Some Observations on Phytoplankton Community Structure, Dynamics and Their Relationship to Water Quality in Five Santiago Island Reservoirs, Cape Verde
Abstract
:1. Introduction
- The variation in phytoplankton taxonomic composition within each reservoir is mainly governed by local environmental conditions due to the high dispersal ability of phytoplankton at small spatial scales (Santiago Island scale).
- Phytoplankton abundance, community composition, and cyanobacterial dominance are dependent on the quantity of the water and nutrient inputs in the reservoirs.
2. Materials and Methods
2.1. Study Area: Regional Context
2.2. Geological Units and Land Use/Land Cover Characterization of Reservoir Drainage Basins
2.3. Meteorological Characterization
2.4. Sampling Sites and Periods
2.5. Environmental Parameters
2.6. Phytoplankton
2.6.1. Phytoplankton Assemblages and Diversity
2.6.2. Risk Levels of Toxic Cyanobacteria Occurrence
2.7. Statistical Analysis
2.7.1. Environmental Parameters
2.7.2. Phytoplankton
2.7.3. Relationship between Environmental Variables and Phytoplankton Descriptors
3. Results
3.1. Geological Units and LULC Characterization
3.1.1. Characterization of Geological Units
3.1.2. LULC Characterization
3.2. Meteorological Characterization
3.3. Environmental Parameters: Spatial and Temporal Patterns
3.3.1. Global Trends
3.3.2. Spatial Patterns
3.3.3. Temporal Patterns
3.4. Phytoplankton
3.4.1. Phytoplankton Assemblages and Diversity
3.4.2. Risk Levels of Toxic Cyanobacteria Occurrence
3.4.3. Relationship between Environmental Variables and Phytoplankton Descriptors
4. Discussion
4.1. Environmental Parameters: Spatial and Temporal Patterns
4.2. Phytoplankton
4.2.1. Phytoplankton Assemblages and Diversity
4.2.2. Risk Levels of Toxic Cyanobacteria Occurrence
4.2.3. Relationship between Environmental Variables and Phytoplankton Descriptors
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Ramos, T.B.; Darouich, H.; Gonçalves, M.C.; Brito, D.; Castelo Branco, M.A.; Martins, J.C.; Fernandes, M.L.; Pires, F.P.; Morais, M.; Neves, R. An Integrated Analysis of the Eutrophication Process in the Enxoé Reservoir within the DPSIR. Water 2018, 10, 1576. [Google Scholar] [CrossRef][Green Version]
- Palma, P.; Fialho, S.; Lima, A.; Mourinha, C.; Penha, A.; Novais, M.H.; Rosado, A.; Morais, M.; Potes, M.; Costa, M.J.; et al. Land-cover patterns and hydrogeomorphology of tributaries: Are these important stressors for the water quality of reservoirs in the Mediterranean region? Water 2020, 12, 2665. [Google Scholar] [CrossRef]
- Palma, P.; Penha, A.; Novais, M.H.; Fialho, S.; Lima, A.; Moutinho, C.; Alvarenga, P.; Rosado, A.; Iakunin, M.; Rofrigues, G.; et al. Water-sediment physicochemical dynamics in a large reservoir in the Mediterranean region under multiple stressors. Water 2021, 13, 707. [Google Scholar] [CrossRef]
- Yahyaee, A.R.; Moridi, A.; Sarang, A. A new optimized model to control eutrophication in multi-purpose reservoirs. Int. J. Environ. Sci. Technol. 2021, 18, 3357–3370. [Google Scholar] [CrossRef]
- Sabater-Liesa, L.; Ginebreda, A.; Barcelo, D. Shifts of environmental and phytoplankton variables in a regulated river: A spatial-driven analysis. Sci. Total Environ. 2018, 642, 968–978. [Google Scholar] [CrossRef]
- Mishra, P.; Garg, V.; Dutt, K. Seasonal dynamics of phytoplankton population and water quality in Bidoli reservoir. Environ. Monit. Assess. 2019, 191, 130. [Google Scholar] [CrossRef]
- Liu, C.; Sun, X.; Su, L.; Cai, J.; Zhang, L.; Guo, L. Assessment of phytoplankton community structure and water quality in the Hongmen Reservoir. Water Qual. Res. J. 2021, 56, 19–30. [Google Scholar] [CrossRef]
- Guedes, I.A.; Rachid, C.T.C.C.; Rangel, L.M.; Silva, L.H.S.; Bisch, P.M.; Azevedo, S.M.F.O.; Pacheco, A.B.F. Close link between harmful cyanobacterial dominance and associated bacterioplankton in a tropical eutrophic reservoir. Front. Microbiol. 2018, 9, 424. [Google Scholar] [CrossRef]
- Novais, M.H.; Penha, A.M.; Morales, E.A.; Potes, M.; Salgado, R.; Morais, M. Vertical distribution of benthic diatoms in a large reservoir (Alqueva, Southern Portugal) during thermal stratification. Sci. Total Environ. 2019, 659, 1242–1255. [Google Scholar] [CrossRef]
- Vanderley, R.F.; Ger, K.A.; Becker, V.; Bezerra, M.G.T.A.; Panosso, R. Abiotic factors driving cyanobacterial biomass and composition under perennial bloom conditions in tropical latitudes. Hydrobiologia 2021, 848, 943–960. [Google Scholar] [CrossRef]
- Guignard, M.S.; Leitch, A.R.; Acquisti, C.; Eizaguirre, C.; Elser, J.J.; Hessen, D.O.; Jeyasingh, P.D.; Neiman, M.; Richardson, A.E.; Soltis, P.S.; et al. Impacts of nitrogen and phosphorus: From genomes to natural ecosystems and agriculture. Front. Ecol. Evol. 2017, 5, 70. [Google Scholar] [CrossRef][Green Version]
- Merel, S.; Villarín, M.C.; Chung, K.; Snyder, S. Spatial and thematic distribution of research on cyanotoxins. Toxicon 2013, 76, 118–131. [Google Scholar] [CrossRef]
- Merel, S.; Walker, D.; Chicana, R.; Snyder, S.; Baure`s, E.; Thomas, O. State of knowledge and concerns on cyanobacterial blooms and cyanotoxins. Environ. Int. 2013, 59, 303–327. [Google Scholar] [CrossRef] [PubMed]
- Paerl, H.W. Mitigating toxic planktonic cyanobacterial blooms in aquatic ecosystems facing increasing anthropogenic and climatic pressures. Toxins 2018, 10, 76. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Paerl, H.W.; Huisman, J. Climate: Blooms like it hot. Science 2008, 320, 57–58. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Burford, M.A.; Beardall, J.; Willis, A.; Orr, P.T.; Magalhaes, V.F.; Rangel, L.M.; Azevedo, S.M.F.O.E.; Neilan, B.A. Understanding the winning strategies used by the bloom-forming cyanobacterium Cylindrospermopsis raciborskii. Harmful Algae 2016, 54, 44–53. [Google Scholar] [CrossRef]
- Harke, M.J.; Davis, T.W.; Watson, S.B.; Gobler, C.J. Nutrient-controlled niche differentiation of western Lake Erie cyanobacterial populations revealed via metatranscriptomic surveys. Environ. Sci. Technol. 2016, 50, 604–615. [Google Scholar] [CrossRef]
- Paerl, H.W. Controlling harmful cyanobacterial blooms in a climatically more extreme world: Management options and research needs. J. Plankton Res. 2017, 39, 763–771. [Google Scholar] [CrossRef][Green Version]
- Salmaso, N.; Boscaini, A.; Capelli, C.; Cerasino, L. Ongoing ecological shifts in a large lake are driven by climate change and eutrophication: Evidences from a three decade study in Lake Garda. Hydrobiologia 2018, 824, 177–195. [Google Scholar] [CrossRef]
- Scherer, P.I.; Raeder, U.; Geist, J.; Zwirglmaier, K. Influence of temperature, mixing, and addition of microcystin-LR on microcystin gene expression in Microcystis aeruginosa. Microbiology 2017, 6, e00393. [Google Scholar] [CrossRef]
- Buratti, M.F.; Manganelli, M.; Vichi, S.; Stefanelli, M.; Scardala, S.; Testai, E.; Funari, F. Cyanotoxins: Producing organisms, occurrence, toxicity, mechanism of action and human health toxicological risk evaluation. Arch. Toxicol. 2017, 91, 1049–1130. [Google Scholar] [CrossRef]
- Carmichael, W.W.; Mahmood, N.A.; Hyde, E.G. Natural toxins from cyanobacteria (blue-green algae). In Marine Toxins: Origins, Structure, and Molecular Pharmacology; Hall, S., Strichartz, G., Eds.; American Chemical Society: Washington, DC, USA, 1990; pp. 87–106. [Google Scholar]
- Christiansen, G.; Fastner, J.; Erhard, M.; Börner, T.; Dittmann, E. Microcystin biosynthesis in Planktothrix: Genes, evolution, and manipulation. J. Bacteriol. 2003, 185, 564–572. [Google Scholar] [CrossRef][Green Version]
- Rouhiainen, L.; Vakkilainen, T.; Siemer, B.L.; Buikema, W.; Haselkorn, R.; Sivonen, K. Genes coding for hepatotoxic heptapeptides (microcystins) in the cyanobacterium Anabaena strain 90. Appl. Environ. Microbiol. 2004, 70, 686–692. [Google Scholar] [CrossRef][Green Version]
- Moffitt, M.C.; Neilan, B.A. Characterization of the nodularin synthetase gene cluster and proposed theory of the evolution of cyanobacterial hepatotoxins. Appl. Environ. Microbiol. 2004, 70, 6353–6362. [Google Scholar] [CrossRef][Green Version]
- Stal, L.; Albertano, P.; Bergman, B.; von Brockel, K.; Gallon, J.; Hayes, P.; Sivonen, K.; Walsby, A. BASIC: Baltic Sea cyanobacteria. An investigation of the structure and dynamics of water blooms of cyanobacteria in the Baltic Sea–responses to a changing environment. Cont. Shelf Res. 2003, 23, 1695–1714. [Google Scholar] [CrossRef]
- Lind, O.; Dávalos-Lind, L.; López, C.; López, M.; Dyble Bressie, J. Seasonal morphological variability in an in-situ Cyanobacteria monoculture: Example from a persistent Cylindrospermopsis bloom in Lake Catemaco, Veracruz, Mexico. J. Limnol. 2016, 75, 66–80. [Google Scholar] [CrossRef][Green Version]
- Figueredo, C.C.; Giani, A. Phytoplankton community in the tropical lake of Lagoa Santa (Brazil): Conditions favoring a persistent bloom of Cylindrospermopsis raciborskii. Limnologica 2009, 39, 264–272. [Google Scholar] [CrossRef][Green Version]
- Figueredo, C.C.; Pinto-Coelho, R.M.; Lopes, A.M.M.B.; Lima, P.H.O.; Gücker, B.; Giani, A. From intermittent to persistent cyanobacterial blooms: Identifying the main drivers in an urban tropical reservoir. J. Limnol. 2016, 75, 445–454. [Google Scholar] [CrossRef][Green Version]
- Giani, A.; Taranu, Z.E.; von Ruckert, G.; Gregory-Eaves, I. Comparing key drivers of cyanobacteria biomass in temperate and tropical systems. Harmful Algae 2017, 97, 101859. [Google Scholar] [CrossRef]
- Medeiros, L.; Mattos, A.; Lürling, M.; Becker, V. Is the future blue-green or brown? The effects of extreme events on phytoplankton dynamics in a semi-arid man-made lake. Aquat. Ecol. 2015, 49, 293–307. [Google Scholar] [CrossRef]
- Brasil, J.; Attayde, J.L.; Vasconcelos, F.R.; Dantas, D.D.F.; Huszar, V.L.M. Drought-induced water-level reduction favors cyanobacteria blooms in tropical shallow lakes. Hydrobiologia 2016, 770, 145–164. [Google Scholar] [CrossRef]
- Costa, M.R.A.; Menezes, R.F.; Sarmento, H.; Attayde, J.L.; da SL Sternberg, L.; Becker, V. Extreme drought favors potential mixotrophic organisms in tropical semiarid reservoirs. Hydrobiologia 2019, 831, 43–54. [Google Scholar] [CrossRef]
- Tilahun, S.; Kifle, D. The influence of El Ninõ-induced drought on cyanobacterial community structure in a shallow tropical reservoir (Koka Reservoir, Ethiopia). Aquat. Ecol. 2019, 53, 61–77. [Google Scholar] [CrossRef]
- Olds, B.P.; Peterson, B.C.; Koupal, K.D.; Farnsworth, K.M.; Schoenebeck, C.W.; Hoback, W.W. Water quality parameters of a Nebraska reservoir differ between drought and normal conditions. Lake Reserv. Manag. 2011, 27, 229–234. [Google Scholar] [CrossRef][Green Version]
- Mosley, L.M. Drought impacts on the water quality of freshwater systems; review and integration. Earth-Sci. Rev. 2015, 140, 203–214. [Google Scholar] [CrossRef]
- McGregor, G.B.; Fabbro, L.D. Dominance of Cylindrospermopsis raciborskii (Nostocales, Cyanoprokaryota) in Queensland tropical and subtropical reservoirs: Implications for monitoring and management. Lakes Reserv. Manag. 2000, 5, 195–205. [Google Scholar] [CrossRef]
- Crossetti, L.O.; de C. Bicudo, D.; Bini, L.M.; Dala-Corte, R.B.; Ferragut, C.; Bicudo, C.E.M. Plankton species interactions and invasion by Ceratium furcoides are influenced by extreme drought and water-hyacinth removal in a shallow tropical reservoir. Hydrobiologia 2019, 831, 71–85. [Google Scholar] [CrossRef]
- Rotenberg, E.; Yakir, D. Contribution of semi-arid forests to the climate system. Science 2010, 327, 451–454. [Google Scholar] [CrossRef]
- Huang, J.; Guan, X.; Ji, F. Enhanced cold-season warming in semi-arid regions. Atmos. Chem. Phys. 2012, 12, 5391–5398. [Google Scholar] [CrossRef][Green Version]
- Ventura, J.E. A problemática dos Recursos Hídricos em Santiago. In Proceedings of the 1º Congresso de Desenvolvimento Regional de Cabo Verde. 15º Congresso da ADPR|2ª Congresso Lusófono de Ciência Regional|3ª Congresso de Gestão e Conservação da Natureza, Cidade da Praia, Santiago, Cabo Verde, 6–11 July 2009. [Google Scholar]
- Teixeira, J.J.L. Hidrosedimentologia e Disponibilidade Hídrica da Bacia Hidrográfica da Barragem de Poilão, Cabo VerdeAnálise de Riscos de Ruptura de Barragens: Estudo de Caso de Seis Barragens na Ilha de Santiago em Cabo Verde. Master’s Thesis, Programa de Pós-Graduação em Engenharia Agrícola da Universidade Federal do Ceará, Fortaleza, Brazil, 2011; 100p. [Google Scholar]
- Tavares dos Santos, E.A. As Barragens em Cabo Verde: Avaliação dos Impactes Ambientais, Socioeconómicos e Culturais. Caso de Estudo “A Barragem do Poilão” Ilha de Santiago. Master’s Thesis, em Gestão do Território—Especialização em Ambiente e Recursos Naturais, Universidade Nova de Lisboa, Lisboa, Portugal, 2013; 131p. [Google Scholar]
- Lopes Varela, I.L.B. Estudo de Aproveitamento de fins Múltiplos da Barragem de Faveta, Ilha de Santiago (Cabo Verde) com Enfoque na rega e Abastecimento de Água. Master’s Thesis, Engenharia Civil na Especialidade de Hidráulica, Recursos Hídricos e Ambiente, Universidade de Coimbra, Coimbra, Portugal, 2014; 70p. [Google Scholar]
- Araújo, A.; Hernandez, R.; Fonseca, R.; Matos, J. Avaliação da taxa de sedimentação na Barragem do Poilão (Ilha de Santiago, Cabo Verde). Comun. Geológicas 2014, 10, 597–600. [Google Scholar]
- Ferreira, V.A.D.S. Conflitos e Participação no Uso da Água da Barragem de Poilão, Ilha de Santiago, Cabo Verde. Ph.D. Thesis, em Ciências Sociais, Universidade de Cabo Verde, Praia, Cabo Verde, 2014; 193p. [Google Scholar]
- Instituto Nacional de Estatística (INE). Inquérito Multi-Objetivo Contínuo (IMC); Instituto Nacional de Estatística (INE): Praia, Cabo Verde, 2019. [Google Scholar]
- Gomes, A.D.M. Hidrogeologia e recursos hídricos da Ilha de Santiago (Cabo Verde). Ph.D. Thesis, Universidade de Aveiro, Aveiro, Portugal, 2007; 298p. [Google Scholar]
- Bosa, M.S. Water Institutions and Management in Cape Verde. Water 2015, 7, 2641–2655. [Google Scholar] [CrossRef][Green Version]
- Marques, F.O.; Hildenbrand, A.; Zeyen, H.; Cunha, C.; Victória, S.S. The complex vertical motion of intraplate oceanic islands assessed in Santiago Island, Cape Verde. Geochem. Geophys. 2020, 21, e2019GC008754. [Google Scholar] [CrossRef]
- Neves, D.J.D.; de P.R. Silva, V.; Almeida, R.S.R.; Sous, F.A.S.; da Silva, B.B. General aspects of the climate in the Cabo Verde archipelago. Ambiência 2017, 13, 59–73. [Google Scholar] [CrossRef][Green Version]
- Romeiras, M.M.; Duarte, M.C.; Pais, M.S. Islands Biodiversity: Conservation Strategies Based on Knowledge of Endemic Plant Species from Cape Verde Islands [Macaronesian Region]; Handbook of Nature Conservation: Global, Environmental and Economic Issues; Aronoff, J.B., Ed.; Nova Science Publishers, Inc.: New York, NY, USA, 2009; p. 147. [Google Scholar]
- Correia de Matos, S.C. Padrões de Distribuição da Flora Exótica em Cabo Verde: O Papel dos Fatores Antrópicos e Ecológicos. Master’s Thesis, Ecologia e Gestão Ambiental, Universidade de Lisboa, Lisboa, Portugal, 2012; 53p. [Google Scholar]
- Duarte, M.C.; Moreira, I. A vegetação de Santiago (Cabo Verde), Apontamento HistóricoGarcia de Orta. Ser. Bot. 2002, 16, 51–80. [Google Scholar]
- Fernandes, M.M. Análise de Risco de Ruptura de Barragens: Estudo de caso de seis Barragens na Ilha de Santiago em Cabo Verde, África. Ph.D. Thesis, Centro de Tecnologia, Engenharia Civil: Recursos Hídricos, Universidade Federal do Ceará, Fortaleza, Brazil, 2020; 381p. [Google Scholar]
- Serralheiro, A. Carta geológica da Ilha de Santiago (Cabo Verde) na Escala 1:100,000. Junta de Investigações Científicas do Ultramar; Laboratório de Estudos Petrológicos e Paleontológicos do Ultramar: Lisboa, Portugal, 1977. [Google Scholar]
- Instituto Nacional de Gestão do Território (INGT). Cabo Verde. 2018. Available online: https://ingt.gov.cv/ingt/ (accessed on 24 May 2021).
- Rice, E.W.; Baird, R.B.; Eaton, A.D.; Clesceri, L.S. (Eds.) Standard Methods for the Examination of Water and Wastewater, 22nd ed.; American Public Health Association (APHA); American Water Works Association (AWWA); Water Environmental Federation: Washington, DC, USA, 2012; ISBN 978-087553-013-0. [Google Scholar]
- Cole, G.A. Textbook of Limnology, 4th ed.; Waveland Press Inc.: Long Grive, IL, USA, 1994. [Google Scholar]
- INAG, I.P. Manual para a Avaliação da Qualidade Biológica da água. Protocolo de Amostragem e Análise para o Fitoplâncton; Ministério do Ambiente, do Ordenamento do Território e do Desenvolvimento Regional. Instituto da Água, I.P.: Lisboa, Portugal, 2009; 42p. [Google Scholar]
- Huber-Pestalozzi, G. Das Phytoplankton des Süßwassers, Systematik und Biologie, 4. Teil: Euglenophyceen. Die Binnengewässer 1955, 16, 1–606. [Google Scholar]
- Hubber-Pestalozzi, G. Das Phytoplankton des Süsswassers Band 16, 2 Teil, 1 Hälfte: Chrysophyceen. Farblose Flagellaten, Heterokonten; Schweizerbart’sche Verlagsgesellschaft: Stuttgart, Germany, 1976. [Google Scholar]
- Komárek, J.; Fott, B. Chlorophyceae (Grünalgen), Ordnung Chlorococcales. G. Huber-Pestalozzi, Ed. Die Binnengewässer. Das Phytoplankton des Süßwassers, 7. Teil, 1. Halfte; E, Schweizerbart’sche Verlagsbuchhandlung: Stuttgart, Germany, 1983. [Google Scholar]
- Komárek, J.; Komárková, J. Diversity of Aphanizomenon-like cyanobacteria. Czech Phycol. 2006, 6, 1–32. [Google Scholar]
- Coesel, P.; Meesters, K. Desmids of the Lowlands: Mesotaeniaceae and Desmidiaceae of the European Lowlands; BRILL: Leiden, The Netherlands, 2007. [Google Scholar]
- Coesel, P.; Meesters, K. European Flora of the Desmid Genera Staurastrum and Staurodesmus: Identification Key for Desmidiaceae—Morphology—Ecology and Distribution—Taxonomy; BRILL: Leiden, The Netherlands, 2013. [Google Scholar] [CrossRef]
- McGregor, G.B. Freshwater Cyanobacteria of North-eastern Australia: 2: Chroococcales. Phytotaxa 2013, 133, 1–130. [Google Scholar] [CrossRef][Green Version]
- McGregor, G.B. Freshwater Cyanobacteria of North-Eastern Australia: 3. Nostocales. Phytotaxa 2018, 359, 1–166. [Google Scholar] [CrossRef]
- Utermöhl, H. Zur Vervollkommnung der quantitativen Phytoplankton Methodik. Int. Ver. Theor. Angew. Limnol. 1958, 9, 1–38. [Google Scholar] [CrossRef]
- Hillebrand, H.; Dürselen, C.-D.; Kirschtel, D.; Pollingher, U.; Zohary, T. Biovolume calculation for pelagic and benthic microalgae. J. Phycol. 1999, 35, 403–424. [Google Scholar] [CrossRef]
- Sun, J.; Liu, D. Geometric models for calculating cell biovolume and surface area for phytoplankton . J. Plankton Res. 2003, 25, 1331–1346. [Google Scholar] [CrossRef][Green Version]
- INAG, I.P. Manual para a Avaliação da Qualidade Biológica da água. Guia de Utilização da Tabela de Valores-Guia Normalizados de Biovolumes e Determinação do Biovolume Através de Procedimentos Laboratoriais; Ministério da Agricultura, Mar, Ambiente e Ordenamento do Território. Instituto da Água, I.P.: Lisbon, Portugal, 2011; 11p. [Google Scholar]
- Hammer, D.A.T.; Ryan, P.D.; Hammer, Ø.; Harper, D.A.T. Past: Paleontological Statistics Software Package for Education and Data Analysis. Palaeontol. Electron. 2001, 4, 1–9. [Google Scholar]
- Shannon, C.; Weaver, W.W. The Mathematical Theory of Communications; University of Illinois Press: Champaign, IL, USA, 1963. [Google Scholar]
- Death, R. Margalef’s index. Ecol. Indic. 2008, 2008, 2209–22010. [Google Scholar]
- Pielou, E.C. Ecological Diversity; John Wiley&Sons: New York, NY, USA, 1975; 174p. [Google Scholar]
- Harrison, S.; Ross, S.J.; Lawton, J.H. Beta diversity on geographic gradients in Britain. J. Anim. Ecol. 1992, 61, 151–158. [Google Scholar] [CrossRef]
- World Health Organization (WHO). Algae and cyanobacteria in fresh water. In Guidelines for Safe Recreational Water Environments; Coastal and Fresh Waters; World Health Organization: Geneva, Switzerland, 2003; Volume 1, pp. 136–158. Available online: http://apps.who.int/iris/bitstream/10665/42591/1/9241545801.pdf (accessed on 15 July 2021).
- Videira, A. Engenharia Genética–Princípios e Aplicações; Lidel—edições técnicas. Lda: Lisbon, Portugal, 2011; ISBN 9789727577439. [Google Scholar]
- Neiland, B.A.; Jacobs, D.; Del Dot, T.; Blackall, L.L.; Hawkings, P.R.; Cox, P.T.; Goodman, C.A. rRNA sequences and evolutionary relationships among toxic and nontoxic cyanobacteria of the genus Microcystis. Int. J. Syst. Bacteriol. 1997, 47, 693–697. [Google Scholar] [CrossRef]
- Jungblut, A.D.; Hawes, I.; Mountfort, D.; Hitzfeld, B.; Dietrich, D.R.; Burns, B.P.; Neilan, B.A. Diversity within cyanobacterial mat communities in variable salinity meltwater ponds of McMurdo Ice Shelf, Antarctica. Environ. Microbiol. 2005, 7, 519–529. [Google Scholar] [CrossRef][Green Version]
- Nonnemam, D.; Zimba, P.V. A PCR-based test to assess the potential for microcystins occurrence in channel catfish production ponds. J. Phycol. 2002, 38, 230–233. [Google Scholar] [CrossRef]
- Jungblut, A.-D.; Neilan, B.A. Molecular identification and evolution of the cyclic peptide hepatotoxins, microcystins, and nodularins synthetase genes in three orders of Cyanobacteria. Arch. Microbiol. 2006, 186, 107–114. [Google Scholar]
- Schembri, M.A.; Neilan, B.A.; Saint, C.P. Identification of Genes Implicated in Toxins Production in the Cylindrospermopsin Raciborkii; John Wiley & Sons, Inc.: New York, NY, USA, 2001; pp. 413–421. [Google Scholar]
- Singh, K.P.; Malik, A.; Mohan, D.; Sinha, S. Multivariate statistical techniques for the evaluation of spatial and temporal variations in water quality of Gomti River (India)–A case study. Water Res. 2004, 38, 3980–3992. [Google Scholar] [CrossRef]
- Clarke, K.; Gorley, R. Non-parametric multivariate analyses of changes in community structure. Aust. J. Ecol. 1993, 18, 117–143. [Google Scholar] [CrossRef]
- Clarke, K.; Gorley, R. Primer E-v5: User Manual/Tutorial. Primer-E, Plymouth; Plymouth Marine Laboratory: Plymouth, UK, 2001. [Google Scholar]
- Victória, S.S. Caraterização Geológica e Geotécnica das Unidades Litológicas da Cidade da Praia (Santiago, Cabo Verde). Ph.D. Thesis, DCT-FCT, Universidade de Coimbra, Coimbra, Portugal, 2012; 302p. [Google Scholar]
- Serralheiro, A. A Geologia da ilha de Santiago (Cabo Verde). Ph.D. Thesis, Museu do Laboratório Mineralógico e Geológico da Faculdade de Ciências da Universidade de Lisboa, Universidade de Lisboa, Losboa, Portugal, 1976; 218p. [Google Scholar]
- da, S.C. Pinto, M.M. Cartografia Geoquímica da ilha de Santiago com uma DENSIDADE de Amostragem Média/Baixa (Geochemical Mapping of Santiago Island with a Medium/Low Sampling Density). Ph.D. Thesis, Geoscience, University of Aveiro, Aveiro, Portugal, 2010; 436p. [Google Scholar]
- Vanni, M.J. Nutrient cycling by animals in freshwater ecosystems. Annu. Rev. Ecol. Syst. 2002, 33, 341–370. [Google Scholar] [CrossRef][Green Version]
- Schmidt, T.S.; Clements, W.H.; Wanty, R.B.; Verplanck, P.L.; Church, S.E.; San Juan, C.A.; Fey, D.L.; Rockwell, B.W.; Dewitt, E.D.H.; Klein, T.L. Geologic processes influence the effects of mining on aquatic ecosystems. Ecol. Appl. 2012, 22, 870–879. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Bouwman, A.F.; Bierkens, M.F.P.; Griffioen, J.; Hefting, M.M.; Middelburg, J.; Middelkoop, H.; Slomp, C.P. Nutrient dynamics, transfer and retention along the aquatic continuum from land to ocean: Towards integration of ecological and biogeochemical models. Biogeosciences 2013, 10, 1–23. [Google Scholar] [CrossRef][Green Version]
- Lintern, A.; Webb, J.A.; Ryu, D.; Liu, S.; Bende-Michl, U.; Waters, D.; Leahy, P.; Wilson, P.; Western, A.W. Key factors influencing differences in stream water quality across space. WIREs Water 2018, 5, e1260. [Google Scholar] [CrossRef][Green Version]
- Dubois, N.; Saulnier-Talbot, E.; Mills, K.; Gell, P.; Battarbee, R.; Bennion, H.; Chawchai, S.; Dong, X.; Francus, P.; Flower, R.; et al. First human impacts and responses of aquatic systems: A review of palaeolimnological records from around the world. Anthr. Rev. 2018, 5, 28–68. [Google Scholar] [CrossRef]
- Strayer, D.L.; Beighley, R.E.; Thompson, L.C.; Brooks, S.; Nilsson, C.; Pinay, G.; Naiman, R.J. Effects of land-cover change on stream ecosystems: Roles of empirical models and scaling issues. Ecosystems 2003, 6, 407–423. [Google Scholar] [CrossRef]
- Zhang, D.; Wang, X.; Zhou, Z. Impacts of small-scale industrialized swine farming on local soil, water and crop qualities in a hilly red soil region of subtropical China. Int. J. Environ. Res. Public Health 2017, 14, 1524. [Google Scholar] [CrossRef][Green Version]
- Zhou, Y.; Xu, J.F.; Yin, W.; Ai, L.; Fang, N.F.; Tan, W.F.; Yan, F.L.; Shi, Z.H. Hydrological and environmental controls of the stream nitrate concentration and flux in a small agricultural watershed. J. Hydrol. 2017, 545, 355–366. [Google Scholar] [CrossRef]
- Matono, P.; Batista, T.; Sampaio, E.; Ilhéu, M. Effects of Agricultural Land Use on the Ecohydrology of Small-Medium Mediterranean River Basins: Insights from a Case Study in the South of Portugal. In Land Use—Assessing the Past, Envisioning the Future; InTechOpen: London, UK, 2018; pp. 30–51. [Google Scholar]
- Messina, N.J.; Couture, R.M.; Norton, S.A.; Birkel, S.D.; Amirbahman, A. Modeling response of water quality parameters to land-use and climate change in a temperate, mesotrophic lake. Sci. Total Environ. 2010, 713, 136549. [Google Scholar] [CrossRef]
- Vásquez-Méndez, R.; Ventura-Ramos, E.; Oleschko, K.; Hernández-Sandoval, L.; Angel Domínguez-Cortázar, M. Soil Erosion Processes in Semiarid Areas: The Importance of Native Vegetation, Soil Erosion Studies; InTech: London, UK, 2011; pp. 25–40. ISBN 978-953-307-710-9. Available online: File:///C:/Users/Manuela%20Morais/Downloads/IntechsoilerosionISBN978-953-307-435-1.pdf (accessed on 15 July 2021).
- Scholes, R.J. The Future of Semi-Arid Regions: A Weak Fabric Unravels. Climate 2020, 8, 43. [Google Scholar] [CrossRef][Green Version]
- Bou-Imajjane, L.; Belfoul, M.A.; Elkadiri, R.; Stokes, M. Soil erosion assessment in a semi-arid environment: A case study from the Argana Corridor, Morocco. Environ. Earth Sci. 2020, 79, 409. [Google Scholar] [CrossRef]
- FitzHugh, T.W.; Mackay, D.S. Impact of subwatershed partitioning on model source-and transport-limited sediment yields in an agricultural ninpoint source pollution model. J. Soil Water Conserv. 2001, 56, 137–143. [Google Scholar]
- Thurow, T.L.; Taylor, C.H., Jr. Viewpoint: The role of drought in range management. J. Range Manag. 1999, 52, 413–419. [Google Scholar] [CrossRef]
- Nunes, J.P.; Seixas, J.; Keizer, J.J. Modeling the response of within-storm runoff and erosion dynamics to climate change in two Mediterranean watersheds: A multi-model, multi-scale approach to scenario design and analysis. Catena 2013, 102, 27–39. [Google Scholar] [CrossRef]
- Lisboa, M.S.; Schneider, R.L.; Sullivan, P.J.; Walter, M.T. Drought and post-drought rain effect on stream phosphorus and other nutrient losses in the Northeastern USA. J. Hydrol. Reg. Stud. 2020, 28, 100672. [Google Scholar] [CrossRef]
- Green, R.; Bertetti, F.; Hernandez, M. Recharge Variability in Semi-Arid Climates. Nat. Educ. Knowl. 2012, 3, 34. [Google Scholar]
- Smith, V.H. Eutrophication of freshwater and coastal marine ecosystems a global problem. Environ. Sci. Pollut. Res. 2003, 10, 126–139. [Google Scholar] [CrossRef] [PubMed]
- Baho, D.L.; Drakare, S.; Johnson, R.K.; Allen, C.R.; Angeler, D.G. Is the impact of eutrophication on phytoplankton diversity dependent on lake volume/ecosystem size? J. Limnol. 2017, 76, 199–210. [Google Scholar]
- Huisman, J.; Codd, G.A.; Paerl, H.W.; Ibelings, B.W.; Verspagen, J.M.H.; Visser, P.M. Cyanobacterial blooms. Nat. Rev. Microbiol. 2018, 16, 471–483. [Google Scholar] [CrossRef]
- Burford, M.A.; O’Donohue, M.J. A comparison of phytoplankton community assemblages in artificially and naturally mixed subtropical water reservoirs. Freshw. Biol. 2006, 51, 973–982. [Google Scholar] [CrossRef][Green Version]
- Istvánovics, V. Eutrophication of Lakes and Reservoirs. In Encyclopedia of Inland Waters; Likens, G.E., Ed.; Elsevier: Oxford, UK, 2009; Volume 1, pp. 157–165. [Google Scholar]
- Vinçon-Leite, B.; Casenave, C. Modelling eutrophication in lake ecosystems: A review. Sci. Total Environ. 2019, 651, 2985–3001. [Google Scholar] [CrossRef]
- Leibold, M.A.; Holyoak, M.; Mouquet, N.; Amarasekare, P.; Chase, J.M.; Hoopes, M.F.; Holt, R.D.; Shurin, R.B.; Law, R.; Tilman, D.; et al. The metacommunity concept: A framework for multi-scale community ecology. Ecol. Lett. 2004, 7, 601–613. [Google Scholar] [CrossRef]
- Holyoak, M.; Leibold, M.A.; Holt, R.D. Metacommunities: Spatial Dynamics and Ecological Communities; The University of Chicago Press: Chicago, IL, USA, 2005. [Google Scholar]
- Elliott, J.A.; Persson, I.; Thackeray, S.J.; Blenckner, T. Phytoplankton modelling of Lake Erken, Sweden by linking the models PROBE and PROTECH. Ecol. Modell. 2007, 202, 421–426. [Google Scholar] [CrossRef]
- Soininen, J. A quantitative analysis of species sorting across organisms and ecosystems. Ecology 2014, 95, 3284–3292. [Google Scholar] [CrossRef]
- Bond, N.R.; Lake, P.S.; Arthington, A.H. The impacts of drought on freshwater ecosystems: An Australian perspective. Hydrobiologia 2008, 600, 3–16. [Google Scholar] [CrossRef][Green Version]
- Zorzel-Almeida, S.; Bartzek, E.C.R.; Bicudo, D.C. Homegenization of diatom assemblages is driven by eutrophication in tropical reservoirs. Environ. Pollut. 2021, 288, 117778. [Google Scholar] [CrossRef] [PubMed]
- Baselga, A. Partitioning the turnover and nestedness components of beta diversity. Glob. Ecol. Biogeogr. 2010, 19, 134–143. [Google Scholar] [CrossRef]
- Rodríguez-Alcalá, O.; Blanco, S.; García-Girón, J.; Jeppesen, E.; Irvine, K.; Nõges, P.; Nõges, T.; Gross, E.M.; Bécares, E. Large-scale geographical and environmental drivers of shallow lake diatom metacommunities across Europe. Sci. Total Environ. 2020, 707, 135887. [Google Scholar] [CrossRef] [PubMed]
- Whittaker, R.J.; Willis, K.J.; Field, R. Scale and species richness: Towards a general, hierarchical theory of species diversity. J. Biogeogr. 2001, 28, 453–470. [Google Scholar] [CrossRef][Green Version]
- Crispino, L.M.B.; Sant’Anna, C.L. Cianobactérias marinhas bentônicas de ilhas costeiras do Estado de São Paulo, Brasil. Rer. Bras. Bot. 2006, 29, 639–656. [Google Scholar] [CrossRef][Green Version]
- Tucci, A.; Sant’Anna, C.L.; Gentil, R.C.; Azevedo, M.T. daP. Fitoplâncton do Lago das Garças, São Paulo, Brasil: Um reservatório urbano eutrófico. Hoehnea 2006, 33, 147–175. [Google Scholar]
- Havens, K.E.; Thomas, J.R.; East, T.L.; Smilth, V.H. N:P ratios, light limitation, and cyanobacterial dominance in a subtropical lake impacted by non-point source nutrient pollution. Environ. Pollut. 2003, 122, 379–390. [Google Scholar] [CrossRef]
- Moresco, G.A.; Bortolini, J.C.; De’o Dias, J.; Pineda, A.; Jati, S.; Rodrigues, L.C. Drivers of phytoplankton richness and diversity components in Neotropical floodplain lakes, from small to large spatial scales. Hydrobiologia 2017, 799, 203–215. [Google Scholar] [CrossRef]
- Finlay, B.J. Global dispersal of free-living microbial eukaryote species. Science 2002, 296, 1061–1063. [Google Scholar] [CrossRef][Green Version]
- Fenchel, T.; Finlay, B.J. The ubiquity of small species: Patterns of local and global diversity. BioScience 2004, 54, 777–784. [Google Scholar] [CrossRef]
- Martiny, J.B.H.; Bohannan, B.J.M.; Brown, J.H.; Colwell, R.K.; Fuhrman, J.A.; Green, J.L.; Horner-Devine, M.C.; Kane, M.; Krumins, J.A.; Kuske, C.R.; et al. Microbial biogeography: Putting microorganisms on the map. Nat. Rev. Microbiol. 2006, 4, 102–112. [Google Scholar] [CrossRef]
- Funari, E.; Testai, E. Human health risk assessment related to cyanotoxins exposure. Crit. Rev. Toxicol. 2008, 38, 97–125. [Google Scholar] [CrossRef] [PubMed]
- Whitton, B.A. Ecology of Cyanobacteria II. Their Diversity in Space and Time; Springer: New York, NY, USA, 2008; p. 760. [Google Scholar]
- Rastogi, R.P.; Sinha, R.P.; Incharoensakdi, A. The cyanotoxin microcystins: Current overview. Rev. Environ. Sci. Bio. 2014, 13, 215–249. [Google Scholar] [CrossRef]
- Corbel, S.; Mougin, C.; Bouaïcha, N. Cyanobacterial toxins: Modes of actions, fate in aquatic and soil ecosystems, phytotoxicity and bioaccumulation in agricultural crops. Chemosphere 2014, 96, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Niamien-Ebrottie, J.E.; Bhattacharyya, S.; Deep, P.R.; Nayak, B. Cyanobacteria and cyanotoxins in the world: Review. Inter. J. App. Res. 2015, 1, 563–569. [Google Scholar]
- Mowe, M.; Mitrovic, S.; Lim, R.; Furey, A.; Yeo, D. Tropical cyanobacterial blooms: A review of prevalence, problem taxa, toxins and influencing environmental factors. J. Limnol. 2015, 74, 205–224. [Google Scholar] [CrossRef][Green Version]
- Chorus, I.; Welker, M. (Eds.) Toxic Cyanobacteria in Water, 2nd ed.; CRC Press: Boca Raton, FL, USA; World Health Organization: Geneva, Switzerland, 2021. [Google Scholar]
- Stuken, A.; Campbell, R.J.; Quesada, A.; Sukenik, A.; Dadheech, P.K.; Wiedner, C. Genetic and morphologic characterization of four putative cylindrospermopsin producing species of the cyanobacterial genera Anabaena and Planktothrix. J. Plankton Res. 2009, 31, 465–480. [Google Scholar] [CrossRef]
- Jiang, Y.; Xiao, P.; Yu, G.; Sano, T.; Pan, Q.; Li, R. Molecular basis and phylogenetic implications for deoxy-cylindrospermopsin biosynthesis in Raphidiopsis curvata (cyanobacteria). Appl. Environ. Microbiol. 2012, 78, 2256–2263. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Sinha, R.; Pearson, L.A.; Davis, T.W.; Muenchhoff, J.; Pratama, R.; Jex, A.; Burford, M.A.; Neilan, B.A. Comparative genomics of Cylindrospermopsis raciborskii strains with differential toxicities. BMC Genome. 2014, 15, 83. [Google Scholar] [CrossRef][Green Version]
- Funari, E.; Manganelli, M.; Sinisi, L. Impact of climate change on waterborne diseases. Ann. Ist. Super Sanità. 2012, 48, 473–487. [Google Scholar] [CrossRef]
- Zanchett, G.; Oliveira-Filho, E.C. Cyanobacteria and Cyanotoxins: From Impacts on Aquatic Ecosystems and Human Health to Anticarcinogenic Effects. Toxins 2013, 5, 1896–1917. [Google Scholar] [CrossRef] [PubMed]
- Backer, L.C.; McNeel, S.; Barber, T.; Kirkpatrick, B.; Williams, C.; Irvin, M.; Zhou, Y.; Johnson, T.; Nierenberg, K.; Aubel, M.; et al. Recreation exposure to microcystins during an algal bloom in California lakes. Toxins 2010, 55, 909–921. [Google Scholar]
- Gutiérrez-Praena, D.; Campos, A.; Azevedo, J.; Neves, J.; Freitas, M.; Guzmán-Guillén, R.; Cameán, A.M.; Renaut, J.; Vasconcelos, V. Exposure of Lycopersicon esculentum to Microcystin-LR: Effects in the Leaf Proteome and Toxin Translocation from Water to Leaves and Fruits. Toxins 2014, 6, 1837–1854. [Google Scholar] [CrossRef][Green Version]
- Ferrão, J.; Bell, V.; Fernandes, T.H. Mycotoxins, Food Safety and Security in Sub-Saharan Africa. SM J. Food Nutri. Disord. 2017, 3, 1021. [Google Scholar]
- Lee, S.; Jiangb, X.; Manuboluc, M.; Riedlb, K.; Ludsina, S.A.; Martina, J.F.; Lee, J. Fresh produce and their soils accumulate cyanotoxins from irrigation water: Implications for public health and food security. Food Res. Int. 2017, 102, 234–245. [Google Scholar] [CrossRef]
- Codd, G.A.; Steffensen, D.A.; Burch, M.D.; Baker, P.D. Toxic blooms of cyanobacteria in Lake Alexandrina: Learning from history. Aust. J. Mar. Freshw. Res. 1994, 45, 731–736. [Google Scholar] [CrossRef]
- Lv, J.; Wu, H.; Chen, M. Effects of nitrogen and phosphorus on phytoplankton composition and biomass in 15 subtropical, urban shallow lakes in Wuhan, China. Limnologica 2011, 41, 48–56. [Google Scholar] [CrossRef][Green Version]
- Ahmed, A.I.; Mohamed, H.A.-A.; Takajio, O.; Nitrogem Fixing Vyanobacteria: Future Prospect. Open Access Peer-Reviewd Chapter. 2014. Available online: https://www.intechopen.com/books/advances-in-biology-and-ecology-of-nitrogen-fixation/nitrogen-fixing-cyanobacteria-future-prospect (accessed on 15 July 2021).
- Li, Y.; Liu, Y.; Zhao, L.; Hastings, A.; Guo, H. Exploring change of internal nutrients cycling in a shallow lake: A dynamic nutrient driven phytoplankton model. Ecol. Model. 2015, 313, 137–148. [Google Scholar] [CrossRef]
- Cui, Y.; Zhu, G.; Li, H.; Luo, L.; Cheng, X.; Jin, Y.; Trolle, D. Modelling the response of phytoplankton to reduced external nutrient load in a subtropical Chinese reservoir using DYRESM-CAEDYM. Lake Reserv. Manag. 2016, 32, 146–157. [Google Scholar] [CrossRef][Green Version]
- Elliott, J.A.; Defew, L. Modelling the response of phytoplankton in a shallow lake (Loch Leven, UK) to changes in lake retention time and water temperature. Hydrobiologia 2012, 681, 105–116. [Google Scholar] [CrossRef][Green Version]
Poilão | Saquinho | Salineiro + | Faveta | Figueira Gorda | Flamengos | Principal + | |
---|---|---|---|---|---|---|---|
Stream | Ribeira Seca | Ribeira Charco | Ribeira Grande | Ribeira Picos | Ribeira Boaventura | Ribeira Flamengos | Ribeira Principal |
Year of construction | 2006 | 2013 | 2013 | 2013 | 2014 | 2017 | 2019 |
Maximum height (m) | 26.0 | 33.9 | 31.0 | 36.5 | 34.7 | 32.5 | 42.8 |
Maximum capacity (103 m3) | 1700 | 700 | 700 | 700 | 1800 | 850 | 700 |
Available water volume for irrigation (103 m3/year) | 1200 | 563 | 596 | 536 | 1455 | 852 | 520 |
Irrigated area (ha) | 100 | 66 | 58 | 86 | 105 | 80 | 85 |
Maximum flood discharge (m3/s) | 320.0 | 312.0 | 214.5 | 186.6 | 363.0 | 271.0 | 200.0 |
Reservoir depth in June 2016 (m) | 8 | * | * | 10 | 8 | 9 | * |
Reservoir depth in May 2017 (m) | 7 | * | * | 9 | 8 | 7 | * |
Reservoir depth in December 2017 (m) | 4 | 6 | * | 9 | 8 | 7 | * |
Reservoir depth in October 2018 (m) | 4 | 5 | * | * | 9 | * | * |
Reservoir depth in February 2020 (m) | * | 1 | * | * | 4 | 1 ** | * |
Water Access and Sanitation | Cabo Verde | Urban Area | Rural Area | São Miguel | Santa Cruz | Santa Catarina | São Lourenço dos Órgãos | São Salvador do Mundo | |
---|---|---|---|---|---|---|---|---|---|
Access to Water | Connected to the network | 69.0 | 74.7 | 57.4 | 52.2 | 69.0 | 57.7 | 56.2 | 15.6 |
Not connected to the network | 31.0 | 25.3 | 42.6 | 47.6 | 31.0 | 42.3 | 43.8 | 84.4 | |
Neighbours | 9.3 | 11.9 | 3.9 | 4.3 | 7.8 | 4.2 | 4.2 | 0.0 | |
Engine | 8.5 | 7.8 | 10.0 | 4.4 | 5.2 | 14.8 | 12.5 | 26.3 | |
Fountain | 7.1 | 5.0 | 11.7 | 8.8 | 4.9 | 6.5 | 1.9 | 16.3 | |
Other sources | 6.1 | 0.5 | 17.2 | 30.3 | 13.1 | 16.8 | 25.2 | 41.8 | |
Wastewater evacuation | Connected to the sewer network | 31.6 | 44 | 3.3 | 54.9 | 29.6 | 3.8 | 1.0 | 1.1 |
Septic tanks | 51.0 | 43.4 | 68.4 | 6.2 | 22.4 | 69.0 | 74.7 | 71.9 | |
Rudimentary septic tanks | 2.6 | 2.5 | 2.7 | 0.0 | 10.3 | 2.6 | 0.0 | 0.0 | |
No access-discharge into the nature | 14.8 | 10.1 | 25.6 | 38.9 | 37.7 | 24.6 | 24.3 | 27.0 | |
Solid waste evacuation | Connected to the management system | ||||||||
Containers | 59.1 | 65.2 | 46.6 | 49.4 | 56.9 | 35.1 | 57.0 | 52.4 | |
Dump trucks | 23.0 | 31.5 | 5.6 | 3.2 | 1.5 | 2.9 | 1.1 | 4.5 | |
No connection to the management system | |||||||||
Buried/Burned | 9.6 | 1.6 | 26.7 | 20.8 | 15.0 | 39.3 | 33.0 | 23.0 | |
Dumped into the nature/surroundings of the houses | 8.3 | 1.7 | 21.1 | 26.5 | 16.7 | 22.7 | 8.9 | 20.1 | |
Inhabitants | 549,699 | 13,779 | 25,917 | 47,604 | 6,879 | 8,582 |
Target Gene | Primer Direction 5′–3′ (Forward and Reverse) | Amplicon (bp) | Melting Temp. (°C) | Reference | Observations |
---|---|---|---|---|---|
16S rRNA | AGAGTTTGATCCTGGCTCAG GCTTCGGCACGGCTCGGGTCGATA | 780 | 83.5–85.0 °C | [80,81] | Universal gene for identifying the presence of Cyanobacteria |
mcyB | TGGGAAGATGTTCTTCAGGTATCCAA AGAGTGGAAACAATATGATAAGCTAC | 350 | 78.0–79.5 °C | [82] | Genes specific for B and E regions of the Microcystin gene and common region of Microcystin and Nodularin gene-specific |
mcyE/nda | TTTGGGGTTAACTTTTTTGGCCATAGTC AATTCTTGAGGCTGTAAATCGGGTTT | 472 | 80.0–83.0 °C | [83] | |
Peptide synthetase | GGCAAATTGTGATAGCCACGAGC GATGGAACATCGCTCACTGGTG | 597 | 83.0 °C | [84] | Specific genes to produce proteins responsible for the synthesis of Cylindrospermopsin. |
Polyketide synthetase | GAAGCTCTCTGGAATCCGGTAA AATCCTTACGGGATCCGGTGC | 650 | 81.0–82.0 °C | [84] |
Metrics | Faveta | Figueira Gorda | Poilão | Saquinho | Flamengos |
---|---|---|---|---|---|
Nº of Taxa (S) | 10.0 (9.5–13.0) | 9.0 (8.0–11.0) | 15.0 (13.3–16.0) | 15.0 (12.0–19.5) | 11.5 (10.5–14.0) |
Density (N) | 4.0 × 105 (2.2 × 105–4.0 × 105) | 1.2 × 105 (2.0 × 104–1.4 × 106) | 2.9 × 105 (11 × 105–7.5 × 105) | 5.4 × 106 (2.7 × 106–5.9 × 106) | 3.2 × 105 (2.5 × 103–7.9 × 105) |
Biovolume (Bv) | 10.68 (7.25–25.0) | 7.58 (6.02–40.60) | 3730.00 (19.91–58.92) | 111.99 (71.02–158.70) | 6.47 (1.22–18.42) |
Shannon Index (H’) | 0.93 (0.76–1.07) | 0.60 (0.60–0.62) | 0.94 (0.66–01.30) | 0.17 (0.11–0.96) | 1.19 (0.57–1.84) |
Margalef (M) | 0.76 (0.73–0.96) | 0.75 (0.57–0.87) | 1.03 (0.89–1.23) | 0.89 (0.70–1.53) | 1.31 (1.11–138)) |
Evenness (J) | 0.42 (0.43–0.26) | 0.28 (0.26–0.32) | 0.35 (0.25–0.49) | 0.08 (0.05–0.31) | 0.53 (0.23–0.81) |
Dominance (D) | 0.59 (0.51–0.60) | 0.64 (0.59–0.70) | 0.57 (0.45–0.64) | 0.93 (0.60–0.96) | 0.47 (0.22–0.74) |
Metric | Cyanobacteria Density (N) | Cyanobacteria Biovolume (BV) |
---|---|---|
Nº of Taxa (S) | 0.032 | 0.131 |
Density (N) | 0.970 *** | 0.936 *** |
Biovolume (Bv) | 0.950 *** | 0.810 *** |
Dominance (D) | 0.688 ** | 0.591 ** |
Shannon Index (H’) | −0.753 *** | −0.683 *** |
Margalef (M) | −0.542 * | −0.429 |
Evenness (J) | −0.813 *** | −0.748 *** |
Dependent Variable | Independent Variables | Regression Coefficient | F Value | R2 | D.F. |
---|---|---|---|---|---|
Total biovolume | Na | 1.77 * | 19.34 | 0.84 | 18 |
Mg | −1.71 ** | ||||
NO3-N | 4.56 *** | ||||
HCO3 | −0.21 * | ||||
T | 8.58 *** | ||||
Density of Bacillariophyta | CO3 | −0.61 ** | 12.11 | 0.55 | 18 |
PPT | −2.66 *** | ||||
Density of Chlorophyta | K | −3.49 *** | 10.20 | 0.67 | 18 |
NH4-N | −13.17 * | ||||
HCO3 | −0.43 * | ||||
TN | −4.13 * | ||||
Density of Cyanobacteria | Na | 5.79 ** | 23.42 | 0.71 | 18 |
TP | −3.77 *** |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Morais, M.; Penha, A.M.; Novais, M.H.; Landim, L.; Victória, S.S.; Morales, E.A.; Barbosa, L.G. Some Observations on Phytoplankton Community Structure, Dynamics and Their Relationship to Water Quality in Five Santiago Island Reservoirs, Cape Verde. Water 2021, 13, 2888. https://doi.org/10.3390/w13202888
Morais M, Penha AM, Novais MH, Landim L, Victória SS, Morales EA, Barbosa LG. Some Observations on Phytoplankton Community Structure, Dynamics and Their Relationship to Water Quality in Five Santiago Island Reservoirs, Cape Verde. Water. 2021; 13(20):2888. https://doi.org/10.3390/w13202888
Chicago/Turabian StyleMorais, Manuela, Alexandra Marchã Penha, Maria Helena Novais, Leonel Landim, Sónia Silva Victória, Eduardo A. Morales, and Luciana Gomes Barbosa. 2021. "Some Observations on Phytoplankton Community Structure, Dynamics and Their Relationship to Water Quality in Five Santiago Island Reservoirs, Cape Verde" Water 13, no. 20: 2888. https://doi.org/10.3390/w13202888