Cloning and Characterization of ThSHRs and ThSCR Transcription Factors in Taxodium Hybrid ‘Zhongshanshan 406’
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Growth Conditions
2.2. Gene Cloning
2.3. Sequence Analysis
2.4. Real Time PCR Analysis of ThSHRs and ThSCR
2.5. Protoplast Transfection
3. Results
3.1. Molecular Cloning and Sequence Analysisof ThSHR and ThSCR Genes
3.2. Expression of ThSHR and ThSCR
3.3. Subcellular Localization of ThSHR and ThSCR Proteins
4. Discussion
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Guo, F.; Song, Z.; Sullivan, L.; Wang, H.; Liu, X.; Wang, X.; Li, Z.; Zhao, Y. Enhancing phytolith carbon sequestration in rice ecosystems through basalt powder amendment. Sci. Bull. 2015, 60, 591–597. [Google Scholar] [CrossRef] [Scilit]
- Porfírio, S.; da Silva, M.D.R.G.; Cabrita, M.J.; Azadi, P.; Peixe, A. Reviewing current knowledge on olive (Olea europaea L.) adventitious root formation. Sci. Hortic. 2016, 198, 207–226. [Google Scholar]
- Xu, M.; Xie, W.; Huang, M. Two WUSCHEL-related HOMEOBOX genes, PeWOX11a and PeWOX11b, are involved in adventitious root formation of poplar. Physiol. Plant. 2015, 155, 446–456. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, B.; Tong, C.; Yin, T.; Zhang, X.; Zhuge, Q.; Huang, M.; Wang, M.; Wu, R. Detection of quantitative trait loci influencing growth trajectories of adventitious roots in Populus using functional mapping. Tree Genet. Genomes 2009, 5, 539–552. [Google Scholar] [CrossRef] [Scilit]
- Da Costa, C.T.; De Almeida, M.R.; Ruedell, C.M.; Schwambach, J.; Maraschin, F.D.S.; Fett-Neto, A.G. When stress and development go hand in hand: Main hormonal controls of adventitious rooting in cuttings. Front. Plant Sci. 2013, 4, 133. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Di Laurenzio, L.; Wysocka-Diller, J.; Malamy, J.E.; Pysh, L.; Helariutta, Y.; Freshour, G.; Hahn, M.G.; Feldmann, K.A.; Benfey, P.N. The SCARECROW gene regulates an asymmetric cell division that is essential for generating the radial organization of the Arabidopsis root. Cell 1996, 86, 423–433. [Google Scholar] [CrossRef] [Scilit]
- Sabatini, S.; Heidstra, R.; Wildwater, M.; Scheres, B. SCARECROW is involved in positioning the stem cell niche in the Arabidopsis root meristem. Genes Dev. 2003, 17, 354–358. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koizumi, K.; Wu, S.; MacRae-Crerar, A.; Gallagher, K.L. An essential protein that interacts with endosomes and promotes movement of the short-root transcription factor. Curr. Biol. 2011, 21, 1559–1564. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clark, N.M.; Hinde, E.; Winter, C.M.; Fisher, A.P.; Crosti, G.; Blilou, I.; Gratton, E.; Benfey, P.N.; Sozzani, R. Tracking transcription factor mobility and interaction in Arabidopsis roots with fluorescence correlation spectroscopy. Elife 2016, 5, e14770. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Koizumi, K.; Hayashi, T.; Gallagher, K.L. SCARECROW reinforces short-root signaling and inhibits periclinal cell divisions in the ground tissue by maintaining SHR at high levels in the endodermis. Plant Signal. Behav. 2012, 7, 1573–1577. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nakajima, K.; Sena, G.; Nawy, T.; Benfey, P.N. Intercellular movement of the putative transcription factor SHR in root patterning. Nature 2001, 413, 307–311. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Della Rovere, F.; Fattorini, L.; D’Angeli, S.; Veloccia, A.; Del Duca, S.; Cai, G.; Falasca, G.; Altamura, M.M. Arabidopsis SHR and SCR transcription factors and AUX1 auxin influx carrier control the switch between adventitious rooting and xylogenesis in planta and in in vitro cultured thin cell layers. Ann. Bot. 2015, 115, 617–628. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ogasawara, H.; Kaimi, R.; Colasanti, J.; Kozaki, A. Activity of transcription factor JACKDAW is essential for SHR/SCR-dependent activation of SCARECROW and MAGPIE and is modulated by reciprocal interactions with MAGPIE, SCARECROW and SHORT ROOT. Plant Mol. Biol. 2011, 77, 489–499. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hirano, Y.; Nakagawa, M.; Suyama, T.; Murase, K.; Shirakawa, M.; Takayama, S.; Sun, T.P.; Hakoshima, T. Structure of the SHR-SCR heterodimer bound to the BIRD/IDD transcriptional factor JKD. Nat. Plants 2017, 3, 17010. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carlsbecker, A.; Lee, J.-Y.; Roberts, C.J.; Dettmer, J.; Lehesranta, S.; Zhou, J.; Lindgren, O.; Moreno-Risueno, M.A.; Vatén, A.; Thitamadee, S. Cell signalling by microRNA165/6 directs gene dose-dependent root cell fate. Nature 2010, 465, 316–321. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Scheres, B.; Di Laurenzio, L.; Willemsen, V.; Hauser, M.T.; Janmaat, K.; Weisbeek, P.; Benfey, P.N. Mutations affecting the radial organisation of the Arabidopsis root display specific defects throughout the embryonic axis. Development 1995, 121, 53–62. [Google Scholar]
- Wysocka-Diller, J.W.; Helariutta, Y.; Fukaki, H.; Malamy, J.E.; Benfey, P.N. Molecular analysis of SCARECROW function reveals a radial patterning mechanism common to root and shoot. Development 2000, 127, 595–603. [Google Scholar] [PubMed]
- Ueda, M.; Koshino-Kimura, Y.; Okada, K. Stepwise understanding of root development. Curr. Opin. Plant Biol. 2005, 8, 71–76. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qi, B.; Yang, Y.; Yin, Y.; Xu, M.; Li, H. De novo sequencing, assembly, and analysis of the Taxodium ‘zhongshansa’ roots and shoots transcriptome in response to short-term waterlogging. BMC Plant Biol. 2014, 14, 1. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, C.; Xu, S.; Yin, Y. Transcriptome analysis of the Taxodium ‘zhongshanshan 405’roots in response to salinity stress. Plant Physiol. Biochem. 2016, 100, 156–165. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Z.; Gu, C.; Xuan, L.; Hua, J.; Shi, Q.; Fan, W.; Yin, Y.; Yu, F. Identification of suitable reference genes in Taxodium ‘Zhongshanshan’ under abiotic stresses. Trees 2017, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Xu, M.; Zhang, B.; Su, X.; Zhang, S.; Huang, M. Reference gene selection for quantitative real-time polymerase chain reaction in Populus. Anal. Biochem. 2011, 408, 337–339. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, M.; Xie, W.; Huang, M. Overexpression of PeRHD3 alters the root architecture in Populus. Biochem. Biophys. Res. Commun. 2012, 424, 239–244. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tan, B.; Xu, M.; Chen, Y.; Huang, M. Transient expression for functional gene analysis using Populus protoplasts. Plant Cell Tissue Organ Cult. 2013, 114, 11–18. [Google Scholar] [CrossRef] [Scilit]
- Combet, C.; Blanchet, C.; Geourjon, C.; Deléage, G. NPS@: Network protein sequence analysis. Trends Biochem. Sci. 2000, 25, 147–150. [Google Scholar] [CrossRef] [Scilit]
- Sigrist, C.J.A.; De Castro, E.; Cerutti, L.; Cuche, B.A.; Hulo, N.; Bridge, A.; Bougueleret, L.; Xenarios, I. New and continuing developments at PROSITE. Nucleic Acids Res. 2012, 41, D344–D347. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, D.; Iyer, L.M.; Aravind, L. Bacterial GRAS domain proteins throw new light on gibberellic acid response mechanisms. Bioinformatics 2012, 28, 2407–2411. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cenci, A.; Rouard, M. Evolutionary Analyses of GRAS Transcription Factors in Angiosperms. Front. Plant Sci. 2017, 8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kamiya, N.; Itoh, J.I.; Morikami, A.; Nagato, Y.; Matsuoka, M. The SCARECROW gene’s role in asymmetric cell divisions in rice plants. Plant J. 2003, 36, 45–54. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xuan, L.; Xu, M.; Chen, C.; Yang, C.; Xu, L.; Huang, M. Identification and characterization of three PeSHRs and one PeSCR involved in adventitious root development of Populus. Plant Cell Tissue Organ Cult. 2014, 117, 253–264. [Google Scholar] [CrossRef] [Scilit]
- Bolle, C. The role of GRAS proteins in plant signal transduction and development. Planta 2004, 218, 683–692. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yoon, E.K.; Dhar, S.; Lee, M.-H.; Song, J.H.; Lee, S.A.; Kim, G.; Jang, S.; Choi, J.W.; Choe, J.-E.; Kim, J.H. Conservation and diversification of the SHR-SCR-SCl23 regulatory network in the development of the functional endodermis in Arabidopsis shoots. Mol. Plant 2016, 9, 1197–1209. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kaufmann, K.; Pajoro, A.; Angenent, G.C. Regulation of transcription in plants: Mechanisms controlling developmental switches. Nat. Rev. Genet. 2010, 11, 830–842. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pysh, L.D.; Wysocka-Diller, J.W.; Camilleri, C.; Bouchez, D.; Benfey, P.N. The GRAS gene family in Arabidopsis: Sequence characterization and basic expression analysis of the SCARECROW-like genes. Plant J. 1999, 18, 111–119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, M.-H.; Kim, B.; Song, S.-K.; Heo, J.-O.; Yu, N.-I.; Lee, S.A.; Kim, M.; Kim, D.G.; Sohn, S.O.; Lim, C.E. Large-scale analysis of the GRAS gene family in Arabidopsis thaliana. Plant Mol. Biol. 2008, 67, 659–670. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Helariutta, Y.; Fukaki, H.; Wysocka-Diller, J.; Nakajima, K.; Jung, J.; Sena, G.; Hauser, M.-T.; Benfey, P.N. The short-root gene controls radial patterning of the Arabidopsis root through radial signaling. Cell 2000, 101, 555–567. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Andersson-Gunnerås, S.; Gaboreanu, I.; Hertzberg, M.; Tucker, M.R.; Zheng, B.; Leśniewska, J.; Mellerowicz, E.J.; Laux, T.; Sandberg, G. Reduced expression of the short-root gene increases the rates of growth and development in hybrid poplar and Arabidopsis. PLoS ONE 2011, 6, e28878. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, S.; Gallagher, K.L. Intact microtubules are required for the intercellular movement of the short-root transcription factor. Plant J. 2013, 74, 148–159. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lim, J.; Helariutta, Y.; Specht, C.D.; Jung, J.; Sims, L.; Bruce, W.B.; Diehn, S.; Benfey, P.N. Molecular analysis of the SCARECROW gene in maize reveals a common basis for radial patterning in diverse meristems. Plant Cell 2000, 12, 1307–1318. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Richards, D.E.; Peng, J.; Harberd, N.P. Plant GRAS and metazoan STATs: One family? Bioessays 2000, 22, 573–577. [Google Scholar] [CrossRef] [Scilit]
- Miyashima, S.; Hashimoto, T.; Nakajima, K. ARGONAUTE1 acts in Arabidopsis root radial pattern formation independently of the SHR/SCR pathway. Plant Cell Physiol. 2009, 50, 626–634. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heidstra, R.; Welch, D.; Scheres, B. Mosaic analyses using marked activation and deletion clones dissect Arabidopsis SCARECROW action in asymmetric cell division. Genes Dev. 2004, 18, 1964–1969. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Primer-ID | Forward PCR Primer (5′-3′) | Reverse PCR Primer (5′-3′) |
|---|---|---|
| ThSHR1_3OUTER | TGTGTGAGCGCCGTGAGAAGGCTGTGCA | TACCGTCGTTCCACTAGTGATTT |
| ThSHR1_3INNER | TTTTGCAGTTTTTTGTAAGTCCTG | CGCGGATCCTCCACTAGTGATTTCACTATAGG |
| ThSHR1_5OUTER | CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT | ATCCATAGAAGATGCTGCATTCGC |
| ThSHR1_5INNER | CTAATACGACTCACTATAGGGC | GTTGGTGGTGGTATTGGGCTTCTC |
| ThSHR1_ORF | ATGGATAGATTGTTTACCTCCAGCATA | TTACAAGCAAGGCTTCCAGGCGG |
| ThSHR1_qRT-PCR | TACCCGCGACCTTCAGTGAC | CAGGCGGAAGCCCAAATGAC |
| ThSHR2_3OUTER | TTCTGTTATGAAGGAAATAGGGCA | TACCGTCGTTCCACTAGTGATTT |
| ThSHR2_3INNER | TCAGCCTGTGTTTCGTTTCGCTTGA | CGCGGATCCTCCACTAGTGATTTCACTATAGG |
| ThSHR2_5OUTER | CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT | CTGAACTCAAACGGCACTCCCATAA |
| ThSHR2_5INNER | CTAATACGACTCACTATAGGGC | AGGGACTAGCCTCCTGGAATTTCAG |
| ThSHR2_ORF | ATGTCATATAGTTTTTATACCCATTC | CTATTTAGGTTTCCAGGCAGAAG |
| ThSHR2_qRT-PCR | ACTCAGTGGCCCATGCTGTT | AACGGCACTCCCATAAGCCT |
| ThSCR_3OUTER | ATCCTGATGACAGCATAGAAAGACA | TACCGTCGTTCCACTAGTGATTT |
| ThSCR_3INNER | TGGAACTCTCAAACTTGGCTGGAAAGAC | CGCGGATCCTCCACTAGTGATTTCACTATAGG |
| ThSCR_5OUTER | CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT | ACATTGGAGTAGAAGATCCAGAAGG |
| ThSCR_5INNER | CTAATACGACTCACTATAGGGC | TCCAGTTTGCAGCTCCAATTTCATC |
| ThSCR_ORF | ATGACATTTGCTTCTTCTAAATTGTGTG | TTACAGTGCATCATGGGTGGGTGTC |
| ThSCR_qRT-PCR | ATGGCCAGGGCTATTCCACA | CTGCCTGTTGCCTCCAATGC |
| APRT_qRT-PCR | TCCACAGGTTCTTGAATCGCT | TGACTTGAGCCTCATTCGCTC |
| Gene_ID | Full-Length cDNA(bp) | 5′-UTR (bp) | 3′-UTR (bp) | ORF (bp) | Predicted Peptide | Secondary Structure Prediction | |||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| MW (kDa) | PI | GRAVY | Hh (%) | Ee (%) | Tt (%) | Cc (%) | |||||
| ThSHR1 | 2069 | 332 | 282 | 1455 | 55.52 | 5.58 | −0.383 | 41.32 | 14.46 | 0.00 | 44.21 |
| ThSHR2 | 1515 | 52 | 173 | 1290 | 48.80 | 5.26 | −0.256 | 32.87 | 19.11 | 0.00 | 48.02 |
| ThSCR | 1909 | 220 | 93 | 1596 | 59.12 | 5.43 | −0.224 | 38.61 | 17.33 | 0.00 | 44.07 |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Z.; Yin, Y.; Hua, J.; Fan, W.; Yu, C.; Xuan, L.; Yu, F. Cloning and Characterization of ThSHRs and ThSCR Transcription Factors in Taxodium Hybrid ‘Zhongshanshan 406’. Genes 2017, 8, 185. https://doi.org/10.3390/genes8070185
Wang Z, Yin Y, Hua J, Fan W, Yu C, Xuan L, Yu F. Cloning and Characterization of ThSHRs and ThSCR Transcription Factors in Taxodium Hybrid ‘Zhongshanshan 406’. Genes. 2017; 8(7):185. https://doi.org/10.3390/genes8070185
Chicago/Turabian StyleWang, Zhiquan, Yunlong Yin, Jianfeng Hua, Wencai Fan, Chaoguang Yu, Lei Xuan, and Fangyuan Yu. 2017. "Cloning and Characterization of ThSHRs and ThSCR Transcription Factors in Taxodium Hybrid ‘Zhongshanshan 406’" Genes 8, no. 7: 185. https://doi.org/10.3390/genes8070185
APA StyleWang, Z., Yin, Y., Hua, J., Fan, W., Yu, C., Xuan, L., & Yu, F. (2017). Cloning and Characterization of ThSHRs and ThSCR Transcription Factors in Taxodium Hybrid ‘Zhongshanshan 406’. Genes, 8(7), 185. https://doi.org/10.3390/genes8070185

