Next Article in Journal
Prediction of Daily River Discharge to Estuaries Based on Meteorological Data
Previous Article in Journal
Sustainable Greywater Treatment in Jordan: The Role of Constructed Wetlands as Nature-Based Solutions
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Water
Volume 17
Issue 17
10.3390/w17172498
water-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Development and Application of a Novel Conserved Signature Protein/Gene-Based qPCR Strategy for Improved Cryptosporidium Surveillance in Recreational Waters

by
Faizan Saleem
1,†,
Enze Li
1,†,
Kevin L. Tran
1,
Sarah Bello
2,
Susan Weir
3,
Thomas A. Edge
1,
Radhey S. Gupta
2,* and
Herb E. Schellhorn
1,*
1
Department of Biology, McMaster University, 1280 Main St W., Hamilton, ON L8S 4K1, Canada
2
Department of Biochemistry and Biomedical Sciences, McMaster University, McMaster University Medical Centre, 1280 Main St W., Hamilton, ON L8S 4K1, Canada
3
Water Standards, Technical Assessments & Standards Development Branch, Ministry of Environment, Conservation and Parks, 40 St. Clair Ave West, Toronto, ON M4V 1M2, Canada
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Water 2025, 17(17), 2498; https://doi.org/10.3390/w17172498
Submission received: 25 July 2025 / Revised: 11 August 2025 / Accepted: 15 August 2025 / Published: 22 August 2025
(This article belongs to the Section Water Quality and Contamination)
Browse Figures
Versions Notes

Abstract

Cryptosporidium is a major waterborne parasite that causes gastrointestinal illness. Conventional assays, including microscopy and immunological identification, often suffer from false positives or negatives due to non-specific binding or morphological differences between Cryptosporidium species. We developed a novel qPCR assay based on a Cryptosporidium-specific Conserved Signature Protein (CSP) to address the limitations of testing complex samples, including those from recreational waters. The CSP (hypothetical protein (cgd2_3830)) was identified as taxonomically unique to Cryptosporidium species. The CSP sequence and designed qPCR assay primers/probe demonstrated high specificity for the targeted Cryptosporidium species when tested against NCBI RefSeq databases. qPCR assay efficiency was determined as 95% and an R2 value of 0.99, with a slope and intercept of −3.4 and 40.1, respectively. Additionally, the Lower Limit of Detection (ALLOD) was determined as three gene copies, suggesting the potential to detect even a single oocyst. No non-specific amplification products or primer dimers were observed when the qPCR assay was evaluated using recreational water, fecal solution, and wastewater, while spike-in-control tests indicated minimal interference with the sensitivity of the assay, highlighting application for testing complex environmental DNA extracts. These findings highlight the application of the novel CSP-based qPCR assay for the rapid and sensitive detection of Cryptosporidium sp., thereby circumventing the sequence variability and multi-copy limitations associated with existing molecular markers. This proof-of-concept study presents a diagnostic framework utilizing CSP-based markers for developing water quality monitoring strategies, with scope for expansion to other microbial pathogens and potential applications in clinical and food safety settings.

Graphical Abstract

1. Introduction

Protozoan parasites, including Cryptosporidium, are major waterborne pathogens that survive in cystic forms and resist commonly used water and wastewater disinfection procedures [1]. Approximately 90% of reported cryptosporidiosis outbreaks are waterborne [2], and Cryptosporidium is one of the leading causes of death related to gastrointestinal disorders worldwide [3,4]. Among the Cryptosporidium species that can cause infection, C. hominis and C. parvum account for more than 90% of reported cases [5]. However, the Cryptosporidium genus includes thirty valid species that cause gastrointestinal disorders in humans and animals [6], emphasizing the need to develop or implement new broad-range detection methods. Additionally, Cryptosporidium has high infectivity, as ingestion of a single oocyst can be enough to cause gastrointestinal illness [1]. Detecting Cryptosporidium oocysts in source waters for drinking, recreation, and food production is challenging due to environmental factors, including the low abundance of oocysts [7], inherent methodological limitations that restrict the sensitivity of current detection methods [8], and interference from complex water matrices [9].
Commonly used strategies for Cryptosporidium detection and quantification include microscopy [10] and immunological assays [11]. Although both microscopy and immunological methods have been widely tested, they are prone to limitations in sensitivity and specificity, including variations in microscopic stain uptake [8], interference from microscopic fixatives [12], non-specific antibody binding [13] and overlapping fluorescent signals from naturally fluorescent microorganisms, including algae in surface waters [14]. For example, the standard USEPA microscopy method 1623.1 [10] suffers from limitations, including higher cost per sample [15], and oocyst recovery as low as 50% [16]. Specifically, a previous study on waterborne Cryptosporidium parvum reported about 8–14% loss of oocysts during the centrifugation steps and 29–34% oocyst loss due to filtration/elution steps compared to the immunomagnetic separation-based fluorescence method [17]. Another limitation of the microscopy method is its effectiveness in obtaining reliable information, as structural details revealed after hours-long sample preparation may be obscured or misidentified due to similar cross-reactive structures within a complex environmental matrix, potentially leading to erroneous measurements [18]. In comparison, molecular approaches such as Restriction Fragment Length Polymorphism (RFLP) [19], quantitative polymerase chain reaction (qPCR) [20], and digital PCR [21] have become more widely accessible for public health officials as more robust alternatives to conventional strategies. However, many DNA amplification-based strategies rely on universal gene markers, including 18S rDNA [22] and GP60 (a 60 kDa glycoprotein) [9], which have limitations in routine use due to false positives/negatives, as well as variable gene copy numbers among environmental isolates [23].
Conserved Signature Proteins/Genes (CSPs) are unique molecular markers that are highly specific and taxonomically conserved within the targeted organisms [24,25,26]. They can serve as useful alternatives to conventional universal gene markers for DNA amplification-based diagnostic strategies. CSPs have been widely studied across various taxonomic groups and have become a new foundational tool for distinguishing complex microbial taxa [24,27,28,29]. Additionally, CSP DNA sequences benefit from conserved nucleotide composition and identical gene copy numbers among different environmental strains of the same species [27,30], which provides clade-level specificity and supports the development of both taxon-specific and sensitive diagnostic methods for biological samples, including water and clinical specimens. This proof-of-concept study aimed to identify Cryptosporidium-specific CSP and assess its application in developing a qPCR strategy for more robust and reliable water diagnostics. The specific questions addressed were: (1) Are there any Conserved Signature Proteins/Genes specific to Cryptosporidium species? (2) Can identified CSPs be utilized to develop a qPCR-based water diagnostic method? (3) Will the qPCR assay effectively detect diverse Cryptosporidium species? (4) Can the newly developed qPCR strategy be applied successfully to complex environmental waters?

2. Materials and Methods

2.1. Identification of Cryptosporidium-Specific Conserved Signature Protein/Gene

A Cryptosporidium-specific Conserved Signature Protein (CSP) was identified using the previously described methodology [25,26,31]. BLASTp [32] searches were performed for all Cryptosporidium proteins against a customized database consisting of publicly available genomes of Cryptosporidium and hematozoa species. Based on BLASTp results, the candidate Cryptosporidium-specific CSPs were identified as either not present in any other organism or taxon or had an E-value lower than 1 × 10−3. Subsequently, a second BLASTp search was conducted on the sequences of candidate CSPs against the NCBI RefSeq protein database without a non-complexity filter to identify those CSPs for whom all significant BLASTp hits were for the Cryptosporidium species only.

2.2. Primer/Probe Design and Specificity Validation

Initially, two primer sets targeting the Cryptosporidium-specific Conserved Signature Protein (CSP) were developed with amplicon lengths of 119 and 146 bp. The specificity of the primer sequences was evaluated in silico using Primer-BLAST [33] against both the NCBI nr and RefSeq genome databases under default settings. Additional specificity checks were carried out at the organism level by searching for eukaryotic, bacterial and protist entries in the RefSeq genome database. After initial PCR amplification screening, the primer set producing a 146 bp fragment was selected for the qPCR assay (Table 1). The probe sequence was designed following stringent criteria [34], including (1) positioning near one of the primers, (2) maintaining a melting temperature 5–10 °C above that of the primers, and (3) ensuring a GC content of 35–65%. The probe sequence was further aligned against the NCBI RefSeq databases to confirm specificity.

2.3. PCR Assay Development Quality Control Analysis

A larger PCR fragment (934 bp) of the Cryptosporidium-specific CSP was amplified from Cryptosporidium parvum DNA and oocysts from two commercial sources, including the American Type Culture Collection (ATCC-PRA-67DQ) and Microbiologics (St. Cloud, MN, USA), respectively, to verify the conservation of the CSP sequence. DNA from the oocysts was extracted using the Norgen Plant/Fungi DNA isolation kit (Norgen Biotek, Thorold, ON, Canada) following the manufacturer’s protocol with minor modifications. Modifications to the DNA extraction protocol included bead-beating Cryptosporidium oocysts for 5 min at 18,000 g, along with the kit lysis buffer and an additional round of DNA elution from the spin column. For the amplicons required for Sanger sequencing, a PCR mixture was prepared by combining 10 pmol of each primer, 12.5 µL of Environmental Master Mix 2.0 (Thermo Scientific, Waltham, MA, USA), 10.5 µL of nuclease-free water, and 1.0 ng of Cryptosporidium genomic DNA. The thermal cycler program included an initial denaturation at 98 °C for 10 min, followed by 35 cycles of denaturation at 98 °C for 30 s, annealing at 60 °C for 30 s, and extension at 72 °C for 60 s, ending with a final extension at 72 °C for 5 min. The resulting PCR product was then purified using the GeneJET Gel Extraction Kit (Thermo Scientific, Waltham, MA, USA) and used for Sanger sequencing on the SeqStudio Flex Genetic Analyzer (Thermo Scientific, Waltham, MA, USA) at the Farncombe Sequencing Institute (McMaster University). The sequence obtained was compared against the NCBI nr and RefSeq genome databases to confirm the sequence conservation.
For the qPCR assay, a smaller amplicon (146 bp) was purified using the GeneJET Gel Extraction Kit (Thermo Scientific, Waltham, MA, USA). DNA quantification was performed using a Qubit micro fluorometer (Thermo Scientific, Waltham, MA, USA), followed by calculation of gene copies to prepare the qPCR standards. qPCR standards were prepared by 10-fold dilutions to obtain standards ranging from 107 to 101 gene copies/µL, and standard curves were only accepted if R2 ≥ 0.99 and amplification efficiency between 90 and 110% [35]. qPCR mix was prepared in a 20 µL total volume containing 10 pmol (1 µL) of each primer, 5 pmol (1 µL) of the probe, 10 µL of Environmental Mastermix 2.0 (Thermo Scientific, Waltham, MA, USA), DNA (1 µL of standard, environmental or Salmon DNA), and water (6 µL). The thermocycler program for the qPCR assay included an initial denaturation at 95 °C for 10 min, followed by 40 cycles of 95 °C for 20 s and 62 °C for 1 min. The Assay Lower Limit of Detection (ALLOD) of the qPCR assay was determined by evaluating standard dilutions ranging from 2 to 10 gene copies per reaction, using five separate batches of reagents and standards, and then identifying the minimum gene copies of the target detected with 95% probability of detection. For the dye-based qPCR (without the probe) method development, each 20 μL reaction mix consisted of 1× Luna Universal qPCR master mix (New England Biolabs, Ipswich, MA, USA), 5.0 pmol of each forward and reverse primer, 0.4 μg bovine serum albumin, 1.0 μL of each Cryptosporidium CSP amplicon standard dilution, and water. The protocol included an initial denaturation at 95 °C for 1 min, followed by 40 cycles at 95 °C for 15 s and 60 °C for 30 s, and a melt curve from 60 to 95 °C with an increment of 0.5 °C/5 s. All PCR reactions were conducted in triplicate using a Bio-Rad CFX96 Touch Real-Time PCR system (Bio-Rad Inc., Hercules, CA, USA).

2.4. PCR Assay Efficiency for Recreational Water DNA Testing

To test effects of exogenous environmental DNA on PCR assay quantitation, recreational water DNA samples, previously tested for microbiome composition [30], were used to test DNA amplification/fluorescence with or without Salmon sperm DNA (Thermo Scientific, Waltham, MA, USA) or recreational water DNA spiking to analyze the efficiency of the assay in complex DNA samples. Recreational beach water samples (500 mL) [30,36] were concentrated by filtration (0.2 µm), and DNA was extracted using a Norgen Biotek Soil Plus DNA isolation kit (Norgen Biotek, Thorold, ON, Canada) with purified DNA eluted into a 50 µL final volume. Approximately 3 to 106 purified Cryptosporidium CSP amplicon gene copies were spiked into 50 ng of Salmon sperm DNA and 25 ng of recreational water DNA, followed by testing with the qPCR assay to validate the potential application in environmental monitoring.

3. Results

3.1. Cryptosporidium-Specific Conserved Signature Protein/Gene

To identify candidate CSP markers for this study, the Cryptosporidium proteome was aligned against the NCBI nr and RefSeq databases to identify protein/DNA sequences specific to the Cryptosporidium species only. Based on BLASTp searches, the identified CSP, annotated as a hypothetical protein (cgd2_3830) (NCBI gene ID: 3373407), is uniquely found in the Cryptosporidium genus with a percentage identity ranging from 90 to 100 percent for C. parvum, C. hominis, C. tyzzeri, and C. ubiquitum (Supplementary Figure S1).

3.2. In Silico and Experimental Validation of Primers/Probe for Cryptosporidium-Specific CSP

A large fragment of CSP DNA sequence (934 bp) spanning the targeted qPCR region was amplified from the DNA of C. parvum, followed by Sanger sequencing and alignment against the NCBI RefSeq sequence of C. parvum, as the first step to validate nucleotide sequence conservation (Figure 1). Except for a 1 bp deletion near the 3′ end, the amplified CSP DNA sequence showed 100% sequence identity with the RefSeq sequence of the Cryptosporidium parvum species. As a second step of validation, qPCR-suitable primer sequences were designed, and in silico PCR was performed against the NCBI databases to evaluate amplification specificity (Supplementary Figures S2–S4). The predicted primer set produced hits against Cryptosporidium species with no non-specific matches when aligned against the NCBI nt (Supplementary Figure S2), core-nt (Supplementary Figure S3) and RefSeq (Supplementary Figure S4) databases. The designed qPCR primers can target C. parvum, C. hominis, and C. tyzzeri (Supplementary Figure S5), while the probe sequence is specific to C. parvum due to the first two bases at the 5′ end, which are not found in the other two Cryptosporidium species (C. tyzzeri and C. hominis) (Supplementary Figure S5). Complex microbial and eukaryotic DNA samples, extracted from 30 recreational water samples, were tested in the Cryptosporidium assay as a third validation step. No off-target amplification products were observed in the recreational water samples until they were spiked with Cryptosporidium DNA. DNA extracted from 14 wastewater sludge samples and spiked controls was also tested (Supplementary Figure S6), for which we only observed DNA amplification/fluorescence signal in the spiked controls.

3.3. Development of qPCR Assay and Quality Control Analysis

Two primer sets were designed to optimize the qPCR strategy (Supplementary Figure S7). Primer sets 1 and 2 provided PCR product sizes of 119 and 146 bp, respectively (Supplementary Figure S7). Primer set 2 was selected for further qPCR method development due to the larger-sized PCR product and optimal annealing temperature (Supplementary Figure S8), which is near the qPCR optimal annealing/extension temperature of 60 °C (Supplementary Figure S9). A composite standard curve ranging from 3 to 106 gene copies was generated to test the efficiency of the primer set, probe and qPCR assay (Figure 2). The efficiency of the Cryptosporidium-specific CSP-based qPCR assay was 94.8% with a Coefficient of determination (R2) of 0.99, a slope of −3.4, and an intercept of 40.1. Additionally, the Assay Lower Limit of Detection (ALLOD) of the assay was determined to be 3 gene copies. The qPCR quality measures of primers were evaluated using dye-based qPCR to test for the application of the assay without the probe sequence, targeting a broad range of Cryptosporidium species (Supplementary Figures S10–S12). The dye-based qPCR, in the absence of a probe, also provided good amplification efficiency (Supplementary Figure S10) and a single peak corresponding to the targeted DNA region without the formation of primer dimers (Supplementary Figures S11 and S12).

3.4. Application of qPCR Assay for Recreational Water Testing

Due to the absence of Cryptosporidium in any of the 30 tested recreational water samples and 14 wastewater sludge samples, mock-positive samples were created by spiking different concentrations of Cryptosporidium DNA in salmon or environmental DNA to test for the applicability of the developed qPCR assay in water testing (Figure 3). In all three conditions tested, including Salmon DNA spiking, environmental DNA spiking, or pure Cryptosporidium DNA spiking (positive control), a linear relationship was observed for 3 to 106 gene copies. Cryptosporidium DNA- and Salmon DNA-spiked samples yielded similar threshold cycle (Ct) values (Supplementary Table S1), with an R2 value of 0.99 and efficiency ranging from 100% to 104%. An approximately 1.5–2.0 Ct difference was observed for the samples spiked with environmental DNA (Supplementary Table S1). However, a high R2 value of 0.99 was observed even in the presence of environmental DNA. Cryptosporidium oocysts were spiked into fecal solution and recreational water samples, followed by DNA extraction and amplification to assess further the efficiency of the PCR assay (Supplementary Figures S13 and S14). For conventional PCR without the use of a probe, positive PCR amplification was observed for the DNA extracted from the oocyst-containing fecal solution (Supplementary Figure S13). Similarly, for qPCR using a probe DNA sequence, positive amplification/fluorescence was observed for both oocyst-spiked fecal solution and recreational water samples (Supplementary Figure S14).

4. Discussion

Effective detection of Cryptosporidium remains a major challenge in testing source waters used for drinking, recreational purposes, and food production, especially considering complex anthropogenic factors that can introduce and promote the growth of diverse pathogens [37,38]. A single Cryptosporidium oocyst is enough to cause infection [1], highlighting the need for more sensitive diagnostic methods that go beyond current approaches. Standard microscopy and immunogenic assays may lack sufficient specificity and sensitivity [8], including issues in differentiating morphologically similar oocysts [39] and inconsistent antibody binding across Cryptosporidium species [40]. Although DNA-based detection strategies offer a promising alternative to overcome these limitations, they mainly depend on universal gene markers, which can produce false negatives or positives [41]. Existing diagnostic DNA markers have inherent limitations, such as restricted sensitivity at higher taxonomic levels. Moreover, while a specific marker may work well in a particular setting or region, its use as a universal detection tool is often limited because it may be present in non-target taxonomic groups or due to environmental DNA variants. Ideally, a robust genetic marker should be unique to the targeted taxonomic group and strongly linked to a well-defined taxonomic framework. For example, Conserved Signature Proteins (CSPs) and Conserved Signature INDELS are evolutionarily conserved markers that could be useful in environmental and clinical diagnostics. We have tested the application of CSP-class DNA markers at the species and strain levels for detecting and quantifying E. coli in general [42] and E. coli O157:H7 [43], and we expect the reliability of this approach will increase as more case studies on using CSPs/CSIs for diagnostic purposes are published. Our current work is a proof-of-concept study using a newly identified Cryptosporidium-specific Conserved Signature Protein (CSP), demonstrating its potential for quality monitoring of Cryptosporidium species in recreational water systems.
In silico and in vitro testing confirmed the presence of CSP only in Cryptosporidium species, highlighting the evolutionary and taxonomic importance of using CSP markers as a general strategy for taxonomic identification. On the contrary, Cryptosporidium-specific primers and probes based on the 18S rRNA gene might also detect other taxonomic groups, such as Colpodellidae, Blastocystis, and Prymnesium (Supplementary Figures S15 and S16). Amplicon Sequence Variants (ASVs) provide an alternative method for exploring lower-level taxonomic diversity. However, ASVs may not be widely conserved, as they can emerge spontaneously and may only dominate within specific regions.
Molecular methods can also be influenced by issues related to detection sensitivity or specificity. For example, due to non-optimized incubation time or reagent ratio, loop-mediated isothermal amplification (LAMP) can produce false negatives or positives [44]. Detection and identification assays based on universal taxonomic markers rely on a limited number of conserved nucleotides in the targeted organism [45]. However, single-nucleotide polymorphisms (SNPs) or environmental genetic variants can cause erroneous DNA amplification (e.g., secondary non-target products) or failed amplification [46,47], potentially leading to false-positive or false-negative identification of targeted taxa [48,49]. The Cryptosporidium CSP sequence is highly conserved (for the probe and PCR primer regions), highlighting the effectiveness of using CSP-based qPCR assays for reliable water diagnostics. Additionally, universal taxonomic marker genes may have multiple copies per genome [50], which can result in inaccurate measurement of target abundance in an environment or sample. In contrast, the CSP sequence exists as a single gene copy per genome, and the number of gene copies in any sample can be directly linked to the number of Cryptosporidium sporozoites. The Assay Lower Limit of Detection (ALLOD) for the CSP-based qPCR assay was approximately three gene copies, enabling detection even of a single oocyst, which contains four infective sporozoites [51], each carrying a single copy of the whole genome [52].
CSP-based qPCR assay showed >90% efficiency even with complex samples, including increasing concentrations of control Salmon sperm DNA and complex environmental DNA. Theoretically, a Cq value difference of 3.2 is expected between the 10-fold dilutions in a qPCR assay, which shows 100% efficiency [53]. A previous study [54] on 18S rDNA-based qPCR reported lower and variable Cq value differences for the dilutions containing 1–10 oocysts, which is a limitation we observed as well for our CSP-based qPCR assay. However, the limit of detection for the CSP-based qPCR assay is comparatively lower than the LOD reported for the 18S rDNA-based assay [54]. RNA-based (RT-PCR) assay targeting 18S rRNA transcripts [55] has been reported to be more sensitive due to a high number of RNA copies, but lower RNA stability, and complex RNA extraction procedures can hinder the adoption of the assay for environmental samples. We observed a slight increase in qPCR Ct values for complex environmental DNA samples, which can be due to PCR inhibitors in recreational water matrices. The sensitivity of molecular assays can be affected by complex environmental matrices, as reported for a CRISPR/Cas12a-based immunosensor [56], for which the detection sensitivity decreased tenfold in the presence of mud particles. Aside from the environmental factors, primer dimer formation in primer sets with high self-complementarity reduces the efficiency of the target amplification in qPCR [57]. The CSP-based primer set did not produce primer dimers in dye-based qPCR, demonstrating the efficiency of the developed assay for interference-free amplification of target DNA. Although non-specific amplification was not observed, environmental sample complexity can vary due to anthropogenic and ecological factors, including temperature [58], diverse fecal contamination sources [59], and nutrient load [60]. Therefore, molecular assays, including the CSP-based qPCR, should be validated across diverse locations that may differ in taxonomic composition from those examined in this study.
In this proof-of-concept study, we identified a Cryptosporidium-specific CSP-class DNA marker and investigated the potential of CSPs as diagnostic markers. It is important to note that our current work focuses on assessing practical application of CSP-based diagnostics rather than fully validating it as a standard method at this stage. Environmental and experimental factors, including regional genetic variants, low abundance of Cryptosporidium oocysts in waters, water filtration procedures, and DNA extraction efficiency, can potentially limit the applications of the qPCR assay. Future work should include extensive validation, including testing against a diverse range of environmental samples known to contain various Cryptosporidium species, and incorporating/testing complementary water filtration and high-efficiency DNA extraction procedures, which go beyond the immediate scope of this study.

5. Conclusions

  • Thetaxon-specific hypothetical protein (cgd2_3830) was identified as a Cryptosporidium-specific Conserved Signature Protein (CSP), and in silico and in vitro testing validated its potential as a diagnostic marker for environmental samples.
  • The CSP DNA sequence is highly conserved among different Cryptosporidium species and is absent in other species, which is essential for reducing false positives and negatives due to environmental genetic variants.
  • The qPCR assay can also be performed in a conventional dye-based format without interference from primer dimer formation, thus avoiding the false positives due to the self-complementarity of primer sequences.
  • The developed qPCR assay can detect, as a lower limit, three gene copies in a standard PCR reaction, with high detection sensitivity even in the presence of non-Cryptosporidium complex environmental DNA.
  • This proof-of-concept study provides an applicative framework for developing diagnostic strategies using CSP-based DNA markers, which can be extended to the detection/quantification of other microbial pathogens as well.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/w17172498/s1, Figure S1: BLASTp alignment of Cryptosporidium-specific Conserved Signature Protein (CSP) against the NCBI Refseq protein database. Figure S2: Primer BLAST results for primer set designed to amplify qPCR suitable fragment of Cryptosporidium-specific Conserved Signature Protein (CSP) DNA sequence using the NCBI nt database. Figure S3: Primer BLAST results for primer set designed to amplify qPCR suitable fragment of Cryptosporidium-specific Conserved Signature Protein (CSP) DNA sequence using the NCBI core-nt database. Figure S4: Primer BLAST results for primer set designed to amplify qPCR suitable fragment of Cryptosporidium-specific Conserved Signature Protein (CSP) DNA sequence using the NCBI Refseq database. Figure S5: Multiple sequence alignment between C. parvum, C. hominis, and C. tyzzeri of the qPCR targeted region for Cryptosporidium-specific CSP, with the locations of primers/probe and nucleotide differences between Cryptosporidium species highlighted. The single nucleotide mismatch between C. parvum and C. hominis in the forward primer is resolved by adding a degenerate base at the highlighted position. Figure S6: In vitro specificity testing of the primer designed for the Cryptosporidium-specific CSP-based qPCR assay. Figure S7: PCR amplification of potential candidate DNA fragments for Cryptosporidium-specific CSP-based qPCR strategy. Figure S8: The annealing temperature gradient of the primer set selected for developing a Cryptosporidium-specific CSP-based qPCR strategy. Figure S9: The annealing temperature gradient of the primer set along with the probe for Cryptosporidium-specific CSP-based qPCR. Figure S10: The amplification curve for the Cryptosporidium-specific CSP assay without the probe using dye-based qPCR. Figure S11: The melt curve for the Cryptosporidium-specific CSP assay without the probe using dye-based qPCR. Figure S12: The melt curve peak analysis for the Cryptosporidium-specific CSP assay without the probe using dye-based qPCR. Figure S13: PCR testing of DNA extracted from Cryptosporidium oocysts in a fecal solution (PC1), Well marked as 2 represents purified CSP fragment as PCR template (positive control), Well marked as 2 represents Cryptosporidium genomic DNA as PCR template (positive control), and NTC represents non-template control. Figure S14: qPCR assay (with probe) testing for DNA extracted from recreational water samples with spiked Cryptosporidium oocysts. (1) purified Cryptosporidium CSP amplicon, 10^7 copies, (2) Genomic DNA isolated from Cryptosporidium oocyst, 0.2 ng DNA, (3) 200 μL oocyst containing fecal suspension spiked into 100 mL Lake water, (4) 100 μL oocyst suspension spiked into 100 mL lake water, and (5) Non-template control. Figure S15: In-silico PCR (Primer BLAST) results for Cryptosporidium-specific 18S rRNA-based primers adopted from Kishida et al., 2012 and Miller et al., 2006. Figure S16: BLASTn alignment results for Cryptosporidium-specific 18S rRNA-based probe sequence adopted from Kishida et al., 2012 and Miller et al., 2006. Table S1: Cq values for each spiking test for the detection sensitivity of the CSP-based Cryptosporidium-specific qPCR assay in the presence of Salmon and complex environmental DNA.

Author Contributions

Validation, F.S. and E.L.; methodology, F.S., E.L., K.L.T., R.S.G. and H.E.S.; Investigation, F.S., E.L., K.L.T., S.B. and H.E.S.; writing—original draft preparation, F.S.; writing—review and editing F.S., T.A.E., E.L., S.W., R.S.G. and H.E.S.; supervision, R.S.G. and H.E.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Canada First Research Excellence Fund Global Water Futures (CFREF–20015754) and Natural Sciences and Engineering Research Council of Canada (ALLRP 554507-20).

Data Availability Statement

The data supporting this article have been included as part of the Supplementary Materials.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. World Health Organization (WHO). Diarrhoeal Disease-Fact Sheet. 2017. Available online: https://www.who.int/news-room/fact-sheets/detail/diarrhoeal-disease (accessed on 1 May 2023).
  2. Karanis, P.; Kourenti, C.; Smith, H. Waterborne transmission of protozoan parasites: A worldwide review of outbreaks and lessons learnt. J. Water Health 2007, 5, 1–38. [Google Scholar] [CrossRef]
  3. Shrivastava, A.K.; Kumar, S.; Smith, W.A.; Sahu, P.S. Revisiting the global problem of cryptosporidiosis and recommendations. Trop. Parasitol. 2017, 7, 8–17. [Google Scholar]
  4. Certad, G.; Viscogliosi, E.; Chabé, M.; Cacciò, S.M. Pathogenic mechanisms of Cryptosporidium and Giardia. Trends Parasitol. 2017, 33, 561–576. [Google Scholar] [CrossRef] [PubMed]
  5. Caccio, S.M.; Putignani, L. Epidemiology of human cryptosporidiosis. In Cryptosporidium: Parasite and Disease; Springer: Vienna, Austria, 2013; pp. 43–79. [Google Scholar]
  6. Šlapeta, J. Cryptosporidiosis and Cryptosporidium species in animals and humans: A thirty colour rainbow? Int. J. Parasitol. 2013, 43, 957–970. [Google Scholar] [CrossRef] [PubMed]
  7. Smith, H.V.; Nichols, R.A. Cryptosporidium: Detection in water and food. Exp. Parasitol. 2010, 124, 61–79. [Google Scholar] [CrossRef] [PubMed]
  8. Hassan, E.M.; Örmeci, B.; DeRosa, M.C.; Dixon, B.R.; Sattar, S.A.; Iqbal, A. A review of Cryptosporidium spp. and their detection in water. Water Sci. Technol. 2021, 83, 1–25. [Google Scholar] [CrossRef]
  9. Li, N.; Neumann, N.F.; Ruecker, N.; Alderisio, K.A.; Sturbaum, G.D.; Villegas, E.N.; Chalmers, R.; Monis, P.; Feng, Y.; Xiao, L. Development and evaluation of three real-time PCR assays for genotyping and source tracking Cryptosporidium spp. in water. Appl. Environ. Microbiol. 2015, 81, 5845–5854. [Google Scholar] [CrossRef] [PubMed]
  10. USEPA Method 1623: Cryptosporidium Giardia in Water by Filtration/IMS/FA. Office of Water, EPA 815-R-05-002. 2012. Available online: https://www.epa.gov/sites/production/files/2015-07/documents/epa-1623.pdf (accessed on 1 January 2023).
  11. Simmons, O.D., III; Sobsey, M.D.; Schaefer, F.W., III; Francy, D.S.; Nally, R.A.; Heaney, C.D. Evaluation of USEPA method 1622 for detection of Cryptosporidium oocysts in stream waters. J. Am. Water Work. Assoc. 2001, 93, 78–87. [Google Scholar] [CrossRef]
  12. Khanna, V.; Tilak, K.; Ghosh, A.; Mukhopadhyay, C. Modified negative staining of heine for fast and inexpensive screening of Cryptosporidium, Cyclospora, and Cystoisospora spp. Int. Sch. Res. Not. 2014, 165424. [Google Scholar] [CrossRef]
  13. Luka, G.S.; Najjaran, H.; Hoorfar, M. On-chip-based electrochemical biosensor for the sensitive and label-free detection of cryptosporidium. Sci. Rep. 2022, 12, 6957. [Google Scholar] [CrossRef]
  14. Keserue, H.A.; Füchslin, H.P.; Wittwer, M.; Nguyen-Viet, H.; Nguyen, T.T.; Surinkul, N.; Koottatep, T.; Schürch, N.; Egli, T. Comparison of rapid methods for detection of Giardia spp. and Cryptosporidium spp. (oo)cysts using transportable instrumentation in a field deployment. Environ. Sci. Technol. 2012, 46, 8952–8959. [Google Scholar] [CrossRef] [PubMed]
  15. Fradette, M.S.; Culley, A.I.; Charette, S.J. Detection of Cryptosporidium spp. and Giardia spp. in environmental water samples: A journey into the past and new perspectives. Microorganisms 2022, 10, 1175. [Google Scholar] [CrossRef] [PubMed]
  16. Sammarro Silva, K.J.; Sabogal-Paz, L.P. Giardia spp. cysts and Cryptosporidium spp. oocysts in drinking water treatment residues: Comparison of recovery methods for quantity assessment. Environ. Technol. 2021, 42, 3144–3153. [Google Scholar] [CrossRef] [PubMed]
  17. Kim, K.J.; Jung, H.H.; Lee, K. Evaluation of cyst loss in standard procedural steps for detecting of Giardia lamblia and Cryptosporidium parvum in water. Biotechnol. Bioprocess Eng. 2006, 11, 368–371. [Google Scholar] [CrossRef]
  18. Loiola, S.H.N.; Galvão, F.L.; Santos, B.M.D.; Rosa, S.L.; Soares, F.A.; Inácio, S.V.; Suzuki, C.T.N.; Sabadini, E.; Bresciani, K.D.S.; Falcão, A.X.; et al. Development of new staining procedures for diagnosing Cryptosporidium spp. in fecal samples by computerized image analysis. Microsc. Microanal. 2021, 27, 1518–1528. [Google Scholar] [CrossRef]
  19. Ruecker, N.J.; Matsune, J.C.; Lapen, D.R.; Topp, E.; Edge, T.A.; Neumann, N.F. The detection of Cryptosporidium and the resolution of mixtures of species and genotypes from water. Infect. Genet. Evol. 2013, 15, 3–9. [Google Scholar] [CrossRef]
  20. Wang, Y.; Zhang, B.; Li, J.; Yu, S.; Zhang, N.; Liu, S.; Zhang, Y.; Li, J.; Ma, N.; Cai, Y.; et al. Development of a quantitative real-time PCR assay for detection of Cryptosporidium spp. infection and threatening caused by Cryptosporidium parvum subtype IIdA19G1 in diarrhea calves from Northeastern China. Vector-Borne Zoonotic Dis. 2021, 21, 179–190. [Google Scholar] [CrossRef]
  21. Tiwari, A.; Ahmed, W.; Oikarinen, S.; Sherchan, S.P.; Heikinheimo, A.; Jiang, G.; Simpson, S.L.; Greaves, J.; Bivins, A. Application of digital PCR for public health-related water quality monitoring. Sci. Total Environ. 2022, 837, 155663. [Google Scholar] [CrossRef]
  22. Kishida, N.; Miyata, R.; Furuta, A.; Izumiyama, S.; Tsuneda, S.; Sekiguchi, Y.; Noda, N.; Akiba, M. Quantitative detection of Cryptosporidium oocyst in water source based on 18S rRNA by alternately binding probe competitive reverse transcription polymerase chain reaction (ABC-RT-PCR). Water Res. 2012, 46, 187–194. [Google Scholar] [CrossRef]
  23. Šlapeta, J. Cryptosporidium: Identification and genetic typing. Curr. Protoc. Microbiol. 2017, 44, 20B-1. [Google Scholar] [CrossRef]
  24. Gao, B.; Mohan, R.; Gupta, R.S. Phylogenomics and protein signatures elucidating the evolutionary relationships among the gammaproteobacteria. Int. J. Syst. Evol. Microbiol. 2009, 59, 234–247. [Google Scholar] [CrossRef] [PubMed]
  25. Gupta, R.S.; Mathews, D.W. Signature proteins for the major clades of Cyanobacteria. BMC Evol. Biol. 2010, 10, 24. [Google Scholar] [CrossRef] [PubMed]
  26. Gupta, R.S.; Mok, A. Phylogenomics and signature proteins for the alpha proteobacteria and its main groups. BMC Microbiol. 2007, 7, 106. [Google Scholar] [CrossRef] [PubMed]
  27. Gupta, R.S.; Griffiths, E. Chlamydiae-specific proteins and indels: Novel tools for studies. Trends Microbiol. 2006, 14, 527–535. [Google Scholar] [CrossRef]
  28. Gao, B.; Gupta, R.S. Phylogenetic framework and molecular signatures for the main clades of the phylum Actinobacteria. Microbiol. Mol. Biol. Rev. 2012, 76, 66–112. [Google Scholar] [CrossRef] [PubMed]
  29. Naushad, H.S.; Lee, B.; Gupta, R.S. Conserved signature indels and signature proteins as novel tools for understanding microbial phylogeny and systematics: Identification of molecular signatures that are specific for the phytopathogenic genera Dickeya, Pectobacterium and Brenneria. Int. J. Syst. Evol. Microbiol. 2014, 64 Pt 2, 366–383. [Google Scholar] [CrossRef]
  30. Saleem, F.; Li, E.; Edge, T.A.; Tran, K.L.; Schellhorn, H.E. Identification of potential microbial risk factors associated with fecal indicator exceedances at recreational beaches. Environ. Microbiome 2024, 19, 4. [Google Scholar] [CrossRef]
  31. Gao, B.; Gupta, R.S. Phylogenomic analysis of proteins that are distinctive of Archaea and its main subgroups and the origin of methanogenesis. BMC Genom. 2007, 8, 86. [Google Scholar] [CrossRef]
  32. Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
  33. Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef]
  34. Lim, J.; Shin, S.G.; Lee, S.; Hwang, S. Design and use of group-specific primers and probes for real-time quantitative PCR. Front. Environ. Sci. Eng. China 2011, 5, 28–39. [Google Scholar] [CrossRef]
  35. Taylor, S.C.; Nadeau, K.; Abbasi, M.; Lachance, C.; Nguyen, M.; Fenrich, J. The ultimate qPCR experiment: Producing publication quality, reproducible data the first time. Trends Biotechnol. 2019, 37, 761–774. [Google Scholar] [CrossRef] [PubMed]
  36. Li, E.; Saleem, F.; Edge, T.A.; Schellhorn, H.E. Assessment of crAssphage as a human fecal source tracking marker in the lower Great Lakes. Sci. Total Environ. 2024, 912, 168840. [Google Scholar] [CrossRef] [PubMed]
  37. United States Environmental Protection Agency (USEPA). Cryptosporidium: Drinking Water Health Advisory; Office of Science and Technology, Office of Water: Washington, DC, USA, 2001. Available online: https://www.epa.gov/sdwa/drinking-water-health-advisories-has (accessed on 1 March 2023).
  38. Health Canada. Guidelines for Canadian Drinking Water Quality: Guideline Technical Document—Enteric Protozoa: Giardia and Cryptosporidium; Water and Air Quality Bureau, Healthy Environments and Consumer Safety Branch, Health Canada: Ottawa, ON, Canada, 2019; Catalogue No. H144-13/10-2018E-PDF. [Google Scholar]
  39. Choudhary, A.; Gupta, N.; Ahmad, H.; Mirdha, B.R. Morphological variations on microscopy in oocysts of coccidian parasites: A prospective study from a tertiary care hospital in north India. Microsc. Res. Tech. 2017, 80, 969–972. [Google Scholar] [CrossRef] [PubMed]
  40. Sammarro Silva, K.J.; Sabogal-Paz, L.P. Analytical challenges and perspectives of assessing viability of Giardia muris cysts and Cryptosporidium parvum oocysts by live/dead simultaneous staining. Environ. Technol. 2022, 43, 60–69. [Google Scholar] [CrossRef] [PubMed]
  41. Hadfield, S.J.; Robinson, G.; Elwin, K.; Chalmers, R.M. Detection and differentiation of Cryptosporidium spp. in human clinical samples by use of real-time PCR. J. Clin. Microbiol. 2011, 49, 918–924. [Google Scholar] [CrossRef] [PubMed]
  42. Saleem, F.; Li, E.; Tran, K.L.; Rudra, B.; Edge, T.A.; Schellhorn, H.E.; Gupta, R.S. Utilizing novel Escherichia coli-specific conserved signature proteins for enhanced monitoring of recreational water quality. MicrobiologyOpen 2024, 13, e1410. [Google Scholar] [CrossRef] [PubMed]
  43. Wong, S.Y.; Paschos, A.; Gupta, R.S.; Schellhorn, H.E. Insertion/deletion-based approach for the detection of Escherichia coli O157: H7 in freshwater environments. Environ. Sci. Technol. 2014, 48, 11462–11470. [Google Scholar] [CrossRef]
  44. Mthethwa, N.P.; Amoah, I.D.; Reddy, P.; Bux, F.; Kumari, S. Fluorescence and colorimetric LAMP-based real-time detection of human pathogenic Cryptosporidium spp. from environmental samples. Acta Trop. 2022, 235, 106606. [Google Scholar] [CrossRef]
  45. Ki, J.S. Hypervariable regions (V1–V9) of the dinoflagellate 18S rRNA using a large dataset for marker considerations. J. Appl. Phycol. 2012, 24, 1035–1043. [Google Scholar] [CrossRef]
  46. Boyle, B.; Dallaire, N.; MacKay, J. Evaluation of the impact of single nucleotide polymorphisms and primer mismatches on quantitative PCR. BMC Biotechnol. 2009, 9, 75. [Google Scholar] [CrossRef] [PubMed]
  47. Artesi, M.; Bontems, S.; Göbbels, P.; Franckh, M.; Maes, P.; Boreux, R.; Meex, C.; Melin, P.; Hayette, M.P.; Bours, V.; et al. A recurrent mutation at position 26340 of SARS-CoV-2 is associated with failure of the E gene quantitative reverse transcription-PCR utilized in a commercial dual-target diagnostic assay. J. Clin. Microbiol. 2020, 58, 10–1128. [Google Scholar] [CrossRef] [PubMed]
  48. McIlroy, S.J.; Tillett, D.; Petrovski, S.; Seviour, R.J. Non-target sites with single nucleotide insertions or deletions are frequently found in 16S rRNA sequences and can lead to false positives in fluorescence in situ hybridization (FISH). Environ. Microbiol. 2011, 13, 33–47. [Google Scholar] [CrossRef] [PubMed]
  49. Thorsen, J.; Brejnrod, A.; Mortensen, M.; Rasmussen, M.A.; Stokholm, J.; Al-Soud, W.A.; Sørensen, S.; Bisgaard, H.; Waage, J. Large-scale benchmarking reveals false discoveries and count transformation sensitivity in 16S rRNA gene amplicon data analysis methods used in microbiome studies. Microbiome 2016, 4, 62. [Google Scholar] [CrossRef] [PubMed]
  50. Hadfield, S.J.; Pachebat, J.A.; Swain, M.T.; Robinson, G.; Cameron, S.J.; Alexander, J.; Hegarty, M.J.; Elwin, K.; Chalmers, R.M. Generation of whole genome sequences of new Cryptosporidium hominis and Cryptosporidium parvum isolates directly from stool samples. BMC Genom. 2015, 16, 650. [Google Scholar] [CrossRef]
  51. O’Hara, S.P.; Chen, X.M. The cell biology of Cryptosporidium infection. Microbes Infect. 2011, 13, 721–730. [Google Scholar] [CrossRef]
  52. Mthethwa, N.P.; Amoah, I.D.; Reddy, P.; Bux, F.; Kumari, S. Development and evaluation of a molecular based protocol for detection and quantification of Cryptosporidium spp. in wastewater. Exp. Parasitol. 2022, 234, 108216. [Google Scholar] [CrossRef]
  53. Ruiz-Villalba, A.; Ruijter, J.M.; van den Hoff, M.J. Use and misuse of Cq in qPCR data analysis and reporting. Life 2021, 11, 496. [Google Scholar] [CrossRef]
  54. Robinson, G.; Elwin, K.; Jones, M.; Chalmers, R.M. A comparison of qPCR and microscopy for the detection and enumeration of Cryptosporidium oocysts from drinking water. J. Med. Microbiol. 2023, 72, 001715. [Google Scholar] [CrossRef]
  55. Mahmudunnabi, R.G.; Pannu, A.S.; Nguyen, N.T.; Stratton, H.M.; Shiddiky, M.J. Avoiding commercial kit-based DNA isolation and purification steps: A rapid method for Cryptosporidium oocyst detection. Sens. Diagn. 2025, 4, 229–238. [Google Scholar] [CrossRef]
  56. Li, Y.; Deng, F.; Hall, T.; Vesey, G.; Goldys, E.M. CRISPR/Cas12a-powered immunosensor suitable for ultra-sensitive whole Cryptosporidium oocyst detection from water samples using a plate reader. Water Res. 2021, 203, 117553. [Google Scholar] [CrossRef]
  57. Garafutdinov, R.R.; Galimova, A.A.; Sakhabutdinova, A.R. The influence of quality of primers on the formation of primer dimers in PCR. Nucleosides Nucleotides Nucleic Acids 2020, 39, 1251–1269. [Google Scholar] [CrossRef]
  58. Wang, H.; Liu, X.; Wang, Y.; Zhang, S.; Zhang, G.; Han, Y.; Li, M.; Liu, L. Spatial and temporal dynamics of microbial community composition and factors influencing the surface water and sediments of urban rivers. J. Environ. Sci. 2023, 124, 187–197. [Google Scholar] [CrossRef]
  59. Paruch, L.; Paruch, A.M. An Overview of Microbial Source Tracking Using Host-Specific Genetic Markers to Identify Origins of Fecal Contamination in Different Water Environments. Water 2022, 14, 1809. [Google Scholar] [CrossRef]
  60. Cotner, J.B.; Hall, E.K.; Scott, J.T.; Heldal, M. Freshwater bacteria are stoichiometrically flexible with a nutrient composition similar to seston. Front. Microbiol. 2010, 1, 132. [Google Scholar] [CrossRef]
Water 17 02498 g001
Figure 1. Sanger sequencing sequence conservation validation of the large CSP amplicon (934 bp) against the corresponding CSP gene of C. parvum (XP_627584.1 from NCBI RefSeq). These two sequences shared an identity of 99.89%, with no mismatch but a gap in the amplicon (highlighted).
Figure 1. Sanger sequencing sequence conservation validation of the large CSP amplicon (934 bp) against the corresponding CSP gene of C. parvum (XP_627584.1 from NCBI RefSeq). These two sequences shared an identity of 99.89%, with no mismatch but a gap in the amplicon (highlighted).
Water 17 02498 g001
Water 17 02498 g002
Figure 2. The standard curve describing efficiency and quality parameters for the Cryptosporidium-specific CSP-based qPCR assay.
Figure 2. The standard curve describing efficiency and quality parameters for the Cryptosporidium-specific CSP-based qPCR assay.
Water 17 02498 g002
Water 17 02498 g003
Figure 3. Detection sensitivity of the CSP-based Cryptosporidium-specific qPCR assay in the presence of Salmon and complex environmental DNA.
Figure 3. Detection sensitivity of the CSP-based Cryptosporidium-specific qPCR assay in the presence of Salmon and complex environmental DNA.
Water 17 02498 g003
Table 1. Primers and probe sequences used for CSP-based Cryptosporidium-specific qPCR and Sanger sequencing assays.
Table 1. Primers and probe sequences used for CSP-based Cryptosporidium-specific qPCR and Sanger sequencing assays.
Assay TypePrimer/ProbeSequence (5′-3′)Size (bp)
qPCRForwardGAATTAAGTCRGAACTGATTGC146
ReverseCGAAGAAATTTGCGAATCATCA
Probe(FAM *)CTCAACTCAAAATAACAATTCTGTTAGTGA(MGBNFQ *)
Sanger
Sequencing		ForwardTGAGCTTCCGACTGGAATTAAG911
ReverseTTCCTGCAGAGTGTTTATAGAAGG
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Saleem, F.; Li, E.; Tran, K.L.; Bello, S.; Weir, S.; Edge, T.A.; Gupta, R.S.; Schellhorn, H.E. Development and Application of a Novel Conserved Signature Protein/Gene-Based qPCR Strategy for Improved Cryptosporidium Surveillance in Recreational Waters. Water 2025, 17, 2498. https://doi.org/10.3390/w17172498

AMA Style

Saleem F, Li E, Tran KL, Bello S, Weir S, Edge TA, Gupta RS, Schellhorn HE. Development and Application of a Novel Conserved Signature Protein/Gene-Based qPCR Strategy for Improved Cryptosporidium Surveillance in Recreational Waters. Water. 2025; 17(17):2498. https://doi.org/10.3390/w17172498

Chicago/Turabian Style

Saleem, Faizan, Enze Li, Kevin L. Tran, Sarah Bello, Susan Weir, Thomas A. Edge, Radhey S. Gupta, and Herb E. Schellhorn. 2025. "Development and Application of a Novel Conserved Signature Protein/Gene-Based qPCR Strategy for Improved Cryptosporidium Surveillance in Recreational Waters" Water 17, no. 17: 2498. https://doi.org/10.3390/w17172498

APA Style

Saleem, F., Li, E., Tran, K. L., Bello, S., Weir, S., Edge, T. A., Gupta, R. S., & Schellhorn, H. E. (2025). Development and Application of a Novel Conserved Signature Protein/Gene-Based qPCR Strategy for Improved Cryptosporidium Surveillance in Recreational Waters. Water, 17(17), 2498. https://doi.org/10.3390/w17172498

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop