, S.A.A.; Mansour, E.M.G.; El-Nadi, A.S.M.; Shoukry, A.A. Administration of some probiotic strains in the rearing water enhances the water quality, performance, body chemical analysis, antioxidant and immune responses of Nile tilapia, Oreochromis niloticus. Appl. Water Sci. 2022, 12, 209. [Google Scholar] [CrossRef]
  49. Kurdomanov, A.; Sirakov, I.; Stoyanova, S.; Velichkova, K.; Nedeva, I.; Staykov, Y. The effect of diet supplemented with Proviotic® on growth, blood biochemical parameters and meat quality in rainbow trout (Oncorhynchus mykiss) cultivated in recirculation system. Aquac. Aquar. Conserv. Legis. 2019, 12, 404–412. Available online: https://www.proquest.com/scholarly-journals/effect-diet-supplemented-with-proviotic®-on/docview/2211915689/se-2?accountid=28625 (accessed on 3 March 2025).
  50. Hai, N.V. Research findings from the use of probiotics in tilapia aquaculture: A review. Fish Shellfish Immunol. 2015, 45, 592–597. [Google Scholar] [CrossRef]
  51. Suphoronski, S.A.; de Souza, F.P.; Chideroli, R.T.; Mantovani Favero, L.; Ferrari, N.A.; Ziemniczak, H.M.; Gonçalves, D.D.; Lopera Barrero, N.M.; Pereira, U.P. Effect of Enterococcus faecium as a Water and/or Feed Additive on the Gut Microbiota, Hematologic and Immunological Parameters, and Resistance Against Francisellosis and Streptococcosis in Nile Tilapia (Oreochromis niloticus). Front. Microbiol. 2021, 12, 743957. [Google Scholar] [CrossRef] [PubMed]
  52. Cao, H.; Yu, R.; Zhang, Y.; Hu, B.; Jian, S.; Wen, C.; Kajbaf, K.; Kumar, V.; Yang, G. Effects of dietary supplementation with β-glucan and Bacillus subtilis on growth, fillet quality, immune capacity, and antioxidant status of Pengze crucian carp (Carassius auratus var. Pengze). Aquaculture 2019, 508, 106–112. [Google Scholar] [CrossRef]
  53. Zhou, X.; Tian, Z.; Wang, Y.; Li, W.J.F.p.; biochemistry. Effect of treatment with probiotics as water additives on tilapia (Oreochromis niloticus) growth performance and immune response. Fish Physiol. Biochem. 2010, 36, 501–509. [Google Scholar] [CrossRef] [PubMed]
  54. Eissa, N.; Wang, H.-P.; Yao, H.; Abou-ElGheit, E. Mixed Bacillus species enhance the innate immune response and stress tolerance in yellow perch subjected to hypoxia and air-exposure stress. Sci. Rep. 2018, 8, 6891. [Google Scholar] [CrossRef]
  55. Tachibana, L.; Telli, G.S.; Dias, D.d.C.; Gonçalves, G.S.; Guimarães, M.C.; Ishikawa, C.M.; Cavalcante, R.B.; Natori, M.M.; Fernandez Alarcon, M.F.; Tapia-Paniagua, S.; et al. Bacillus subtilis and Bacillus licheniformis in diets for Nile tilapia (Oreochromis niloticus): Effects on growth performance, gut microbiota modulation and innate immunology. Aquac. Res. 2021, 52, 1630–1642. [Google Scholar] [CrossRef]
  56. de Azevedo, R.V.; Braga, L.G.T. Use of probiotics in aquaculture. In Probiotic in Animals; InTech Publishers: Rijeka, Croatia, 2012; pp. 103–118. [Google Scholar] [CrossRef]
  57. Hasan, S.; Mian, S.; Rashid, A.; Rahmatullah, S. Effects of stocking density on growth and production of GIFT (Oreochromis niloticus). Bangladesh J. Fish 2010, 14, 45–53. Available online: https://www.researchgate.net/publication/281823113_Effects_of_stocking_density_on_growth_and_production_of_GIFT_Oreochromis_niloticus (accessed on 3 March 2025).
  58. Huang, W.B.; Chiu, T.S. Effects of stocking density on survival, growth, size variation, and production of Tilapia fry. Aquac. Res. 1997, 28, 165–173. [Google Scholar] [CrossRef]
  59. Opiyo, M.A.; Jumbe, J.; Ngugi, C.C.; Charo-Karisa, H. Different levels of probiotics affect growth, survival and body composition of Nile tilapia (Oreochromis niloticus) cultured in low input ponds. Sci. Afr. 2019, 4, e00103. [Google Scholar] [CrossRef]
  60. Assan, D.; Kuebutornye, F.K.A.; Hlordzi, V.; Chen, H.; Mraz, J.; Mustapha, U.F.; Abarike, E.D. Effects of probiotics on digestive enzymes of fish (finfish and shellfish); status and prospects: A mini review. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2022, 257, 110653. [Google Scholar] [CrossRef]
  61. Tang, Y.; Han, L.; Chen, X.; Xie, M.; Kong, W.; Wu, Z. Dietary Supplementation of Probiotic Bacillus subtilis Affects Antioxidant Defenses and Immune Response in Grass Carp Under Aeromonas hydrophila Challenge. Probiotics Antimicrob. Proteins 2019, 11, 545–558. [Google Scholar] [CrossRef]
  62. Gobi, N.; Vaseeharan, B.; Chen, J.-C.; Rekha, R.; Vijayakumar, S.; Anjugam, M.; Iswarya, A. Dietary supplementation of probiotic Bacillus licheniformis Dahb1 improves growth performance, mucus and serum immune parameters, antioxidant enzyme activity as well as resistance against Aeromonas hydrophila in tilapia Oreochromis mossambicus. Fish Shellfish Immunol. 2018, 74, 501–508. [Google Scholar] [CrossRef]
Water 17 01357 g001
Figure 1. Experimental design and procedure.
Figure 1. Experimental design and procedure.
Water 17 01357 g001
Water 17 01357 g002
Figure 2. (A) Observation results of co-cultured colonies on the medium. (B) Broth co-culture and monoculture of BL23 and Streptomyces thermocarboxydus (ST) over 240 h. Control, TSB without BL23, and S. thermocarboxydus; co-culture, combined BL23, and S. thermocarboxydus culture; monoculture, BL23, and S. thermocarboxydus culture alone. (C) Broth co-culture and monoculture of BL23. (D) Broth co-culture and monoculture of S. thermocarboxydus (ST). Groups are as follows: C, control; BL23, Bascillus licheniformis strain BL23; SR, S. roseoflavus; ST, S. thermocarboxydus; and SC, S. cyaneofuscatus.
Figure 2. (A) Observation results of co-cultured colonies on the medium. (B) Broth co-culture and monoculture of BL23 and Streptomyces thermocarboxydus (ST) over 240 h. Control, TSB without BL23, and S. thermocarboxydus; co-culture, combined BL23, and S. thermocarboxydus culture; monoculture, BL23, and S. thermocarboxydus culture alone. (C) Broth co-culture and monoculture of BL23. (D) Broth co-culture and monoculture of S. thermocarboxydus (ST). Groups are as follows: C, control; BL23, Bascillus licheniformis strain BL23; SR, S. roseoflavus; ST, S. thermocarboxydus; and SC, S. cyaneofuscatus.
Water 17 01357 g002
Water 17 01357 g003
Figure 3. Phylogenetic tree for B. licheniformis BL23 using neighbor joining method.
Figure 3. Phylogenetic tree for B. licheniformis BL23 using neighbor joining method.
Water 17 01357 g003
Water 17 01357 g004
Figure 4. Total ammonia nitrogen (TAN) from day 0 to 120.
Figure 4. Total ammonia nitrogen (TAN) from day 0 to 120.
Water 17 01357 g004
Water 17 01357 g005
Figure 5. Nitrite from day 0 to 120.
Figure 5. Nitrite from day 0 to 120.
Water 17 01357 g005
Water 17 01357 g006
Figure 6. Nitrate from day 0 to 120.
Figure 6. Nitrate from day 0 to 120.
Water 17 01357 g006
Water 17 01357 g007
Figure 7. Relative expression of geosmin in water and fish samples, C is the control; T1 is BL23 culture; T2 is ST and BL23 co-culture; BL23 is Bacillus subtilis strain BL23; ST is S. thermocarboxydus; bacterium. Note: “a, b, c” indicate significant differences.
Figure 7. Relative expression of geosmin in water and fish samples, C is the control; T1 is BL23 culture; T2 is ST and BL23 co-culture; BL23 is Bacillus subtilis strain BL23; ST is S. thermocarboxydus; bacterium. Note: “a, b, c” indicate significant differences.
Water 17 01357 g007
Water 17 01357 g008
Figure 8. Relative expression of 2-MIB in water and fish samples. C is control; T1 is BL23 culture; T2 is ST and BL23 co-culture; BL23 is Bacillus subtilis strain BL23; ST is S. thermocarboxydus. Note: “a, b” indicate significant differences.
Figure 8. Relative expression of 2-MIB in water and fish samples. C is control; T1 is BL23 culture; T2 is ST and BL23 co-culture; BL23 is Bacillus subtilis strain BL23; ST is S. thermocarboxydus. Note: “a, b” indicate significant differences.
Water 17 01357 g008
Table 1. Primers used in PCR.
Table 1. Primers used in PCR.
Target
Gene		PrimerSequence (5′–3′)Amplicon Size
(Base Pairs)		Annealing Temp.
(°C)
16S rRNA27-F
1492-R		AGAGTTTGATCCTGGCTCAG
CGGTTACCTTGTTACGACTT		150050
geoAgeoA-F
geoA-R		CTCCTCAACGAGTCCCTGTG
GCTGGTAGGAGAAGAGGTCG		23859
tpcAMmib-F
AMmib-R		TGGACGACTGCTACTGCGAG
AAGGCGTGCTGTAGTTCGTTGTG		59258
Table 2. Detection of geosmin and 2-MIB-producing Streptomyces spp. by olfaction test, GC–MS, and PCR.
Table 2. Detection of geosmin and 2-MIB-producing Streptomyces spp. by olfaction test, GC–MS, and PCR.
ActinomycetesOlfaction TestGC-MSPCR
Geosmin2-MIBgeoAtpc
S. roseoflavus+++++
S.thermocarboxydus++−+−
S. cyaneofuscatus++−+−
Note: + detected; − not detected.
Table 3. Growth performance of tilapia (Oreochromis niloticus) treated with ST (treatment 1), ST and BL23 (treatment 2), or without ST and BL23 (control).
Table 3. Growth performance of tilapia (Oreochromis niloticus) treated with ST (treatment 1), ST and BL23 (treatment 2), or without ST and BL23 (control).
GroupControlTreatment1Treatment2
(ST)(ST and BL23)
Initial weight (g)25.00 ± 13.83 a22.17 ± 12.01 a23.50 ± 10.35 a
Final weight (g)88.50 ± 27.79 ab78.33 ± 23.19 a111.11 ± 28.26 b
Specific growth rate (SGR) (%)1.09 ± 0.04 ab1.08 ± 0.23 a1.32 ± 0.07 b
Feed conversation ratio (FCR)1.78 ± 1.02 a2.06 ± 0.93 a1.86 ± 0.98 a
Average daily gain (ADG) (g/day)0.57 ± 0.14 ab0.47 ± 0.06 a0.76 ± 0.12 b
Weight gain (WG) (g)68.33 ± 16.67 ab56.17 ± 7.32 a90.81 ± 14.47 b
Survival rate (SR) (%)93.33 ± 11.55 a96.67 ± 5.77 a90.00 ± 10.00 a
Note: Different letters mean significant differences between samples (p < 0.05).
Table 4. Effects of probiotic (BL23) on fillet quality of tilapia (Orechromis niloticus).
Table 4. Effects of probiotic (BL23) on fillet quality of tilapia (Orechromis niloticus).
GroupControlTreatment1Treatment2
(ST)(ST and BL23)
Hardness (g)280 ± 27.78 ab230.00 ± 47.29 a323.33 ± 17.01 b
Springiness (mm)0.64 ± 0.14 a1.29 ± 1.11 a0.64 ± 0.17 a
Cohesiveness0.84 ± 0.06 a0.68 ± 0.06 a0.81 ± 0.12 a
Stickiness (g)163.73 ± 21.38 b79.95 ± 8.59 a176.38 ± 63.79 b
Chewiness (g × mm)233.99 ± 27.64 b153.57 ± 21 d.16 a261.56 ± 39.86 b
Resilience0.90 ± 0.81 a1.34 ± 0.24 a0.81 ± 0.12 a
Note: Means in the same row with different lower-case letters are significantly different (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Liu, T.; Boonpeng, N.; Li, K.; Yan, L.; Amankwah, J.F.; Satapornvanit, K.; Borski, R.; Liu, L. The Efficacy of a Novel Selection of Bacillus spp. on Reducing Off-Flavor Compounds and Improving Flesh Quality. Water 2025, 17, 1357. https://doi.org/10.3390/w17091357

AMA Style

Liu T, Boonpeng N, Li K, Yan L, Amankwah JF, Satapornvanit K, Borski R, Liu L. The Efficacy of a Novel Selection of Bacillus spp. on Reducing Off-Flavor Compounds and Improving Flesh Quality. Water. 2025; 17(9):1357. https://doi.org/10.3390/w17091357

Chicago/Turabian Style

Liu, Tianyu, Nattida Boonpeng, Kang Li, Li Yan, Justice Frimpong Amankwah, Kriengkrai Satapornvanit, Russell Borski, and Liping Liu. 2025. "The Efficacy of a Novel Selection of Bacillus spp. on Reducing Off-Flavor Compounds and Improving Flesh Quality" Water 17, no. 9: 1357. https://doi.org/10.3390/w17091357

APA Style

Liu, T., Boonpeng, N., Li, K., Yan, L., Amankwah, J. F., Satapornvanit, K., Borski, R., & Liu, L. (2025). The Efficacy of a Novel Selection of Bacillus spp. on Reducing Off-Flavor Compounds and Improving Flesh Quality. Water, 17(9), 1357. https://doi.org/10.3390/w17091357

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop