Molecular-Marker-Based Design for Breeding Indica–Japonica Hybrid Rice with Bacterial Blight Resistance
Jiaxing Academy of Agricultural Sciences, Jiaxing 314010, China
*
Author to whom correspondence should be addressed.
Genes 2025, 16(6), 719; https://doi.org/10.3390/genes16060719
Submission received: 9 May 2025
/
Revised: 30 May 2025
/
Accepted: 17 June 2025
/
Published: 18 June 2025
(This article belongs to the Section Plant Genetics and Genomics)
Abstract
Background/Objectives: To overcome the limitations imposed by bacterial blight on widely adopted indica–japonica hybrid rice, this study employed molecular design breeding strategies to develop a resistant germplasm. Methods: Through conventional backcross breeding combined with molecular-marker-assisted selection, the Xa23-carrying material XR39 was hybridized with the wide-compatibility restorer line R5315 harboring the S5n gene. Progeny selection integrated evaluations of agronomic traits, disease resistance identification, and test-crossing with sterile lines. Results: Five wide-compatibility restorer lines simultaneously incorporating the Xa23 and S5n genes were successfully developed, demonstrating outstanding bacterial blight resistance and restoration ability. The selected hybrid combinations, A3/RP1, A1/RP4, and A4/RP4, exhibited yield increases of 2.6–8.6% compared to the control. Conclusions: This study not only established a novel germplasm for developing bacterial blight-resistant indica–japonica hybrid rice varieties, but also established a model for gene design breeding for rice improvement.
1. Introduction
Bacterial blight caused by Xanthomonas oryzae is one of the most destructive diseases in rice [1]. In epidemic years, production in the affected areas is generally reduced by 20%–30%, reaching up to 80% in severe cases [2,3]. In recent years, the incidence of bacterial blight in Zhejiang Province, China, has been increasing. Between 2014 and 2016, late rice cultivation in Zhejiang Province experienced numerous disease outbreaks during the later stages of growth [4,5]. These outbreaks were observed in various regions including Wenzhou, Taizhou, Ningbo, Shaoxing, Jinhua, Lishui, and Quzhou, indicating a rapid dissemination in certain areas. In 2019, the late-rice-affected area in Zhejiang Province was 16,700 hectares, which increased to over 32,700 hectares in 2021. Particularly severe damage has been observed in specific regions such as Taizhou, Jinhua, and Quzhou, leading to persistent late rice crop failures. The situation regarding prevention and control is notably critical. Developing and promoting rice varieties with multiple resistances is the most effective approach for disease and pest prevention and management [6]. Forty-two genes providing resistance to rice bacterial blight have been identified to date [7,8]. Among them, the Xa23 gene, known for its broad-spectrum resistance, high resistance levels, and durable resistance properties, was originally identified in common wild rice by Wang et al. [9], and created a nearly isogenic line CBB23, which is widely used in breeding. Wang et al. [10,11] initially mapped the Xa23 locus to a 49.8 kb region on chromosome 11, and then further cloning studies showed that the susceptible Xa23 allele has an identical open reading frame of Xa23 but differs in the promoter region for lack of the TALE binding element for AvrXa23. Tian et al. [12] demonstrated that Xa23 maintained its broad-spectrum resistance to the Xoo strain in rice cultivation regions of southern China between 2019 and 2021.
In 1987, Yuan Longping introduced three stages of hybrid rice breeding incorporating intervariety, intersubspecies, and distant hybridization advantages [13]. Indica–japonica hybrid rice exhibits traits such as large panicles, high grain count, sturdy stems, robust growth, and well-developed root systems. However, the practical application of intersubspecific heterosis has been significantly hindered by natural postzygotic reproductive isolation between indica and japonica subspecies, manifesting as hybrid sterility and low seed setting rates in offspring [14]. The S5n gene locus, which regulates female gamete fertility in rice, was initially identified by Ikehashi on chromosome 6 [15]. Subsequent research has focused on the precise localization and exploration of the S5n locus [16,17]. Through map-based cloning and genetic analysis, it has been established that the three linked genes (ORF3, ORF4, ORF5) at the S5n locus interact genetically, constituting a “killer–protector” system that governs the fertility and segregation of female gametes in rice indica–japonica hybrids [18]. A critical breakthrough came with the identification of a 136 bp deletion in S5n alleles differentiating indica and japonica subspecies [16], which enabled the development of the functional InDel marker S5-136 for molecular screening [19]. This genetic marker has since become an essential tool for marker-assisted selection breeding and germplasm characterization [20,21]. In China’s Zhejiang Province, these scientific advances have facilitated the successful development of three-line indica–japonica hybrid rice systems. Notable commercial varieties, including Yongyou, Zheyou, Chunyou, and Jiayou series, combine japonica cytoplasmic male sterile lines with wide-compatibility indica restorer lines. These achievements demonstrate the effective translation of intersubspecific hybridization research into practical agricultural applications through the strategic integration of germplasm resources and molecular breeding technologies.
In this study, the rice intermediate material XR39, harboring the Xa23 gene for bacterial blight resistance, was crossed with R5315, a wide-compatibility restorer line carrying the S5n gene. Through molecular-marker-assisted selection, five wide-compatibility restorer lines with the Xa23 gene were identified. The indica–japonica hybrid rice derived from this combination exhibits strong resistance to bacterial blight, high yield potential, and promising developmental prospects.
2. Materials and Methods
2.1. Experimental Materials
XR39 and R5315 were provided by Jiaxing Academy of Agricultural Sciences. Four different BT-type japonica rice sterile lines (A1–A4) were used, namely, Jiatong A, Jianing A, Jia238A, Quanjing 1A, Jiatong A, Jianing A, and Jia238A, which were independently selected by Jiaxing Academy of Agricultural Sciences, while Quanjing 1A was provided by Anhui Quanyin High tech Seed Industry Co., Ltd., Hefei, China.
2.2. RP1–5 Breeding Process (Figure 1)
2.2.1. Parental Material Development (2019–2020)
Summer 2019: Hybridization was conducted at the experimental field of Jiaxing Academy of Agricultural Sciences using the bacterial-blight-resistant material XR39 (carrying the Xa23 resistance gene) as the maternal parent and the wide-compatibility restorer line R5315 as the paternal parent, yielding 15 hybrid seeds.
Spring 2020: F1 generation screening was performed at the Lingshui experimental station in Hainan. False hybrids were removed through phenotypic identification, and 13 true hybrid plants were retained and bulk-harvested.
2.2.2. Population Construction and Multi-Generational Selection (2020–2022)
Summer 2020: Approximately 4000 F2 plants were cultivated at Jiaxing. Bacterial blight resistance was evaluated at the booting stage, and 45 elite plants were selected based on comprehensive agronomic traits at maturity. Molecular-marker-assisted selection (MAS) further narrowed the pool to 32 plants.
Spring 2021: A total of 34 elite plants from 12 F3 lines were retained at the Lingshui station after MAS and agronomic trait evaluation.
Summer 2021: Through continuous self-pollination and field selection, 30 stable F4 lines from 10 families were obtained in Jiaxing.
Spring 2022: Molecular marker validation of 30 F5 lines was conducted in Hainan. Concurrently, test crosses were performed with male sterile lines (e.g., Jianing A, Jiatong A), yielding 90 hybrid combinations.
2.2.3. Combining Ability Evaluation (2022–2023)
Summer 2022: At Jiaxing, combining ability tests identified 5 superior hybrid combinations (RP1–RP5). Three plants per combination were bulk-harvested, totaling 15 core lines.
Spring 2023: Expanded test crosses with four male sterile lines (Jianing A, Jiatong A, Jia238 A, Quangeng1 A) generated 120 new hybrid combinations.
2.2.4. Line Stabilization and Field Trials (2023–2024)
Summer 2023: A re-evaluation of 120 F8 combinations at Jiaxing confirmed the superiority of RP1–RP5.
Spring 2024: Small-scale seed production was initiated in Hainan, generating 20 hybrid combinations with four male sterile lines.
Summer 2024: Field trials and community demonstrations at Jiaxing evaluated the agronomic performance, disease resistance, and yield potential of the new combinations.
Figure 1.
Selection process for stable strains with bacteria blight resistance.
2.3. Management of Experimental Fields and Evaluation of Agronomic Traits
The experimental design employed a systematic planting configuration with 6 rows of 6 plants per line (36 plants per line) for each generation, and each hybrid combination was cultivated in 45 rows containing 6 plants per row at a spacing of 15 cm between rows and 20 cm within rows. Yongyou 1540, an indica–japonica hybrid rice variety from the regional trial in China, was used as the control.
The heading stage of rice was recorded. After the rice matured, the edge rows were removed from in each plot. Three plants were selected from the middle rows, and the plant height (PH), effective panicle number per plant (EPNPP), thousand-grain weight (TGW), total grain number per panicle (TGNPP), seed setting rate (SSR), single panicle weight (SPW), grain length (GL), and grain width (GW) were measured.
2.4. Molecular Marker Detection
DNA was extracted from leaf tissue using a rapid method reported by Zeng et al. [22], with minor modifications. The bacterial blight resistance gene Xa23 was identified using the linked marker RM26985 and the functional marker Xa23-fun [23]. The wide-compatibility gene S5n was detected using marker S5136 [19]. The primers used were synthesized by Shanghai Sangon Biotech Co., Ltd., Shanghai, China and specific sequence information is detailed in Table 1. The PCR reaction mixture (20 μL total volume) contained 10 μL 2 × PCR Mix, 1 μL each of 10 μmol/L forward and reverse primers, 2 μL DNA template, and 6 μL ddH2O. The PCR program was as follows: 94 °C for 5 min; 29 cycles of 94 °C for 1 min, 55 °C for 1 min, 72 °C for 1 min, and a final extension at 72 °C for 7 min. Amplified products were separated using 4% agarose gel electrophoresis and visualized using nucleic acid dye.
2.5. Identification of Bacterial Blight Resistance in the Field
The identification strain P6 was provided by the Institute of Plant Protection and Microbiology, Zhejiang Academy of Agricultural Sciences. The artificial leaf cutting method was employed to evaluate the rice bacterial blight resistance at the heading stage. This involved dipping scissors into a bacterial solution and cutting approximately 2 cm of sword leaves, with 4–5 leaves being cut from each plant. Disease incidence was assessed 20 days post-inoculation following the criteria established by Jiang et al. [24] (Table 1).
2.6. Statistical Analyses
Data organization and statistical analysis were conducted using Microsoft Excel 2010, GraphPad Prism 8, and SAS 9.4. One-way ANOVA was used to analyze variance and t-tests were conducted with significance levels of p < 0.05 and p < 0.01.
3. Results
3.1. Molecular Detection of Resistance Gene Xa23 and Wide-Compatibility Gene S5n in F2 Populations
The analysis employed the linkage marker RM26985 and the functional marker Xa23-fun for Xa23 identification, along with the linkage marker S5136 for S5n detection (Table 2). Distinct amplification patterns were observed: RM26985 produced 183 bp and 166 bp fragments in XR39 and XR5315, respectively; Xa23-fun generated a 105 bp fragment in XR39, but no effective product in XR5315; and S5136 amplified 577 bp and 441 bp fragments in XR39 and XR5315, respectively (Figure 2). Notably, two materials lacking the Xa23 gene were identified through molecular marker analysis, despite prior phenotypic selection of resistant plants following artificial inoculation with the bacterial blight pathogen Xanthomonas oryzae. This discrepancy indicates that phenotypic selection alone may yield false positives due to a measurable error rate in resistance identification. Significant polymorphism was observed in these markers, both between parental lines XR39 and XR5315 and within the F2 segregating populations. These findings validate the effectiveness of these markers for implementing marker-assisted selection in hybrid breeding programs.
3.2. Breeding of Wide-Compatibility Restorer Lines Resistant to Bacterial Blight
The parental line XR39 containing the Xa23 gene was crossed with the parental line R5315 harboring the wide-compatibility gene S5n. Molecular markers were employed to screen the progeny plants, and the results were combined with field inoculation identification until a homozygous disease-resistant line was obtained. Figure 3 presents the molecular detection results of some materials from the high-generation population. It can be observed that all of the F6 generation carries both the Xa23 gene for resistance to bacterial blight and the S5n gene for wide compatibility.
3.3. Bacterial Blight Resistance Performance of Five Wide-Compatibility Restorer Lines and Twenty Hybrid Combinations
After agronomic trait evaluation and combining ability testing, five wide-compatibility restorer lines (RP1–5) carrying the Xa23 and S5n genes for resistance to bacterial blight were established in the F8 generation (Figure 4). Bacterial blight resistance was examined in five wide-compatibility restorers and their 20 hybrid combinations using Xanthomonas oryzae P6. The results show that, except for R5315 and Yongyou 1540, which were not detected in Xa23, all materials were resistant to bacterial blight at the boot stage (Table 3).
3.4. Main Agronomic Trait Performance of Five Wide-Compatibility Restorer Lines and Twenty Hybrid Combinations
According to Table 4, RP1 and RP5 had the shortest sowing duration, both 4 days earlier than R5315. The plant height of RP2, RP3, RP4, and RP5 was significantly lower than that of R5313, suggesting that their lodging resistance may be improved. The analysis of yield-related agronomic traits showed that the effective panicle number per plant of the five wide-compatibility restorer lines were not significantly different from R5315. The single panicle weight of RP1 and RP4 was significantly higher than that of R5315. RP1 benefited from significantly higher total grain number per panicle and seed setting rate than R5315. RP4 benefited from significantly higher 1000-grain weight and total grain number per panicle than R5315. The analysis of grain type traits showed that RP2 had the longest grain and RP1 had the shortest grain, which were 8.75 mm and 7.66 mm, respectively. RP4 has the narrowest grain and RP2 has the widest grain at 2.29 mm and 2.79 mm, respectively. Considering grain-related traits, RP2, a large grain restorer line, has the highest 1000-grain weight and the widest and longest grains. RP4 grains are a slender grain type and exhibit the largest length/width ratio.
The agronomic characteristics of 20 hybrid combinations showed that the yields of A3/RP1, A1/RP4, and A4/RP4 were higher than those of the control, Yongyou 1540, with an increase of 2.6%, 8.6%, and 2.9%, respectively (Table 5). Further, the total grain number per panicle of the combinations A3/RP1 and A4/RP4 was higher than that of the control, while the combination A1/RP4 had a higher total grain number per panicle and 1000-grain weight than that of the control. The duration from seeding to heading of the three high-yielding combinations was earlier than that of the control, and the plant height was lower. Among them, the duration of A4/RP4 was 21 days earlier than that of the control, and the plant height was 13.2% lower; A3/IRP1 was 7 days earlier than the control, and the plant height was 3.2% lower; and A1/RP4 was 7 days earlier than the control, and the plant height was 5.4% lower. The three combinations have the characteristics of short plant height, early growth period, and high yield, indicating that they have good prospects for production and application (Figure 5).
4. Discussion
Recently, rice bacteria blight has become severe in some regions of China, posing significant risks to rice safety production. By improving the defense system of rice itself, the cultivation of a new variety of long-spectrum disease-resistant rice is the most environmentally friendly and most effective disease prevention measure [25]. Molecular-marker-assisted selective breeding can be carried out at the genetic level, which is one of the best means to achieve the high efficiency polymerization of multiple excellent traits. The Xa23 gene is an apparent rice bacterial blight resistance gene, which has been widely used in the bacterial blight resistance of hybrid rice. Huang et al. [26] successfully introduced the Xa23 gene into the two-series infertility line Quan 211S with the use of marker-assisted selection technology. Yang et al. [27] used the full genome background to choose technology to introduce the Xa23 gene into the two-series infertility line Feng 39S. The genetic background was successfully selected in a similar way to Feng 39S. Huang et al. [28] found that the conventional japonica rice Ning 84 imported the Xa23 gene using marker-assisted selection technology, significantly improving the resistance to bacterial leaf blight. In previous studies, the majority of Xa23 gene applications used indica hybrid rice, with few involving indica–japonica hybrid rice [26,27]. Thanks to recent genetic research and the selection of recovery systems, indica–japonica hybrid rice has been promoted and applied in China [29]. Song et al. [30] selected the S5n gene through molecular-marker-assisted selection to breed the broad affinity restorer line Zhehui 810, and further developed a new indica–japonica hybrid rice variety Zheyou 810. In this study, Xa23 was detected through the linked marker RM26985 in the low generation, and the functional marker Xa23-fun with complete dominance was used in the high generation. The results show that inoculation and appraisal are highly consistent. There are multiple reasons for the wide-compatibility molecular mechanism in rice, and its genetic regulation is regulated in many different ways [14]. Our study used the marker S5136 linked with S5n to detect the wide compatibility. Combined with the determination of coordination force, five wide-compatibility restorer lines were successfully bred, further verifying the applicability of the molecular marker S5136. Further, we tested the broad compatibility restorer line with resistance to bacterial blight selected in this study and matched it with four three-line japonica CMS lines. Among them, the three combinations A3/RP1, A1/RP4, and A4/RP4 have excellent agronomic traits, indicating good development prospects. Accordingly, the research ideas and methods are feasible for developing new indica–japonica hybrid rice varieties by breeding wide-compatibility restorer lines with resistance to bacterial blight by aggregating S5n and Xa23 genes.
5. Conclusions
The bacterial blight-resistant indica–japonica hybrid rice combinations developed in this study exhibit robust disease resistance, high yield potential, and favorable agronomic traits, providing novel breeding materials with dual disease resistance and wide compatibility for ongoing improvement. By adopting a marker-assisted gene pyramiding strategy, this study achieved the technical integration of disease resistance resources and distant hybridization advantages, offering a paradigm for breeding new rice varieties.
Author Contributions
The experiments were conceived and designed by J.D. and H.F. The partial execution of the experiments and the data analysis were conducted by J.D., Y.L. and X.Z. J.D. was responsible for preparing the initial manuscript draft. Subsequently, X.Z., Y.L. and H.F. collaboratively revised the manuscript. All authors have read and agreed to the published version of the manuscript.
Funding
The financial support for this study originated from the Key Scientific and Technological Grant of Zhejiang for Breeding New Agricultural Varieties (2021C02063), the Jiaxing Key Research and Development Plan Project (2024BZ20006), and the Jiaxing Scientific Research Project (2024AZ10007).
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.
Conflicts of Interest
The authors declare no conflicts of interest.
References
- Yang, Y.; Zhou, Y.; Sun, J.; Liang, W.; Chen, X.; Wang, X.; Zhou, J.; Yu, C.; Wang, J.; Wu, S.; et al. Research Progress on Cloning and Function of Xa Genes Against Rice Bacterial Blight. Front. Plant Sci. 2022, 13, 847199. [Google Scholar] [CrossRef] [PubMed]
- Dossa, G.S.; Quibod, I.; Atienza-Grande, G.; Oliva, R.; Maiss, E.; Vera Cruz, C.; Wydra, K. Rice Pyramided Line IRBB67 (Xa4/Xa7) Homeostasis under Combined Stress of High Temperature and Bacterial Blight. Sci. Rep. 2020, 10, 683. [Google Scholar] [CrossRef] [PubMed]
- Jiang, N.; Yan, J.; Liang, Y.; Shi, Y.; He, Z.; Wu, Y.; Zeng, Q.; Liu, X.; Peng, J. Resistance Genes and Their Interactions with Bacterial Blight/Leaf Streak Pathogens (Xanthomonas oryzae) in Rice (Oryza sativa, L.)—An Updated Review. Rice 2020, 13, 3. [Google Scholar] [CrossRef] [PubMed]
- Xue, Y.; Hu, M.; Chen, S.; Hu, A.; Li, S.; Han, H.; Lu, G.; Zeng, L.; Zhou, J. Enterobacter asburiae and Pantoea ananatis Causing Rice Bacterial Blight in China. Plant Dis. 2021, 105, 2078–2088. [Google Scholar] [CrossRef]
- Yu, L.; Yang, C.; Ji, Z.; Zeng, Y.; Liang, Y.; Hou, Y. First Report of New Bacterial Leaf Blight of Rice Caused by Pantoea ananatis in Southeast China. Plant Dis. 2022, 106, 310. [Google Scholar] [CrossRef]
- Huang, F.; He, N.; Yu, M.; Li, D.; Yang, D. Identification and Fine Mapping of a New Bacterial Blight Resistance Gene, Xa43(t), in Zhangpu Wild Rice (Oryza rufipogon). Plant Biol. 2023, 25, 433–439. [Google Scholar] [CrossRef]
- Huang, B.; Xu, J.Y.; Hou, M.S.; Ali, J.; Mou, T.M. Introgression of Bacterial Blight Resistance Genes Xa7, Xa21, Xa22 and Xa23 into Hybrid Rice Restorer Lines by Molecular Marker-Assisted Selection. Euphytica 2012, 187, 449–459. [Google Scholar] [CrossRef]
- Javed, M.A.; Ali, S.W.; Ashfaq, M.; Tabassam, J.; Ali, M.; IhsanUllah, M.; Nayab, S.F.; Kaya, Y.; Khalili, E.; Ali, Q.; et al. Molecular Profiling of Bacterial Blight Resistance in Malaysian Rice Cultivars. Braz. J. Biol. 2022, 82, e256189. [Google Scholar] [CrossRef]
- Wang, C.; Qin, T.; Yu, H.; Zhang, X.; Che, J.; Gao, Y.; Zheng, C.; Yang, B.; Zhao, K. The Broad Bacterial Blight Resistance of Rice Line CBB 23 Is Triggered by a Novel Transcription Activator-like (TAL) Effector of X Anthomonas Oryzae Pv. Oryzae. Mol. Plant Pathol. 2014, 15, 333–341. [Google Scholar] [CrossRef]
- Wang, C.; Fan, Y.; Zheng, C.; Qin, T.; Zhang, X.; Zhao, K. High-Resolution Genetic Mapping of Rice Bacterial Blight Resistance Gene Xa23. Mol. Genet. Genom. 2014, 289, 745–753. [Google Scholar] [CrossRef]
- Wang, C.; Zhang, X.; Fan, Y.; Gao, Y.; Zhu, Q.; Zheng, C.; Qin, T.; Li, Y.; Che, J.; Zhang, M.; et al. XA23 Is an Executor R Protein and Confers Broad-Spectrum Disease Resistance in Rice. Mol. Plant 2015, 8, 290–302. [Google Scholar] [CrossRef] [PubMed]
- Tian, C.Y.; Fang, Y.L.; Shen, Q.; Wang, H.J.; Chen, X.F.; Guo, W.; Zhao, K.J.; Wang, C.L.; Ji, Z.Y. Genotypic Diversity and Pathogenisity of Xanthomonas Oryzae Pv. Oryzae Isolated from Southern China in 2019-2021. Chin. Bull. Bot. 2023, 5, 743–749. [Google Scholar]
- Yuan, L.P. Breeding Strategy of Hybrid Rice. Hybrid Rice 1987, 1, 1–3. [Google Scholar]
- Ouyang, Y.D. Progress of Indica-Japonica Hybrid Sterility and Wide-Compatibility in Rice. Chin. Sci. Bull. 2016, 35, 3833–3841. [Google Scholar] [CrossRef]
- Ikehashi, H.; Araki, H. Genetics of F1 sterility in remote crosses of rice. In Rice Genetics; World Scientific: Singapore, 1986; pp. 119–130. [Google Scholar]
- Ji, Q.; Lu, J.; Chao, Q.; Gu, M.; Xu, M. Delimiting a Rice Wide-Compatibility Gene S 5 n to a 50 Kb Region. Theor. Appl. Genet. 2005, 111, 1495–1503. [Google Scholar] [CrossRef]
- Qiu, S.Q.; Liu, K.; Jiang, J.X.; Song, X.; Xu, C.G.; Li, X.H.; Zhang, Q. Delimitation of the Rice Wide Compatibility Gene S5 n to a 40-Kb DNA Fragment. Theor. Appl. Genet. 2005, 111, 1080–1086. [Google Scholar] [CrossRef]
- Chen, J.; Ding, J.; Ouyang, Y.; Du, H.; Yang, J.; Cheng, K.; Zhao, J.; Qiu, S.; Zhang, X.; Yao, J.; et al. A Triallelic System of S5 Is a Major Regulator of the Reproductive Barrier and Compatibility of Indica–Japonica Hybrids in Rice. Proc. Natl. Acad. Sci. USA 2008, 105, 11436–11441. [Google Scholar] [CrossRef]
- Yang, J.; Wang, J.; Cao, Q.; Chen, Z.D.; Zhong, W.G. Development and Application of a Functional Marker for Wide Compatibility Gene S5-n of Rice. Acta Agron. Sin. 2009, 35, 2000–2007. [Google Scholar] [CrossRef]
- Mi, J.; Li, G.; Huang, J.; Yu, H.; Zhou, F.; Zhang, Q.; Ouyang, Y.; Mou, T. Stacking S5-n and F5-n to Overcome Sterility in Indica-Japonica Hybrid Rice. TAG. Theor. Appl. Genet. 2016, 129, 563–575. [Google Scholar] [CrossRef]
- Priyadarshi, R.; Arremsetty, H.P.S.; Singh, A.K.; Khandekar, D.; Ulaganathan, K.; Shenoy, V.; Sinha, P.; Singh, V.K. Marker-Assisted Improvement of the Elite Maintainer Line of Rice, IR 58025B for Wide Compatibility (S5n) Gene. Front. Plant Sci. 2018, 9, 1051. [Google Scholar] [CrossRef]
- Zeng, Y.; Ji, Z.; Wen, Z.; Liang, Y.; Yang, C. Combination of Eight Alleles at Four Quantitative Trait Loci Determines Grain Length in Rice. PLoS ONE 2016, 11, e0150832. [Google Scholar] [CrossRef] [PubMed]
- Zhang, D.D.; Fan, Y.L.; Ji, X.Y.; Xia, Z.H. Variation and Functional Markers of Xa23 Promoter of Rice Bacterial Blight Resistance Gene. Mol. Plant Breed. 2020, 18, 7088–7094. [Google Scholar] [CrossRef]
- Jiang, J.; Yang, D.; Ali, J.; Mou, T. Molecular Marker-Assisted Pyramiding of Broad-Spectrum Disease Resistance Genes, Pi2 and Xa23, into GZ63-4S, an Elite Thermo-Sensitive Genic Male-Sterile Line in Rice. Mol. Breed. 2015, 35, 83. [Google Scholar] [CrossRef]
- Xing, J.; Zhang, D.; Yin, F.; Zhong, Q.; Wang, B.; Xiao, S.; Ke, X.; Wang, L.; Zhang, Y.; Zhao, C.; et al. Identification and Fine-Mapping of a New Bacterial Blight Resistance Gene, Xa47(t), in G252, an Introgression Line of Yuanjiang Common Wild Rice (Oryza rufipogon). Plant Dis. 2021, 105, 4106–4112. [Google Scholar] [CrossRef]
- Huang, Y.L.; Yan, Z.; Shen, G.L.; Wang, H.; Zhang, C.H.; Yang, W.; Chen, L.; Zhang, Y.H.; Pang, Z.S.; Qiao, M.; et al. Bacterial Blight Resistance of Rice Sterile Line ‘Quan 2l1S’ Improved by Molecular Marker-Assisted Selection. Chin. Agric. Sci. Bull. 2022, 38, 133–139. [Google Scholar]
- Yang, D.Y.; Xiong, L.Z.; Mou, T.M.; Mi, J.M. Improving the Resistance of the Rice PTGMS Line Feng39S by Pyramiding Blast, Bacterial Blight, and Brown Planthopper Resistance Genes. Crop J. 2022, 10, 1187–1197. [Google Scholar] [CrossRef]
- Huang, X.; Jin, L.C.; Ye, C.H.; Jiang, J.F.; Shi, X.B. Molecular Detection and Breeding Application of Some Disease and Inseet Resistance Genes Ofjaponica Rice Varieties/Lines Recently Developed in Zhejiang Province. Acta Agric. Zhejiangensis 2021, 33, 1159–1169. [Google Scholar]
- Dong, J.J.; Zhang, X.Y.; Fu, H.W.; Li, Y.F. Analysis of Genetic Parameters of Main Agronomic Characters of Hybrid Rice Between the Japonica CMS Line and Wide-Compatibility Indica Restorer Line. Hybrid Rice 2023, 38, 14–21. [Google Scholar]
- Song, J.; Cui, Y.; Fan, H.; Tang, L.; Wang, J. Molecular Breeding of Zheyou810, an Indica–Japonica Hybrid Rice Variety with Superior Quality and High Yield. Agriculture 2023, 13, 1807. [Google Scholar] [CrossRef]
Figure 2.
Molecular detection of resistance gene Xa23 and wide-compatibility gene S5n in F2 populations (M: DL2000 DNA Marker; 1: XR39; 2: XR5315; 3–47: F2 populations).
Figure 2.
Molecular detection of resistance gene Xa23 and wide-compatibility gene S5n in F2 populations (M: DL2000 DNA Marker; 1: XR39; 2: XR5315; 3–47: F2 populations).
Figure 3.
Molecular detection of resistance gene Xa23 and wide-compatibility gene S5n in F6 populations (M: DL2000 DNA Marker; 1: XR39; 2: XR5315; 3–29: F6 populations).
Figure 3.
Molecular detection of resistance gene Xa23 and wide-compatibility gene S5n in F6 populations (M: DL2000 DNA Marker; 1: XR39; 2: XR5315; 3–29: F6 populations).
Figure 4.
Molecular detection of resistance gene Xa23 and wide-compatibility gene S5n of five wide-compatibility restorer lines (M: DL2000 DNA Marker; 1: XR39; 2: XR5315; 3–7: RP1, RP2, RP3, RP4, RP5).
Figure 4.
Molecular detection of resistance gene Xa23 and wide-compatibility gene S5n of five wide-compatibility restorer lines (M: DL2000 DNA Marker; 1: XR39; 2: XR5315; 3–7: RP1, RP2, RP3, RP4, RP5).
Figure 5.
Yield and plant height of hybrid combinations.
Table 1.
Scoring of bacterial blight resistance.
| Lesion Rating | Resistance Level | Lesion Length |
|---|---|---|
| 0 | HR | <1 cm |
| 1 | R | 1–3 cm |
| 3 | MR | <1/4 of the inoculated leaf length |
| 5 | MS | 1/4–1/2 of the inoculated leaf length |
| 7 | S | 1/2–3/4 of the inoculated leaf length |
| 9 | HS | >3/4 of the inoculated leaf length |
Table 2.
Molecular marker information for identification.
| Gene | Primer | Primer Sequence (5′-3′) | Fragment Length (bp) |
|---|---|---|---|
| Xa23 | RM26985-F | CACAAGACAACCTTCAATGG | 183/166 |
| RM26985-R | GGCTTAGGAGCGTTTATAGG | ||
| Xa23-fun-F | AAAGTCCCTTCCGAAACATC | 105/- | |
| Xa23-fun-R | ATGAGGAAGTGCTGCCAGA | ||
| S5n | S5136-F | ATCAACCCATTTCCTTTCCT | 577/441 |
| S5136-R | ATACGCTCGATCGGATTAAC |
Table 3.
Identification of resistance to bacterial blight in five wide-compatibility restorers and their hybrid combinations.
Table 3.
Identification of resistance to bacterial blight in five wide-compatibility restorers and their hybrid combinations.
| Material | Lesion Rating | Resistance Level | Material | Lesion Rating | Resistance Level |
|---|---|---|---|---|---|
| XR39 | 0 | HR | A4/RP2 | 1 | R |
| R5315 | 9 | S | A1/RP3 | 0 | R |
| RP1 | 0 | HR | A2/RP3 | 1 | R |
| RP2 | 0 | HR | A3/RP3 | 1 | R |
| RP3 | 0 | HR | A4/RP3 | 1 | R |
| RP4 | 0 | HR | A1/RP4 | 0 | R |
| RP5 | 0 | HR | A2/RP4 | 1 | R |
| A1/RP1 | 0 | HR | A3/RP4 | 1 | R |
| A2/RP1 | 1 | R | A4/RP4 | 1 | R |
| A3/RP1 | 1 | R | A1/RP5 | 0 | R |
| A4/RP1 | 1 | R | A2/RP5 | 1 | R |
| A1/RP2 | 0 | R | A3/RP5 | 1 | R |
| A2/RP2 | 1 | R | A4/RP5 | 1 | R |
| A3/RP2 | 1 | R | 1540 | 9 | S |
Table 4.
Agronomic characteristics of wide-compatibility restorer lines with bacterial blight resistance.
Table 4.
Agronomic characteristics of wide-compatibility restorer lines with bacterial blight resistance.
| Traits | RP1 | RP2 | RP3 | RP4 | RP5 | R5315 |
|---|---|---|---|---|---|---|
| DSH (d) | 77.00 | 81.00 | 81.00 | 80.00 | 77.00 | 81.00 |
| PH (cm) | 103.4 ± 1.4 a | 95.0 ± 1.8 c | 96.5 ± 1.2 bc | 96.5 ± 1.3 bc | 97.6 ± 1.2 b | 104.8 ± 1.3 a |
| EPNPP | 7.4 ± 0.5 a | 7.8 ± 0.8 a | 8.0 ± 1.0 a | 8.0 ± 0.7 a | 8.2 ± 0.8 a | 7.2 ± 0.8 a |
| TGW (g) | 19.3 ± 0.2 e | 22.3 ± 0.3 a | 20.9 ± 0.4 c | 21.4 ± 0.2 b | 20.3 ± 0.2 d | 20.1 ± 0.3 d |
| TGNPP | 378.1 ± 3.0 a | 217.9 ± 1.5 e | 251.7 ± 3.8 d | 344.7 ± 5.6 b | 303.4 ± 5.5 c | 311.5 ± 6.4 c |
| SSR (%) | 85.2 ± 0.6 a | 80.6 ± 1.8 b | 76.9 ± 1.9 c | 79.1 ± 0.9 bc | 77.3 ± 1.2 c | 81.3 ± 0.3 b |
| SPW (g) | 6.2 ± 0.1 a | 3.9 ± 0.1 e | 4.0 ± 0.1 e | 5.8 ± 0.1 b | 4.8 ± 0.1 d | 5.1 ± 0.2 c |
| GL (mm) | 7.66 ± 0.14 d | 8.75 ± 0.07 a | 8.18 ± 0.09 b | 8.17 ± 0.04 b | 7.93 ± 0.04 c | 8.28 ± 0.07 b |
| GW (mm) | 2.48 ± 0.04 b | 2.79 ± 0.03 a | 2.42 ± 0.03 c | 2.29 ± 0.03 d | 2.41 ± 0.02 c | 2.42 ± 0.01 c |
| GL/GW | 3.09 ± 0.01 f | 3.13 ± 0.01 e | 3.39 ± 0.01 c | 3.56 ± 0.02 a | 3.29 ± 0.01 d | 3.42 ± 0.01 b |
The data are presented as means ± standard deviation (SD); different letters indicate significant difference at the p < 0.05 level. DSH: Duration from seeding to heading; PH: plant height; EPNPP: effective panicle number per plant; TGW: 1000-grain weight; TGNPP: total grain number per panicles; SSR: seed setting rate; SPW: single panicle weight; GL: grain length; GW: grain width.
Table 5.
Agronomic characteristics of combinations between five wide-compatibility restorer lines with bacterial blight resistance and four japonica CMS lines.
Table 5.
Agronomic characteristics of combinations between five wide-compatibility restorer lines with bacterial blight resistance and four japonica CMS lines.
| Hybrid Combinations | DSH (d) | PH (cm) | EPNPP | TGW (g) | TGNPP | SSR (%) | SPW (g) | Yield (t/hm2) | GL (mm) | GW (mm) | GL/GW |
|---|---|---|---|---|---|---|---|---|---|---|---|
| A1/RP1 | 97.0 | 117.0 ± 1.8 ** | 9.2 ± 0.8 | 18.9 ± 0.1 ** | 300.2 ± 5.0 ** | 65.2 ± 0.9 ** | 3.7 ± 0.1 ** | 7.68 | 7.68 | 2.68 | 2.89 |
| A2/RP1 | 101.0 | 105.2 ± 4.8 ** | 8.8 ± 0.8 | 20.6 ± 0.2 | 369.7 ± 4.5 ** | 74.6 ± 1.1 ** | 5.7 ± 0.1 * | 7.32 | 7.75 | 2.67 | 2.92 |
| A3/RP1 | 98.0 | 117.4 ± 1.4 ** | 9.2 ± 0.8 | 20.6 ± 0.2 | 359.2 ± 5.1 ** | 85.7 ± 0.5 ** | 6.3 ± 0.1 | 9.64 | 7.77 | 2.68 | 2.92 |
| A4/RP1 | 83.0 | 106.3 ± 2.2 ** | 9.2 ± 0.8 | 19.5 ± 0.2 ** | 349.6 ± 4.0 ** | 77.7 ± 1.9 ** | 5.3 ± 0.1 ** | 8.32 | 7.35 | 2.47 | 3 |
| A1/RP2 | 100.0 | 115.9 ± 2.3 ** | 8.8 ± 0.8 | 22.8 ± 0.2 ** | 298.4 ± 7.6 ** | 74.5 ± 0.9 ** | 5.1 ± 0.2 ** | 8.78 | 7.71 | 2.76 | 2.82 |
| A2/RP2 | 104.0 | 105.8 ± 1.1 ** | 6.8 ± 0.8 * | 23.9 ± 0.2 ** | 326.8 ± 9.3 | 76.9 ± 1.1 ** | 6.0 ± 0.2 | 8.96 | 8.26 | 2.75 | 3.02 |
| A3/RP2 | 100.0 | 107.7 ± 1.2 ** | 9.0 ± 1.0 | 23.9 ± 0.1 ** | 267.4 ± 4.4 ** | 84.9 ± 0.9 ** | 5.4 ± 0.1 ** | 9.33 | 8.06 | 2.65 | 3.07 |
| A4/RP2 | 84.0 | 104.3 ± 1.3 ** | 8.2 ± 0.8 | 22.3 ± 0.2 ** | 343.0 ± 3.6 ** | 75.0 ± 1.1.0 ** | 5.7 ± 0.1 * | 8.87 | 7.7 | 2.52 | 3.07 |
| A1/RP3 | 98.0 | 110.0 ± 3.5 ** | 10.2 ± 0.8 ** | 22.9 ± 0.1 ** | 298.4 ± 7.4 ** | 82.4 ± 0.6 ** | 5.6 ± 0.1 ** | 8.87 | 7.83 | 2.65 | 2.97 |
| A2/RP3 | 103.0 | 101.3 ± 2.3 ** | 8.2 ± 0.8 | 22.6 ± 0.2 ** | 272.8 ± 12 ** | 82.8 ± 1.1 ** | 5.1 ± 0.1 ** | 8.23 | 8.23 | 2.73 | 3.03 |
| A3/RP3 | 100.0 | 115.8 ± 2.5 ** | 9.6 ± 1.1 | 23.6 ± 0.1 ** | 227.4 ± 13.9 ** | 87.8 ± 1.5 * | 4.7 ± 0.2 ** | 8.78 | 7.78 | 2.77 | 2.84 |
| A4/RP3 | 85.0 | 105.3 ± 2.4 ** | 9.2 ± 0.8 | 21.1 ± 0.2 | 326.7 ± 15 | 81.2 ± 0.2 ** | 5.6 ± 0.2 * | 8.32 | 7.67 | 2.52 | 3.06 |
| A1/RP4 | 98.0 | 114.7 ± 1.0 ** | 8.4 ± 0.9 | 23.3 ± 0.2 ** | 356.1 ± 5.5 ** | 79.5 ± 0.9 ** | 6.6 ± 0.1 ** | 10.21 | 7.74 | 2.63 | 2.96 |
| A2/RP4 | 103.0 | 102.8 ± 2.0 ** | 7.4 ± 0.9 | 21.4 ± 0.2 ** | 270.4 ± 3.1 ** | 72.4 ± 1.2 ** | 4.2 ± 0.1 ** | 8.32 | 8.18 | 2.63 | 3.13 |
| A3/RP4 | 101.0 | 113.2 ± 2.5 ** | 9.2 ± 0.8 | 23.1 ± 0.1 ** | 244.3 ± 7.1 ** | 85.4 ± 0.2 ** | 4.8 ± 0.2 ** | 8.96 | 8.11 | 2.62 | 3.12 |
| A4/RP4 | 84.0 | 105.9 ± 1.6 ** | 8.2 ± 0.8 | 20.5 ± 0.1 | 371.1 ± 11.8 ** | 85.4 ± 0.8 ** | 6.5 ± 0.1 * | 9.67 | 7.62 | 2.49 | 3.09 |
| A1/RP5 | 100.0 | 113.0 ± 1.3 ** | 7.8 ± 0.8 | 21.8 ± 0.1 ** | 336.4 ± 14.5 | 80.7 ± 0.7 ** | 5.9 ± 0.2 | 8.41 | 7.58 | 2.68 | 2.85 |
| A2/RP5 | 106.0 | 119.5 ± 1.8 | 8.4 ± 0.9 | 21.7 ± 0.3 ** | 325.8 ± 9.6 | 74.7 ± 1.0 ** | 5.3 ± 0.1 ** | 7.10 | 7.67 | 2.71 | 2.85 |
| A3/RP5 | 99.0 | 113.0 ± 3.3 ** | 8.0 ± 0.7 | 21.9 ± 0.3 ** | 222.8 ± 2.7 ** | 78.3 ± 1.6 ** | 3.8 ± 0.1 ** | 7.90 | 7.71 | 2.68 | 2.9 |
| A4/RP5 | 86.0 | 111.3 ± 1.3 ** | 7.8 ± 0.8 | 23.4 ± 0.3 ** | 330.7 ± 6.2 | 72.8 ± 1.3 ** | 5.6 ± 0.2 * | 8.59 | 8.2 | 2.63 | 3.14 |
| Yongyou 1540 | 105.0 | 121.3 ± 2.0 | 8.2 ± 0.8 | 20.8 ± 0.2 | 321.2 ± 5.4 | 91.2 ± 1.2 | 6.1 ± 0.1 | 9.40 | 7.44 | 2.63 | 2.85 |
The agronomic traits were analyzed via t-test with Yongyou 1540 as the control (* indicates p < 0.05, ** indicates p < 0.01).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Dong, J.; Zhang, X.; Li, Y.; Fu, H. Molecular-Marker-Based Design for Breeding Indica–Japonica Hybrid Rice with Bacterial Blight Resistance. Genes 2025, 16, 719. https://doi.org/10.3390/genes16060719
AMA Style
Dong J, Zhang X, Li Y, Fu H. Molecular-Marker-Based Design for Breeding Indica–Japonica Hybrid Rice with Bacterial Blight Resistance. Genes. 2025; 16(6):719. https://doi.org/10.3390/genes16060719
Chicago/Turabian StyleDong, Junjie, Xinyue Zhang, Youfa Li, and Haowei Fu. 2025. "Molecular-Marker-Based Design for Breeding Indica–Japonica Hybrid Rice with Bacterial Blight Resistance" Genes 16, no. 6: 719. https://doi.org/10.3390/genes16060719
APA StyleDong, J., Zhang, X., Li, Y., & Fu, H. (2025). Molecular-Marker-Based Design for Breeding Indica–Japonica Hybrid Rice with Bacterial Blight Resistance. Genes, 16(6), 719. https://doi.org/10.3390/genes16060719
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
