Next Article in Journal
Analysis of Regional Water and Energy Consumption Considering Economic Development
Next Article in Special Issue
Antimicrobial Resistant Bacteria in Shrimp and Shrimp Farms of Bangladesh
Previous Article in Journal
Altitudinal Gradient Characteristics of Spatial and Temporal Variations of Snowpack in the Changbai Mountain and Their Response to Climate Change
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Water
Volume 13
Issue 24
10.3390/w13243581
water-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Could Fish Feeding Behaviour and Size Explain Prevalence Differences of the Nematode Eustrongylides excisus among Species? The Case Study of Lake Garda

by
Vasco Menconi
1,
Perla Tedesco
2,
Paolo Pastorino
1,*,
Ivano Confortini
3,
Giuseppe Esposito
1,
Mattia Tomasoni
1,
Davide Mugetti
1,
Andrea Gustinelli
2,
Alessandro Dondo
1,
Elisabetta Pizzul
4,
Maria Letizia Fioravanti
2 and
Marino Prearo
1
1
The Veterinary Medical Research Institute for Piemonte, Liguria and Valle d’Aosta, Via Bologna 148, 10154 Torino, Italy
2
Dipartimento di Scienze Mediche Veterinarie, Alma Mater Studiorum, 40064 Ozzano dell’Emilia, Italy
3
Servizio Tutela Faunistico Ambientale, Provincia di Verona, 37122 Verona, Italy
4
Department of Life Sciences, University of Trieste, Via Giorgieri 10, 34127 Trieste, Italy
*
Author to whom correspondence should be addressed.
Water 2021, 13(24), 3581; https://doi.org/10.3390/w13243581
Submission received: 5 October 2021 / Revised: 4 December 2021 / Accepted: 10 December 2021 / Published: 14 December 2021
(This article belongs to the Special Issue Pathogens of Zoonotic Importance in the Aquatic Environment: Implications for Environmental and Human Health)
Browse Figures
Versions Notes

Abstract

:
The nematode Eustrongylides excisus is a parasite of freshwater fish- and fish-eating birds, with known differences on prevalence values among fish species. Thus, the present study aims to explore the hypothesis that the feeding behavior and the size of fish belonging to different trophic levels could explain such differences. For that, 14 sampling sites were selected to perform a fish parasitological survey on Lake Garda (Italy) during spring-summer 2020. Amplification of nuclear ribosomal internal transcribed spacer (ITS) rDNA sequences of nematodes morphologically ascribable to the genus Eustrongylides allowed to identify them as E. excisus. From the five studied fish species (Perca fluviatilis, Lepomis gibbous, Coregonus lavaretus, Alosa fallax lacustris and Micropterus salmoides), only three presented the parasite E. excisus: P. fluviatilis, L. gibbous and M. salmoides, with significant differences in prevalence values among species (p = 0.002). Additionally, there were differences in prevalence values within the same fish species captured from different sampling sites. Findings showed that mainly piscivorous fish were positive for E. excisus and how the prevalence was highest in M. salmoides. As regard the fish size, a negative correlation between body size and E. excisus was found in P. fluviatilis due to the feeding habit of juvenile perch which feed mainly zooplankton and benthic invertebrates (i.e., oligochaetes, which are the first intermediate hosts of E. excisus). The study findings advance novel knowledge in the field of pathogens of zoonotic importance in the aquatic environment.

Graphical Abstract

1. Introduction

Nematodes ascribable to the genus Eustrongylides Jagerskiold, 1909 (Family: Dioctophymatidae) are large, red, grossly visible parasites that infect numerous fish species and fish–eating birds [1]. Many species have been described within the genus but only three are considered valid: Eustrongylides tubifex, E. excisus, and E. ignotus [2]. Eustrongylides spp. have a heteroxenous life cycle. Adults inhabit the mucosa of the oesophagus, proventriculus or intestine of piscivore birds such as Ciconiiformes, Anseriformes, Gaviiformes, and Pelecaniformes [3]. The eggs are released through the stool into the aquatic environment where oligochaetes (i.e., Tubificidae and Lumbriculidae) are the first intermediate host [2,4,5]. Planktivorous, benthivorous and pelagic fish, as well as amphibians and/or reptiles are second intermediate hosts. Eustrongylid nematodes have been described in 17 orders of fish worldwide to date [6,7,8,9,10]. Furthermore, predatory fish such as pikeperch (Sander lucioperca) and pike (Esox spp.), amphibians, and reptiles [2,11] may act as paratenic hosts and humans as accidental hosts [12]. Species of the genus Eustrongylides are freshwater fish–borne zoonotic nematodes, of which E. excisus is the most relevant species [13].
Eustrongylidosis occurs after the consumption of raw or undercooked fish products [10,14]; however, human infection has been rarely recorded to date [14,15]. The presence of larvae in the peritoneal cavity results in severe abdominal pain within 24 h after eating contaminated fish [16,17,18]. Eberhard and Ruiz-Tiben [19] described a case of human infection caused by female Eustrongylides spp. larva isolated from the skin of the lower limb. Treatment is surgical and entails removal of the larvae. As in other parasitic zoonotic infections such as diphyllobothriasis and opisthorchiasis, the leading cause is the consumption of raw or semi–cooked infected freshwater fish products [20] in certain cultural and socioeconomical conditions [21]. The occurrence of various zoonotic parasites in lacustrine fish species has been recently reported in Italy, mainly involving cestodes (Dibothriocephalus latus), trematodes (Clinostomum complanatum), and nematodes (E. excisus) [14,22,23]. Eustrongylides excisus was isolated in several fish species (i.e., Perca fluviatilis, Atherina boyeri, Micropterus salmoides) in central Italy [14,24,25], and in a subalpine lake in northwest Italy (P. fluviatilis, M. salmoides, L. gibbosus) [10]. On this path, it was noted a significant difference in prevalence values between such fish species [10]. Thus, providing original and novel knowledge, the present study aims to explore if feeding behaviour and size could explain the difference in prevalence values among fish species belonging to different trophic levels. The study was focused on Lake Garda, one the largest subalpine lakes in northern Italy [26]. Indeed, subalpine lakes are valuable resources for tourism, agriculture, drinking water, and fisheries. Recreational and commercial fishing contribute to the economy of local markets. Thus, the consumption of undercooked or raw fish poses potential risks for human health.

2. Materials and Methods

2.1. Study Area

Lake Garda is Italy’s largest lake (water volume 49 km3; surface area 368 km2) (Figure 1) and among the deepest subalpine lakes in the country (maximum depth−350 m) [26]. The lake is divided into two basins separated by an underwater ridge connecting Punta S. Vigilio with the Sirmione Peninsula. The western basin is largest and deepest while the eastern basin (maximum depth−80 m) makes up less than 7% of the lake’s overall volume [27]. The main inflow is the Sarca River at the northern end of the lake; other minor tributaries enter at the western and the northern shore. The diversity of habitats allows for various fish communities, including species of conservation interest or relevant for recreational and commercial fishing [28].

2.2. Parasitological Examination

This parasitological survey was carried out during the spring–summer of 2020. With the collaboration of local commercial fishermen, a total of 423 fish of various species were caught at 14 sampling sites (Figure 1). The sites were selected to cover most of the surface area of the lake devoted to commercial and recreational fishing (Figure 1). Fish were morphologically identified to the species level according to Kottelat and Freyhof [29]: Perca fluviatilis (n = 212), Lepomis gibbous (n = 129), Coregonus lavaretus (n = 42), Alosa fallax lacustris (n = 20) and Micropterus salmoides (n = 20). The lake depth at the sampling sites ranged from −1 to −110 m.
Fish species were caught at a maximum depth of −20 m in the littoral zone. Individuals were collected using mesopelagic gill nets (mesh size 2.5 cm) and kept refrigerated at 4 °C until arrival at the Istituto Zooprofilattico Sperimentale del Piemonte, Liguria e Valle d’Aosta (Turin, Italy). Biometrical features (total body weight and total length) were recorded for each specimen before anatomopathological examination and sexing. Parasitological examination was performed according to European regulations [30,31]. Briefly, the visceral organs were removed from each individual, placed in Petri dishes containing physiological (salinity 0.9%) solution for visual inspection, and then digested using an enzymatic digestion method based on the Codex Alimentarius Commission [32] and EU Regulation (EC) No. 2075/2005 [30]. The skeletal musculature was sliced (2–3 mm thick), visually observed and inspected by transillumination (UVP white light transilluminators, TW–43, Analytik Jena, Jena, Germany) to detect encysted parasites. The location of each larva was recorded by body quadrant: anterior ventral (AV), anterior dorsal (AD), posterior ventral (VP), posterior dorsal (DP), and visceral cavity (VC). Nematodes were isolated from host tissues with pointed light metal forceps and a fine needle, rinsed in deionized water, and fixed in 70% ethanol. Once fixed, the head and the tail of each larva were removed for morphological examination in light microscopy [33] and the central part of the body devoid of taxonomic features was used for molecular analysis. For observation in scanning electron microscopy (SEM), fixed specimens were dehydrated in a graded ethanol series, critical point dried, sputter coated with gold-palladium and observed using a Phenom XL G2 Desktop SEM (Thermo Fisher Scientific) operating at 5 kV.

2.3. Molecular Analysis

Molecular analyses were carried out following Mazzone et al. [34]. Briefly, genomic DNA was extracted from four nematodes by means of a PureLink® Genomic DNA Kit (Life Technologies, Carlsbad, CA, USA) following the manufacturer’s instructions. Amplification of the complete internal transcribed spacer (ITS) rDNA region was performed with primers 81_f-GTAACAAGGTTTCCGTAGGTGAA and ITS2.S_r–CCTGGTTAGTTTCTTTTCCTCCGC [35,36]. For the amplification, molecular grade water was used as a negative control, while a sequenced sample of Eustrongylides excisus from a previous study [34] was used as positive control. The amplified products were electrophoresed on 1% agarose gel stained with SYBR® Safe DNA Gel Stain (Thermo Fisher Scientific, Carlsbad, CA, USA) in 0.5× TBE. The amplicons were purified with Nucleo–Spin Gel and PCR Cleanup (Mackerey–Nagel, Düren, Germany) and sequenced on an ABI 3730 DNA analyser (StarSEQ, Mainz Germany).
The trace files were assembled with ContigExpress (VectorNTI Advance 11 software, Invitrogen, Carlsbad, CA, USA) and the consensus sequences were compared with previously published data using BLAST tools (https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 12 December 2021). The sequences generated in this study were deposited in GenBank under accession numbers MZ648893-MZ648894.

2.4. Statistical Analysis

Normality and homoscedasticity of data were assessed through the Shapiro–Wilk and Levene tests, respectively. Prevalence, mean intensity, and mean abundance of infestation were calculated for each species according to Bush et al. [37]. Differences in the prevalence of infestation between the fish species were tested using the chi-square test and the 95% confidence intervals (95% CI) were calculated. Since the null hypothesis for normal distribution could not be rejected, the non–parametric Kruskal–Wallis or Mann–Whitney U tests were used to reveal differences in biometrical features between the fish species per sampling site (only those that were tested positive for E. excisus) and differences in the site of larvae infestation in musculature quadrants [anterior ventral (AV), anterior dorsal (AD), posterior ventral (PV), posterior dorsal (PD)] and visceral cavity (VC). The Conover–Iman post–hoc test was used for multiple comparisons since the number of individuals for certain fish species was <20 (Table 1). Spearman’s rank correlation coefficient (ρS) was used to test for correlations between total body length and infection with nematode larvae. Significance was set at 0.05%. All basic statistics and analyses were carried out using R software (v. 4.0.5; R Core Team, 2021).

3. Results

Fishes resulted positive for the presence of E. excisus larvae were 13 out of 423 (3.07%) and all isolated parasite larvae were morphologically referred to the genus Eustrongylides spp. (Figure 2 and Figure 3). Among sampled fish species, only in Perca fluviatilis, Lepomis gibbosus and Micropterus salmoides, (Figure 3) larval stage of Eustrongylides were isolated. To note, no visible lesions in the external or internal organs were observed. All other fish species tested negative for nematode larvae. The prevalence of Eustrongylides spp. was: 12.5% (95% CI, 4.3–31%) and 3.70% (95% CI, 0.19–18.28%) in L. gibbosus from San Virgilio and Garda, respectively; 5.55% (95% CI, 0.99–18.14%) and 1.54% (95% CI, 0.08–8.21%) in P. fluviatilis from Lazise and Torri del Benaco, respectively; and 60% (95% CI, 31.27–83.18%) in M. salmoides from Pacengo. There were significant differences in nematode prevalence between fish species (chi-square, p = 0.002). There were significant differences in total length (Kruskal–Wallis, p = 0.005) and weight (Kruskal–Wallis, p = 0.004) of P. fluviatilis between sampling sites, with significant differences between Lazise and the other sites (Conover–Iman post-hoc test, p < 0.05 for all comparisons) (Table 1). A significant difference in total length (p = 0.001) and weight (p = 0.002) was noted for L. gibbosus between the sampling sites, with a marked difference between San Virgilio and the other sites (Conover–Iman post-hoc test, p < 0.05 for all comparisons) (Table 1). Total length and weight significantly differed in M. salmoides between Pacengo and Torri del Benaco (Mann–Whitney U-test; p = 0.001 and p = 0.003 for total length and weight, respectively). Spearman’s rank correlation showed a significant negative correlation between total body length and infection with Eustrongylides spp. in P. fluviatilis (ρs −0.140; p = 0.02). Table 2 presents the number, location (AV, AD, PV, PD muscular quadrants and VC) of nematode larvae, mean intensity, and mean abundance of infestation. There was a significant difference in larvae localization (AV = 8; PV = 1; AD = 2; PD = 2; VC = 2) (Kruskal–Wallis test, p = 0.008), with the highest number recorded in the AV muscle quadrant (Conover–Iman post-hoc test, p < 0.05 for all comparisons) (Table 2). The mean intensity (MI) of infestation ranged from 1 in P. fluviatilis and L. gibbosus to 1.33 in M. salmoides; the mean abundance (MA) ranged from 0.015 to 0.05 in P. fluviatilis and from 0.03 to 0.12 in L. gibbosus and was 0.8 in M. salmoides from Pacengo.
Amplification of the ITS rDNA sequences of nematodes morphologically ascribable to the genus Eustrongylides spp. showed they were identical to each other. BLAST analysis gave 100% identity with the sequence of E. excisus deposited by Mazzone et al. [34] and 99.73–99.74% identity with those of Pekmezci et al. [1].

4. Discussion

Parasites are an integral but frequently neglected part of ecosystems, where they cause either direct (e.g., mechanical destruction of cells) or indirect damage (e.g., withdrawal of nutrients and intoxication) to the host [38]. Fishery products are marketed as high-quality food items, making the question about the potential risk of infection with fish borne zoonotic parasites in humans highly relevant for public health. Recent studies have focused on the incidence and geographic distribution of Eustrongylides spp. in Italy [10,14,24,25]. The expansion of the geographical range of E. excisus may be linked to the recent rise in number and area of the cormorant population in northern Italy, where it is concentrated around large lakes and other pre-alpine water basins [10,39]. According to Atkinson et al. [40] the increase in ichthyophagous bird populations (final hosts), plays a critical role in the incidence of Eustrongylides spp. in fish. The prevalence we recorded in P. fluviatilis (1.54%) was lower than the 10%, 6.84% and 6% reported by [10,24,25], respectively. The prevalence value of 60% in M. salmoides reported here was higher than the 1.89% and the 10% reported by Branciari et al. [24] and Menconi et al. [10], respectively. In a recent paper, Menconi et al. [10] noted that the prevalence of L. gibbosus (18.3%) was far higher than what we recorded in this study. The difference could be related to the remote locations of the lakes they sampled, which were areas probably more favourable for nesting and habitation of fish-eating birds that are the final hosts for E. excisus [41]. Other environmental factors that may also contribute to the occurrence of E. excisus in fish species in Lake Garda include the biological characteristics and the abundance of intermediate and final hosts. For example, environmental conditions favourable for the growth of oligochaete populations play a pivotal role in sites with high prevalence of E. excisus in fish [9]. Additionally, as expected, the feeding behaviour of fish may explain the range of infected species: predatory fish may consume several infected preys and thus amplify the intensity of parasite infection [9]. The relationship between eutrophication and Eustrongylides spp. prevalence is another a key element to understand the epizootiology of this parasite. We found that mainly piscivorous fish were positive for E. excisus and that prevalence was highest in M. salmoides. Fish belonging to the centrarchidae family are the most important paratenic hosts [9]; however, since the frequency of fish predation by L. gibbosus is generally low, it probably acquires Eustrongylides spp. by feeding on infected oligochaetes [4]. As regard the fish size, the negative correlation between body size and Eustrongylides spp. infection in P. fluviatilis may be due to the feeding habit of juvenile perch [10], which feed mainly on zooplankton and benthic invertebrates (i.e., oligochaetes), while adults feed on macroinvertebrates and other fish [42,43,44]. Based on our data we could hypothesize that the high prevalence in young perch possibly results from feeding on infected oligochaetes.
The difference in parasite localization between muscular quadrants (AV = 8; PV = 1; AD = 2; PD = 2) and visceral cavity (VC = 2) could be due to larval migration after infestation of the fish host. Larvae acquisition occurs through the ingestion of infected prey, therefore their localization in the anterior ventral quadrant may be favoured. The European perch is an economic resource for local fishermen, and it is widely used in traditional cuisine. Within the present study, we particularly focused on this fish species as it is a suitable host for E. excisus.
Eustrongylides excisus infection in this commercially relevant fish may adversely affect consumer perception and pose a health risk. Other fish species (e.g., Coregonus lavaretus, and Alosa fallax lacustris) important for local commercial fisheries, they tested negative possibly due to the fact that they feed on planktonic crustaceans.
Changes in eating habits, increased global fish trading, and advances in transportation technologies have brought about considerable changes in the epidemiology of fish–borne parasitic zoonoses [15]. In response to the rising popularity of marinated, raw, or semi–cooked and ethnic fish dishes, health authorities have implemented measures to manage the risk of food–borne illness [30,31,45,46]. In addition, the Italian Ministry of Health [47] has introduced the concept of mandatory consumer information by fish sellers. Fish shops in Italy must display a sign with the following recommendation: “Products intended for raw consumption, marinated or not fully cooked, should be frozen for at least 96 h at −18 °C in a domestic freezer marked with three or more stars” [47]. These measures regard certain zoonotic parasites. Consumers can protect against zoonotic helminth infection by simply freezing fish that will be consumed raw or cooking.

5. Conclusions

The increased prevalence of Eustrongylides spp. in Italian lacustrine fish suggests its recent spread. Results from this study showed how Eustrongylides excisus prevalence was highest in piscivorous fish as Micropterus salmoides, suggesting that feeding behaviour could explain the difference in prevalence values among fish species belonging to different trophic levels. Moreover, the negative correlation found between body size and E. excisus infection in Perca fluviatilis clarifies the higher prevalence found in juvenile perch which feed mainly on zooplankton and benthic invertebrates as oligochaetes (the first intermediate hosts of E. excisus). Finally, this study integrates current data about E. excisus geographical distribution and fish host range in lacustrine environments. However, further studies are needed since numerous aspects of the biology, epidemiology, and control of Eustrongylides species are still scarce to date.

Author Contributions

Conceptualization, V.M. and P.P.; Data curation, P.P. and G.E.; Formal analysis, V.M. and M.L.F.; Investigation, V.M., P.T., P.P., I.C., G.E., M.T., D.M., A.G., A.D., E.P., M.L.F. and M.P.; Methodology, V.M., P.T., P.P., G.E., M.T., D.M., A.G., A.D., E.P., M.L.F. and M.P.; Project administration, M.P.; Supervision, M.P.; Writing—original draft, V.M. and M.P.; Writing—review & editing, P.T. and P.P. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Italian Ministry of Health, project IZS PLV 18/14 RC.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Acknowledgments

The authors express their special thanks to the Unione Pescatori Sportivi del Garda—UPSDG.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Pekmezci, G.Z.; Bolukbas, C.S. Morphological and molecular characterization of Eustrongylides excisus larvae (Nematoda: Dioctophymatidae) in Sander lucioperca (L.) from Northern Turkey. Parasitol. Res. 2021, 120, 2269–2274. [Google Scholar] [CrossRef]
  2. Measures, L.N. Revision of the genus Eustrongylides Jagerskiold, 1909 (Nematoda: Dioctophymatoidea) of piscivorous birds. Can. J. Zool. 2013, 66, 885–895. [Google Scholar] [CrossRef]
  3. Novakov, N.; Bjelic-Cabrilo, O.; Circovic, M.; Jubojevik, D.; Lujic, J. Eustrongylidosis of European Catfish (Siluris glaris). Bulg. J. Agric. Sci. 2013, 1, 72–76. [Google Scholar]
  4. Measures, L.N. Epizootiology, pathology, and description of Eustrongylides tubifex (Nematoda: Dioctophymatoidea) in fish. Can. J. Zool. 1988, 66, 2212–2222. [Google Scholar] [CrossRef]
  5. Measures, L.N. The development of Eustrongylides tubifex (Nematoda: Dioctophymatoidea) in oligochaetes. J. Parasitol. 1988, 74, 294–304. [Google Scholar] [CrossRef]
  6. Bangham, R.V. Parasites of Centrarchidae from southern Florida. Am. Fish. Soc. 1939, 68, 263–268. [Google Scholar] [CrossRef]
  7. Karmanova, E.M. Dioctophymidea of animals and man and the diseases which they cause. In Fundamentals of Nematodology; Amerind Publishing Co. Academy of Science of the U.S.S.R: New Delhi, India, 1968; p. 383. [Google Scholar]
  8. Spalding, M.G.; Bancroft, G.T.; Forrester, D.J. Epizootiology of eustrongylidosis in wading birds (Ciconiiformes) in Florida. J. Wildl. Dis. 1993, 29, 237–249. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  9. Coyner, D.F.; Spalding, M.G.; Forrester, D.J. Epizootiology of Eustrongylides ignotus in Florida: Distribution, density, and natural infections in intermediate hosts. J. Wildl. Dis. 2002, 38, 483–499. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  10. Menconi, V.; Riina, M.V.; Pastorino, P.; Mugetti, D.; Canola, S.; Pizzul, E.; Bona, M.C.; Dondo, A.; Acutis, P.L.; Prearo, M. First Occurrence of Eustrongylides spp. (Nematoda: Dioctophymatidae) in a Subalpine Lake in Northwest Italy: New Data on Distribution and Host Range. Int. J. Environ. Res. Public Health 2020, 17, 4171. [Google Scholar] [CrossRef] [PubMed]
  11. Goncharov, S.L.; Soroka, N.M.; Pashkevich, I.Y.; Dubovyi, A.I.; Bondar, A.O. Infection of predatory fish with larvae of Eustrongylides excisus (Nematoda, Dioctophymatidae) in the Delta of the Dnipro River and the Dnipro-Buh Estuary in Southern Ukraine. Vestn. Zool. 2018, 52, 137–144. [Google Scholar] [CrossRef] [Green Version]
  12. Guerin, P.F.; Marapendi, S.; MC Grail, L. Intestinal perforation caused by larval Eustrongylides. Morb. Mort. Week Rep. 1982, 31, 383–389. [Google Scholar]
  13. Ljubojevic, D.; Novakov, N.; Djordjevic, V.; Radosavljevic, V.; Pelic, M.; Cirkovic, M. Potential parasitic hazards for humans in fish meat. Procedia Food Sci. 2015, 5, 172–175. [Google Scholar] [CrossRef] [Green Version]
  14. Guardone, L.; Ricci, E.; Susini, F.; Polsinelli, E.; Guglielmone, G.; Armani, A. First detection of Eustrongylides excisus (Nematoda: Dioctophymatidae) in big-scale sand smelt (Atherina boyeri) from the lake Massaciuccoli (Northwest Tuscany, Italy): Implications for public health and seafood quality. Food Control 2020, 120, 107517. [Google Scholar] [CrossRef]
  15. Eiras, J.C.; Pavanelli, G.C.; Takemoto, R.M.; Nawa, Y. An overview of fish-borne nematodiases among returned travelers for recent 25 years–unexpected diseases sometimes far away from the origin. Korean J. Parasitol. 2018, 56, 215. [Google Scholar] [CrossRef]
  16. Centers for Disease Control. Intestinal perforation caused by larval Eustrongylides—Maryland. MMW 1982, 31, 383–384. [Google Scholar]
  17. Eberhard, M.L.; Hurwitz, H.; Sun, A.M.; Coletta, D. Intestinal perforation caused by larval Eustrongylides (Nematoda: Dioctophymatoidae) in New Jersey. Am. J. Trop. Med. Hyg. 1989, 40, 648–650. [Google Scholar] [CrossRef]
  18. Narr, L.L.; O’Donnell, J.G.; Libster, B.; Alessi, P.; Abraham, D. Eustrongylidiasis: A parasitic infection acquired by eating live minnow. Int. J. Osteopath. Med. 1996, 96, 400–402. [Google Scholar] [CrossRef] [Green Version]
  19. Eberhard, M.L.; Ruiz–Tiben, E. Cutaneous emergence of Eustrongylides in two persons from South Sudan. Am. J. Trop. Med. Hyg. 2014, 90, 315–317. [Google Scholar] [CrossRef] [Green Version]
  20. Chai, J.Y.; Murrell, K.D.; Lymbery, A.J. Fish-borne parasitic zoonoses: Status and issues. Int. J. Parasitol. 2005, 35, 1233–1254. [Google Scholar] [CrossRef]
  21. Macpherson, C.N. Human behaviour and the epidemiology of parasitic zoonoses. Int. J. Parasitol. 2005, 35, 1319–1331. [Google Scholar] [CrossRef] [PubMed]
  22. Gustinelli, A.; Menconi, V.; Prearo, M.; Caffara, M.; Righetti, M.; Scanzio, T.; Raglio, A.; Fioravanti, M.L. Prevalence of Diphyllobothrium latum (Cestoda: Diphyllobothriidae) plerocercoids in fish species from four Italian lakes and risk for the consumers. Int. J. Food Microbiol. 2016, 235, 109–112. [Google Scholar] [CrossRef] [PubMed]
  23. Menconi, V.; Manfrin, C.; Pastorino, P.; Mugetti, D.; Cortinovis, L.; Pizzul, E.; Pallavicini, A.; Prearo, M. First Report of Clinostomum complanatum (Trematoda: Digenea) in European Perch (Perca fluviatilis) from an Italian Subalpine Lake: A Risk for Public Health? Int. J. Environ. Res. Public Health 2020, 17, 1389. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  24. Branciari, R.; Ranucci, D.; Miraglia, D.; Valiani, A.; Veronesi, F.; Urbani, E.; Lo Vaglio, G.; Pascucci, L.; Franceschini, R. Occurrence of parasites of the genus Eustrongylides spp. (Nematoda: Dioctophymatidae) in fish caught in Trasimeno Lake, Italy. Ital. J. Food Saf. 2016, 5, 6130. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  25. Dezfuli, B.S.; Manera, M.; Lorenzoni, M.; Pironi, F.; Shinn, A.P.; Giari, L. Histopathology and the inflammatory response of European perch, Perca fluviatilis muscle infected with Eustrongylides sp. (Nematoda). Parasit. Vectors 2015, 8, 227. [Google Scholar] [CrossRef] [Green Version]
  26. Ciutti, F.; Beltrami, M.E.; Confortini, I.; Cianfanelli, S.; Cappelletti, C. Non-indigenous invertebrates, fish and macrophytes in Lake Garda (Italy). J. Limnol. 2020, 70, 315–320. [Google Scholar] [CrossRef] [Green Version]
  27. Salmaso, N.; Mosello, R.; Garibaldi, L.; Decet, F.; Brizzio, M.C.; Cordella, P. Vertical mixing as a determinant of trophic status in deep lakes: A case study from two lakes south of the Alps (Lake Garda and Lake Iseo). J. Limnol. 2003, 62, 33–41. [Google Scholar] [CrossRef]
  28. Volta, P.; Jeppesen, E.; Sala, P.; Galafassi, S.; Foglini, C.; Puzzi, C.; Winfield, I.J. Fish assemblages in deep Italian subalpine lakes: History and present status with an emphasis on non-native species. Hydrobiologia 2018, 824, 255–270. [Google Scholar] [CrossRef]
  29. Kottelat, M.; Freyhof, J. Handbook of European freshwater fishes. Publications Kottelat. Copeia 2008, 2008, 725–727. [Google Scholar]
  30. EC (European Community). Regulation (EC) No. 2075/2005 of the European Parliament and of the Council of 5 December 2005 Laying down Specific Rules on Official Controls for Trichinella in Meat. OJEU. 338, 75–76. Available online: https://eur-lex.europa.eu/legal-content/EN/ALL/?uri=CELEX%3A32005R2075 (accessed on 12 December 2021).
  31. EFSA. Scientific Opinion on Risk Assessment of Parasites in Fishery Products. EFSA Panel on Biological Hazards. Available online: https://www.sanipes.gob.pe/archivos/2010-EFSA.pdf (accessed on 10 June 2021).
  32. Codex Alimentarius Commission. Standard for salted Atlantic Herring and Salted Sprat. Codex Stan, 244–2004, 1–8. 2004. Available online: https://www.fao.org/fao-who-codexalimentarius/codex-texts/all-standards/en/ (accessed on 10 June 2021).
  33. Moravec, F. Nematodes parasitic in fishes as larvae. In Parasitic Nematodes of Freshwater Fishes of Europe; Moravec, F., Ed.; Kluwer Academic Publishers: Dordrecht, The Netherlands, 1994; pp. 374–421. [Google Scholar]
  34. Mazzone, A.; Caffara, M.; Gustinelli, A.; Agnetti, F.; Sgariglia, E.; Lo Vaglio, G.; Fioravanti, M.L. Morphological and molecular characterization of larval and adult stages of Eustrongylides excisus (Nematoda: Dioctophymatoidea) with histopathological observations. J. Parasitol. 2019, 105, 882–889. [Google Scholar] [CrossRef]
  35. Cribb, T.H.; Anderson, G.R.; Adlard, R.D.; Bray, R.A. A DNA-based demonstration of a three-host lifecycle for the Bivesiculidae (Platyhelminthes: Digenea). Int. J. Parasitol. 1998, 28, 1791–1795. [Google Scholar] [CrossRef]
  36. Gustinelli, A.; Caffara, M.; Florio, D.; Otachi, E.O.; Wathuta, E.M.; Fioravanti, M.L. First description of the adult stage of Clinostomum cutaneum Paperna, 1964 (Digenea: Clinostomidae) from grey herons Ardea cinerea L. and a redescription of the metacercaria from the Nile tilapia Oreochromis niloticus niloticus (L.) in Kenya. Syst. Parasitol. 2010, 76, 39–51. [Google Scholar] [CrossRef]
  37. Bush, A.O.; Lafferty, K.D.; Lotz, J.M.; Shostak, A.W. Parasitology meets ecology on its own terms: Margolis et al. revisited. J. Parasitol. 1997, 83, 575–583. [Google Scholar] [CrossRef] [PubMed]
  38. Klimpel, S.; Kuhn, T.; Münster, J.; Dörge, D.D.; Klapper, R.; Kochmann, J. Parasites of Marine Fish and Cephalopods, 1st ed.; Springer International Publishing, 2019; Chapter 1; pp. 1–10. Available online: https://link.springer.com/book/10.1007/978-3-030-16220-7 (accessed on 12 December 2021).
  39. Gagliardi, A.; Preatoni, D.; Wauters, L.; Martinoli, A. Selective predators or choosy fishermen? Relation between fish harvest, prey availability and great cormorant (Phalacrocorax carbo sinensis) diet. Ital. J. Zool. 2015, 82, 544–555. [Google Scholar] [CrossRef] [Green Version]
  40. Atkinson, C.T.; Thomas, N.J.; Hunter, D.B. Parasitic Diseases of Wild Birds. In Eustrongylidosis; Spalding, G.M., Forrester, D.J., Eds.; John Wiley & Sons: Hoboken, NJ, USA, 2009; pp. 289–315. [Google Scholar]
  41. Cole, R. Field Manual of Wildlife Diseases. General Field Procedures and Disease of Birds. In Eustrongyloidosis; Milton, F., Franson, J.C., Eds.; US Geological Survey, 2012; pp. 223–228. Available online: https://pubs.usgs.gov/itr/1999/field_manual_of_wildlife_diseases.pdf (accessed on 12 December 2021).
  42. Guma, S.A. The food and feeding habits of young perch, Perca fluviatilis, in Windermere. Freshw. Biol. 1978, 8, 177–187. [Google Scholar] [CrossRef]
  43. Persson, L. Asymmetries in competitive and predatory interactions in fish populations. In Size-Structured Populations-Ecology and Evolution; Ebenman, B., Persson, L., Eds.; Springer: Berlin, Germany, 1988; pp. 203–218. [Google Scholar]
  44. Berezina, N.A.; Strelnikova, A.P. Relationships between the Food Spectrum of Perch Fry (Perca fluviatilis L.) and the Structure of Zoobenthos in Experimental Mesocosms. Biol. Bull. Russ. Acad. Sci. 2001, 28, 311–318. [Google Scholar] [CrossRef]
  45. Codex Alimentarius Commission. Report of the Eighth Session of the joint FAO/WHO Codex Alimentarius Commission: Recommended International Standard for Quick Frozen Filet of Cod and Haddock. 1971. Available online: https://www.fao.org/3/c0531e/C0531E00.htm (accessed on 10 June 2021).
  46. European Regulation (EC). No 853/2004 of the European Parliament and of the Council of 29 April 2004 Laying Down Specific Hygiene Rules for Food of Animal Origin. Available online: http://data.europa.eu/eli/reg/2004/853/oj (accessed on 10 June 2021).
  47. Legeslative Decree, 2013. Decreto 17/07/2013; GU Serie Generale n.187 del 10–08–2013. pp. 31–32. Available online: https://www.sopranciodue.it/en/business-to-do-safety/fire-protection-laws (accessed on 10 June 2021).
Water 13 03581 g001 550
Figure 1. Location of sampling sites (asterisks); where fish species were found positive for Eustrongylides excisus are indicated in red asterisks. The numbers in brackets indicate the capture of a single fish species: 1-Perca fluviatilis; 2-Micropterus salmoides; 3-Lepomis gibbosus.
Figure 1. Location of sampling sites (asterisks); where fish species were found positive for Eustrongylides excisus are indicated in red asterisks. The numbers in brackets indicate the capture of a single fish species: 1-Perca fluviatilis; 2-Micropterus salmoides; 3-Lepomis gibbosus.
Water 13 03581 g001
Water 13 03581 g002 550
Figure 2. (A) Macroscopic examination of the sampled fish, and parasites located in the swim bladder (black arrows). Eustrongylides excisus larva: anterior end (B), and tail (C).
Figure 2. (A) Macroscopic examination of the sampled fish, and parasites located in the swim bladder (black arrows). Eustrongylides excisus larva: anterior end (B), and tail (C).
Water 13 03581 g002
Water 13 03581 g003 550
Figure 3. SEM micrographs of Eustrongylides excisus larva. (A): anterior end; (B): detail of cephalic papillae; (C): tail; (D): detail of caudal papillae.
Figure 3. SEM micrographs of Eustrongylides excisus larva. (A): anterior end; (B): detail of cephalic papillae; (C): tail; (D): detail of caudal papillae.
Water 13 03581 g003
Table
Table 1. Biometrical features (weight and total length; mean ± standard deviation), sex, and number (N) of fish species from sampling sites in Lake Garda. ND = sex not determined. Lowercase letters denote differences revealed by the Conover–Iman post–hoc test.
Table 1. Biometrical features (weight and total length; mean ± standard deviation), sex, and number (N) of fish species from sampling sites in Lake Garda. ND = sex not determined. Lowercase letters denote differences revealed by the Conover–Iman post–hoc test.
Sampling SiteSpeciesWeight (g)Total Length (cm)NMaleFemaleND
Peschiera del GardaAlosa fallax57.1 ± 13.019.5 ± 1.9204555—
LaziseCoregonus lavaretus120.2 ± 28.023.9 ± 2.165050—
Pacengo91.8 ± 80.420.1 ± 7.155050—
Peschiera del Garda99.8 ± 9.123.0 ± 0.656040—
Riva del Garda321.5 ± 53.831.8 ± 3.250100—
Sirmione115.21 ± 20.523.4 ± 1.0105050—
Toscolano Maderno277.2 ± 50.530.1 ± 1.91145.554.5—
BardolinoLepomis gibbosus50.6 ± 41.9 b12.2 ± 3.0 b3026.750.023.3
Garda26.0 ± 12.4 b11.0 ± 1.4 b2734.665.4—
San Vigilio86.4 ± 23.2 b16.5 ± 2.0 a2454.245.8—
Toscolano Maderno62.3 ± 38.9 b13.29 ± 5.8 b4837.562.5—
PacengoMicropterus salmoides93.0 ± 48.8 a33.5±29.1 a104060—
Torri del Benaco1168.7 ± 571.0 b40.3 ± 3.2 b1066.733.3—
Baia delle SirenePerca fluviatilis120.4 ± 33.4 b20.2 ± 1.8 b50100—
Brancolino120.5 ± 27.3 b21.0 ± 1.3 b1421.478.6—
Garda99.36 ± 20.6 b20.41 ± 1.5 b1118.281.8—
Localita la Pozza125.3 ± 31.6 b20.8 ± 1.9 b42565—
Lazise94.7±24.6 a18.7 ± 1.9 a303.396.7—
Riva Cornicello111.5±26.8 b20.6 ± 1.6 b110100—
San Vigilio122.4 ± 42.4 b21.0 ± 2.0 b1216.783.3—
Torri del Benaco98.6 ± 32.6 b20.9 ± 2.0 b6516.983.1—
Toscolano Maderno100.6 ± 33.8 b20 5 ± 2.1 b604565—
Table
Table 2. Number of fish analysed (N) and prevalence of Eustrongylides excisus in freshwater fish species from Lake Garda. The number and the location [lowercase letters: anterior ventral (AV), anterior dorsal (AD), posterior ventral (VP), posterior dorsal (DP), visceral cavity (VC)] of nematode larvae, and the mean intensity (MI) and mean abundance (MA) for each fish species are reported.
Table 2. Number of fish analysed (N) and prevalence of Eustrongylides excisus in freshwater fish species from Lake Garda. The number and the location [lowercase letters: anterior ventral (AV), anterior dorsal (AD), posterior ventral (VP), posterior dorsal (DP), visceral cavity (VC)] of nematode larvae, and the mean intensity (MI) and mean abundance (MA) for each fish species are reported.
Sampling SiteFish SpeciesNPositiveP (%; 95% CI)N of larvaeMIMA
LazisePerca fluviatilis3625.55 (0.99–18.14)2AV10.05
Torri del BenacoPerca fluviatilis6511.54 (0.08–8.21)1AV10.015
PacengoMicropterus salmoides10660 (31.27–83.18)3AV;2AD;1PV;2VC1.330.8
GardaLepomis gibbosus2713.7 (0.19–18.28)1AV10.03
San VigilioL. gibbosus24312.5 (4.3–31)1AN; 2PD10.12
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Menconi, V.; Tedesco, P.; Pastorino, P.; Confortini, I.; Esposito, G.; Tomasoni, M.; Mugetti, D.; Gustinelli, A.; Dondo, A.; Pizzul, E.; et al. Could Fish Feeding Behaviour and Size Explain Prevalence Differences of the Nematode Eustrongylides excisus among Species? The Case Study of Lake Garda. Water 2021, 13, 3581. https://doi.org/10.3390/w13243581

AMA Style

Menconi V, Tedesco P, Pastorino P, Confortini I, Esposito G, Tomasoni M, Mugetti D, Gustinelli A, Dondo A, Pizzul E, et al. Could Fish Feeding Behaviour and Size Explain Prevalence Differences of the Nematode Eustrongylides excisus among Species? The Case Study of Lake Garda. Water. 2021; 13(24):3581. https://doi.org/10.3390/w13243581

Chicago/Turabian Style

Menconi, Vasco, Perla Tedesco, Paolo Pastorino, Ivano Confortini, Giuseppe Esposito, Mattia Tomasoni, Davide Mugetti, Andrea Gustinelli, Alessandro Dondo, Elisabetta Pizzul, and et al. 2021. "Could Fish Feeding Behaviour and Size Explain Prevalence Differences of the Nematode Eustrongylides excisus among Species? The Case Study of Lake Garda" Water 13, no. 24: 3581. https://doi.org/10.3390/w13243581

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop