Next Article in Journal
The Role of Artificial Intelligence in Identifying NF1 Gene Variants and Improving Diagnosis
Previous Article in Journal
De Novo Transcriptome Sequencing Analysis Revealed the Expression Patterns of Genes in Different Organs and the Molecular Basis of Polysaccharide Synthesis in Bletilla striata
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Genes
Volume 16
Issue 5
10.3390/genes16050559
genes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Identification of Mustard Aldehyde Dehydrogenase (ALDH) Gene Family and Expression Analysis Under Salt and Drought Stress

by
Yuling Zheng
†,
Shanshan Wang
†,
Ling He
,
Rui Chen
,
Wei Zhang
,
Huachuan He
,
Hanbing Hu
,
Xiaoyun Liu
,
Heping Wan
and
Chunhong Wu
*
Hubei Engineering Research Center for Protection and Utilization of Special Biological Resources in the Hanjiang River Basin, College of Life Science, Jianghan University, Wuhan 430056, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Genes 2025, 16(5), 559; https://doi.org/10.3390/genes16050559
Submission received: 26 March 2025 / Revised: 28 April 2025 / Accepted: 29 April 2025 / Published: 7 May 2025
(This article belongs to the Section Plant Genetics and Genomics)
Browse Figures
Versions Notes

Abstract

:
Background/Objectives: Abiotic stresses severely constrain the yield of Brassica juncea, and aldehyde dehydrogenases (ALDHs) play a pivotal role in plant stress resistance. This study aims to systematically identify the ALDH gene family members in B. juncea and elucidate their expression patterns under salt and drought stress. Methods: Using the Arabidopsis thaliana AtALDH proteins as seed sequences, BLASTp alignment was performed against the B. juncea whole-protein sequence database, combined with the conserved domain PF00171 of the ALDH proteins. A total of 39 BjALDH gene family members were identified, and their physicochemical properties, structures, phylogenetic relationships, interspecies collinearity, and intraspecies collinearity were analyzed. The qRT-PCR method was employed to quantify the relative expression levels of the BjALDH genes potentially associated with stress resistance under various treatments, and their effects on drought and salt stress tolerance were evaluated. Results: The results demonstrated that BjALDH were universally significantly upregulated under salt stress, while exhibiting predominantly upregulated trends under drought stress. These findings suggest that BjALDH may enhance plant resistance to both salt and drought stress by modulating the aldehyde metabolic pathways. Conclusions: This study provides a theoretical basis for elucidating the functional roles and molecular genetic mechanisms of the BjALDH gene family in B. juncea under salt and drought stress.

1. Introduction

Mustard (Brassica juncea) is formed by the natural compound hybrid of cabbage (Brassica rapa, AA) and Brassica nigra (BB) [1,2]. It is one of the most important part of the whole world’s oil crops, and plays an important role in the field of agricultural production and food safety. It is widely planted worldwide due to its rapid growth, high yield, and strong adaptability [3,4]. Under field conditions, mustard is often subjected to abiotic stresses, such as drought, high temperature, low temperature, salinity, and heavy metals, and these adverse environmental factors have always seriously affected its yield and quality [5]. Therefore, it is important to study the tolerance mechanism of mustard under abiotic stress to improve its stress resistance and promote its high yield and quality.
Salt stress is a relatively common abiotic stress factor, which has a great impact on crop growth and yield, and causes serious economic losses. Excessive salinity in the soil has caused a series of environmental problems, with salinity affecting more than 6% of the world’s total land area (about 800 million hectares) [6]. With the increasing occurrence of extreme weather, improper irrigation, misuse of chemical fertilizers, and industrial emissions, the global ecological environment continues to deteriorate, soil salinity gradually increases, and soil salinization becomes more and more serious [7], bringing great environmental challenges to agricultural production [8]
Drought stress has an inhibitory effect on cell division, leading to the increase of cell membrane permeability to produce excessive free radicals, destroying the metabolic balance of reactive oxygen species, aggravating the degree of membrane lipid peroxidation, resulting in the inactivation of various enzymes in cells, and thus damaging the structure and function of the membrane [9,10]. In addition, drought stress also leads to cell dehydration, reduced cell volume, increased solute concentration, and viscosity, resulting in protein aggregation, leading to inhibition of photosynthetic enzyme activity, destruction of photosynthetic tissue, and plant growth restriction, and even death [11].
Aldehyde dehydrogenases (ALDHs) are enzymes that rely on NAD+/NADP+ as a cofactor to irreversibly convert endogenous and exogenous aromatic/aliphatic aldehydes into corresponding carboxylic acids, thereby reducing the toxic effects of aldehydes [12,13], and are able to adapt to environmental changes by maintaining aldehyde homeostasis. In addition, it takes part in and fulfils a momentous role in physiological processes, such as carnitine biosynthesis, glycolysis, gluconeogenesis, and amino acid metabolism [14]. In a study of soybeans, Kotchoni et al. [15] found that the soybean genome contains 18 unique ALDH sequences, encoding five members of the ALDH family involved in a wide range of metabolic and molecular detoxification routes. Yang et al. [16] found that 17 ALDH genes were distributed on nine chromosomes of the melon genome and were divided into 10 different subgroups by phylogenetic analysis. Furthermore, the expression patterns of the ALDH gene family under six stress types were salt, low temperature, waterlogging, powdery mildew, Fusarium blight, and glutinous stem blight. The results showed that CmALDH2C4 and CmALDH11A3 were significantly expressed under all six stresses, indicating that these two CmALDH genes play key roles in the stress response of melon. Bhuya et al. [17] found that most of the CaALDH genes in pepper were highly responsive to salt stress, and their expression level was significantly upregulated. Kirch et al. [18] found that upregulation of AtALDH3I1 and AtALDH7B4 genes in Arabidopsis enhanced tolerance to the osmotic and oxidative stressors in Arabidopsis. Islam et al. [19] conducted a genome-wide analysis of the potato and identified a total of 22 ALDH genes, with 50% StALDHs observed, with StALDH18A2 showing the highest upregulation, and 62.5% StALDHs, including StALDH10A2 and StALDH18A2.
Recently, the ALDH gene family has been characterized and extensively studied in a variety of plant species, including Arabidopsis, soybean, grape, sorghum, potato, melon, and poplar [13,15,16,18,19,20]. However, there are still no studies on the ALDH gene family in B. juncea, and this study fills a gap in this field. In this study, based on the genome information of mustard, we identified the members of the ALDH gene family, analyzed them, and analyzed the expression difference of the BjALDH genes under salt treatment and drought treatment, and further explored the specific biological function of the BjALDH gene family members. It aims to provide an important theoretical basis and germplasm resources for obtaining high quality anti-resistant mustard varieties, and to elucidate the potential roles of the ALDH gene family in the adaptation to drought and salt stress of B. juncea.

2. Materials and Methods

2.1. Materials and Their Treatment

The mustard resource 22-438-2 provided by Professor Wan Zhengjie from the mustard breeding research team of Huazhong Agricultural University was selected as the material for this study. This variety has strong resistance to abiotic stress, such as salt tolerance (unpublished identification results). The selected mustard strain (22-438-2), provided by the Chinese national modern agriculture (special vegetables) industrial technology system, has a strong salt tolerance. The stress levels, 180 mM NaCl for salt stress and 300 mM mannitol for drought stress, are selected for the best observation and analysis of gene expression changes which were proved by preliminary experiments. The mustard seeds were sown into a tray with a Hoagland nutrient solution (32.5 cm × 24.5 cm × 4.5 cm), and sterile gauze was spread on the plate to form a seeding cell. The seeds were treated under the temperature of 20 °C, 65% humidity, and long sunshine (18 h light and 6 h dark cycle). After 14 days of sowing and growth of the mustard seeds, 5 mustard seedlings with good growth were transferred to NaCl (180 mM) and mannitol (300 mM) as the experimental group, and 5 well-growing mustard seedlings were transferred to the Hoagland nutrient solution without NaCl and mannitol as the control group. The treatment adopted was set for a duration of 12 h, and the materials were sampled, flash-frozen, and stored at −80 °C for subsequent qRT-PCR experiments. The experiment was conducted in the greenhouse of the College of Life Sciences, Jianghan University, Wuhan City, Hubei Province, China (30°30′ N, 114°9′ E).

2.2. Identification of the BjALDH Gene Family Members and Chromosome Localization

Obtain the genome sequence files and protein sequence files from the Ensembl Plants database (https://plants.ensembl.org/index.html, accessed on 11 August 2024), the genome sequence files and protein sequence files from the tea tree (C. sinensis) genome database (http://tpia.teaplants.cn/, accessed on 5 September 2024), the Arabidopsis ALDH protein sequences were obtained as seed sequences from the Arabidopsis (A. thaliana) genome database (TAIR: https://www.arabidopsis.org/, accessed on 5 September 2024). These sequences were used for the BLASTp search with a threshold set at E < 10−10 to identify potential BjALDH proteins in the mustard whole protein sequence. The hidden Markov model (HMM) file for the conserved domain of ALDH PF00171 was downloaded from the Pfam database (http://pfam.xfam.org/, accessed on 6 September 2024) [21].
The mustard protein sequences containing this domain were screened by an HMMER 3.1 software (http://www.hmmer.org/, accessed on 7 September 2024) search. The members of the ALDH families obtained by the two methods were crossed, redundant sequences were removed, and the ALDH gene domain was further determined by the NCBI-CDD (https://www.ncbi.nlm.nih.gov/cdd/, accessed on 20 September 2024) and Pfam database to obtain the ALDH gene, and the name of the BjALDH gene was named BjALDH1~BjALDH39. Using the Expasy ProtParam (https://web.expasy.org/protparam/, accessed on 10 October 2024) online tool to predict biochemical parameters, such as the physical and chemical properties of the BjALDH protein, the predicted structure was implemented by the Plant-mPLoc website [22]. The BjALDH protein secondary structure was predicted using the SMOPA online tool [23]. Using the downloaded annotation files to retrieve the chromosomal location information of BjALDH and Visualizing it with TBTools v2.225 [24].

2.3. Phylogenetic and Evolutionary Analysis of the ALDH Proteins in Mustard

The AtALDH protein sequence of Arabidopsis was downloaded from TAIR. The phylogenetic tree was constructed in MEGA 11 software with the adjacency method (Neighbor joining, NJ), the boot-trap parameter was set to 1000 times, and the phylogenetic tree was beautified with the online website iTOL (https://itol.embl.de/, accessed on 5 September 2024) [25,26]. To explore the phylogenetic relationship between the BjALDH proteins, a phylogenetic tree for Arabidopsis (14), tea tree (27), and mustard was constructed using NJ with 1000 bootstrap repeats in MEGA 11 software (Supplementary File S2).

2.4. Gene Structure and Protein Conserved Domain Analysis of BjALDH

The gene structure of the ALDH family members was obtained based on the genome annotation information. Conserved domains of the BjALDH proteins were obtained from the NCBI-CDD website and the Pfam database. Their conserved motifs were obtained using the MEME 5.5.7 website (http://meme-suite.org/tools/meme, accessed on 12 October 2024) [27]. The cis-acting elements of 2000 bp upstream of the BjALDH gene were predicted via the Plant CARE website [28]. All data information visualization was performed using TBTools.
Using MCScanX2.0.0 software, the collinear relationships between the mustard, Arabidopsis, and tea tree ALDH, and among genes within the BjALDH genome, were analyzed by MCScanX [29]. Collinearity information visualization was performed using TBTools.

2.5. Analyzed by qRT-PCR Analysis of the ALDH Expression Pattern

A total RNA extraction kit (FastPure Universal Plant Total RNA Isolation Kit, Norozan, Nanjing, China) was used to extract the total RNA from the mustard samples. The cDNA was obtained by reverse transcription of the HiScript® II Q Select RT SuperMix with gDNA wiper (Nanjing, Nanjing, China). The qRT-PCR primers were designed with the Primer 6.0 software (Table 1), and underwent qRT-PCR analysis with the AriaMx real-time PCR system (Agilent Technologies, Chaoyang, Beijing, China). The total volume of the qRT-PCR reaction system was 20 μL, consisting of 10 μL of 2 × PerfectStart® Green qPCR SuperMix, 0.4 μL of upstream primers (Primer concentration: 10 μM; final concentration: 0.2 μM), 0.4 μL of downstream primers (Primer concentration: 10 μM; final concentration: 0.2 μM), 1 μL of cDNA template (200 ng/μL), and 8.2 μL of nucleic acid-free water. The qRT-PCR reaction steps were as follows: 95 °C pre-denaturation for 30 s; 95 °C denaturation for 5 s, 55 °C annealing for 1 min, 40 cycles. The internal label is the GAPDHF. Relative gene expression was calculated by the 2−ΔΔCT method [30]. Three biological replicates were used for each sample.

3. Results

3.1. Identification and Chromosome Mapping of Gene Families

Identification of the BjALDH conserved domains using NCBI-CDD and Pfam tools finally identified the 39 BjALDH family members, which were named BjALDH1~BjALDH39 according to the order of their position on the chromosome, and located on 15 chromosomes. Of these, one BjALDH was on chromosomes A02, A10, and B08, two were on chromosomes A01, A03, A05, A07, B02, and B05, three were on chromosomes A06 and B03, four were on chromosomes A08 and B04, and seven were on chromosome B06 (Figure 1).

3.2. Physicochemical Properties and Subcellular Localization Prediction of the Proteins

Analysis of the physicochemical properties of the 39 BjALDH genes showed differences between the different BjALDH protein sequences (Table 2 and Supplementary File S1). The number of amino acids of the BjALDH protein is between 58 and 909, the molecular weight range is 5911.94 to 99,378.23 Da, the theoretical isoelectric point is 4.27 to 9.69, the instability index is between 22.42 and 44.8, the average hydrophobicity is between −0.206 and 0.066, indicating that the BjALDH protein may partially exhibit hydrophilicity.

3.3. Phylogenetic Analysis of the Proteins

By phylogenetic analysis, the 80 ALDH proteins were divided into 10 families, including families 2, 3, 5, 6, 7, 10, 11, 12, 18, and 22 (Figure 2). In these three species, only tea trees had ALDH18 family members, mustard plants had no ALDH6 and ALDH11 family members, and all three species were distributed in the other seven ALDH families. The number of family members for 2 and 3 is the highest in mustard and two other species, indicating that these two families may have more extensive and important biological functions in plants. By contrast, each species has only one family member for 22, implying that these families have functionally high conservation and specificity.

3.4. Analysis of Gene Structure, Conserved Motifs, and Promoter Cis-Acting Elements for BjALDH

Analysis of the conserved motifs of the BjALDH proteins shows that Motif1, Motif2, Motif4 and Motif5 are present in most ALDH proteins, Motif9 in most families 2 and 3, and family 12 members contain Motif1, Motif6, and Motif8, with only one (Figure 3A). An analysis of the BjALDH protein showed that all proteins were found to contain the aldehyde domains (Figure 3B).
The results of the analysis of exon and intron structure (Figure 3C) show that the BjALDHs genes within the same family showed similarity in gene structure, with some obvious differences. In particular, the increase or loss of exons occurs in each family, which is particularly evident in family 2, where BjALDH26 and BjALDH39 are composed of 11 exons, while BjALDH18 contains only 2 exons. Furthermore, although BjALDH23 contains 10 exons, BjALDH17 contains only 8 exons. The two genes also differ in length and structure.
An analysis of the promoter cis-acting elements suggests that BjALDH may have response mechanisms to stress, plant hormone signaling, and hypoxic environment, and this study identified multiple cis-acting elements, with up to 494 photoresponsive elements, far exceeding other cis-acting elements. Auxin and abscisic acid response are also abundant in the ALDH proteins. In addition, BjALDH7, with 49, contains the largest number of cis-acting elements, and it is speculated that it may play an important role in the growth, development, and response to various kinds of abiotic stress in mustard.

3.5. Collinear Analysis of the ALDH Gene Family

Mapping the collinearity of mustard (B. juncea), Arabidopsis (A. thaliana), and tea tree (C. sinensis), found that 29 co-linear gene pairs exist between B. juncea and A. thaliana, and 13 co-linear gene pairs exist between B. juncea and C. sinensis (BjALDH19 and CsALDH3F1, BjALDH20 and CsALDH10A1, BjALDH26 and CsALDH2B3, BjALDH26 and CsALDH2B1, BjALDH23 and CsALDH2H1, BjALDH23 and CsALDH3H2, BjALDH27 and CsALDH5F2, BjALDH29 and CsALDH5F2, BjALDH30 and CsALDH5F2, BjALDH3 and CsALDH5F2, BjALDH4, and CsALDH3F1, BjALDH17, and CsALDH3H1, BjALDH17, and CsALDH3H2) (Figure 4).
The results of the BjALDH collinearity analysis showed 37 pairs of collinity genes located in the species (Figure 5), such as BjALDH2–BjALDH4, BjALDH8–BjALDH35, BjALDH11–BjALDH20, and BjALDH12–BjALDH27.

3.6. Expression Pattern of BjALDH Under Drought and High Salt Conditions

In order to study the effect of BjALDH on mustard in drought and salt stress conditions, three hydroponic environments were selected: control (CK), simulating saline stress (SS: 180 mM) and drought stress (DS: mannitol, 300 mM). Salt stress conditions resulted in significant upregulation of BjALDH3, BjALDH5, BjALDH7, BjALDH8, BjALDH11, BjALDH15, BjALDH21, BjALDH22, and BjALDH25, especially BjALDH22 by more than 40-fold compared with controls. While BjALDH8 and BjALDH25 were significantly upregulated under drought stress; BjALDH3, BjALDH7, BjALDH11, BjALDH15, BjALDH21, BjALDH22, and BjALDH25 showed the trend of upregulation, but were not significantly different, possibly due to the fact that negative regulation or participation of metabolic pathways under drought conditions are not beneficial to plants under stress.(Figure 6) Overall, BjALDH showed an overall upregulation trend in response to drought/salt stress, implying that it may affect the physiological processes in response to drought/salt stress, thereby enhancing mustard resistance.

4. Discussion

Through the effective methods of gene family analysis, researchers can better, more comprehensively, and more easily understand the structure, function, and evolution of genes. In this study, the ALDH family was systematically analyzed in B. juncea for the first time, and its subfamily composition was significantly different from that of other species, suggesting species-specific functional differentiation. Plant ALDH is a key gene regulating the metabolic process of acetaldehyde. It existed early before the evolutionary separation of monocots and dicotyledons [17], which indicates that its evolutionary process is very long, and the potential genetic differentiation is very complex. Although the specific mechanism of the abiotic stress through acetaldehyde metabolism is not fully clear, the results show that it has a strong correlation with the process of stress, implying that it plays an important role in the relevant physiological changes of plants.
Related functions of ALDH in other plants have been widely reported, but have been rarely studied in mustard. In this study, BLASTp was used as the seed sequence in the mustard whole genome protein sequence database. Combined with HMM, CD-Search, and other genes to verify the domain integrity and reliability, 39 members of the ALDH gene family were finally identified, which were located on 15 chromosomes. The distribution patterns of BjALDH on chromosomes is significantly non-uniform (e.g., B06 chromosome enrichment). A similar situation occurred in Callerya speciosa, where CsbHLH was unevenly distributed on chromosomes, suggesting tandem replication events in the genome evolution of C. speciosa [31]. The BjALDH genes may also have a similar formation mechanism, and it is speculated that they are related to the differentiation of stress resistance functions based on the relationship between the ALDH gene family and plant stress resistance.
Through phylogenetic analysis of the protein sequences encoded by the ALDH genes in A. thaliana, B. juncea, and C. sinensis, we found that these proteins not only have numerous members, but form numerous evolutionary branches, significantly redundant with other families. This indicates that, in plants, the ALDH families not only appear early, but have a high degree of sequence divergence. The ancient origin of divergence and its diversification has led to reduced similarity between the different sequences, thus forming different clades in the phylogeny [32,33]. At the same time, the alienation and diversification of such evolutionary relationships also indicate that the biological functions of the ALDH family in plants also tend to be diversified [34].
This study found that the BjALDH proteins contain numerous light-responding elements and phytohormone signaling response elements that are usually associated with plant response to abiotic stress, especially drought stress and salinity stress [35]. For example, a considerable number of abscisic acid (ABA) response elements are contained in the ALDH proteins, which suggests that the BjALDH proteins may regulate stress response through the ABA signaling pathway, implying that the ALDH gene family may play an important role in these physiological activities. At the same time, we found that, among the 10 subfamilies, the family 2 and 3 proteins accounted for the highest proportion in mustard, 26.25% and 27.5%, respectively, while the 18 subfamily proteins accounted for the lowest proportion, only 2.5%, indicating that the 18 subfamilies are very conservative over the other subfamilies in terms of gene evolution, while possible gene family duplication events occurred more in other subfamilies. This property of the ALDH family has been demonstrated in previous studies [36,37]. An analysis of the BjALDH gene structure and the conserved domains suggests that it is evolutionary conserved among several plant species. By analysis of the ALDH gene family in mustard, Arabidopsis, and tea tree plants, 29 pairs were found between Arabidopsis and mustard, and 37 pairs were found between tea trees and mustard.
The role of the ALDH genes in plant response to stress has been widely reported in many plants. A study by Guo et al. [38] of low temperature stress in the potato ALDH2B7a gene four methylation status changes, and in the tobacco StALDH2B7a homologous gene expression, silent mutants appeared when the low temperature tolerance is weakened, providing preliminary evidence that ALDH2B7a is a positive regulation gene for low temperature stress. Subsequent studies have pointed out that StALDH2B7a in response to potato cold stress to remove reactive oxygen produced excess aldehydes. Gao and Han [39] found that rice (Oryza sativa L.) ALDH genes responded significantly to drought and salt stress, with five ALDHs upregulated during both drought and high salt stress. Conversely, three ALDHs were downregulated during drought, and only OsALDH11, OsALDH22, and OsALDH18-1 were downregulated during salt stress. These results suggest that some rice ALDH genes may have a potential role in the response and tolerance of abiotic stresses (such as drought and salt). Correspondingly, the expression data under stress conditions in this study showed the significant difference between expression patterns of different members of the mustard ALDH gene family under different stresses, which is highly corresponded with the previous research. In most cases, all validated ALDH genes were upregulated in salt stress conditions, and most ALDH genes were significantly compared with control and BjALDH22 was the most significant. However, the expression of most ALDH genes also showed an upregulation trend for drought stress, except for BjALDH8 and BjALDH25, which was not significant compared with the salt stress conditions, while BjALDH5 was downregulated. This suggests that BjALDH may control the process of the aldehyde metabolism by changing the expression level of the mustard ALDH genes, which may be more effective for salt stress than for drought stress.
In the face of various abiotic stresses, plants produce excessive aldehydes, which cause toxicity and abnormal mutations at high physiological concentrations [40], leading plants to regulate the levels of these substances in cells in response to these stresses. The members of the ALDH gene family are highly likely to regulate this physiological process through their gene expression products. Moreover, this study found response mechanisms of ALDHs to many other cis-acting elements, such as hypoxia signal response elements and cell cycle regulatory elements, implying that the ALDH gene family may also play an important role in these physiological activities. For example, Tola et al. [12] found that the ALDH gene in plants is not only deeply involved in the physiological process of dealing with abiotic stress, but it affects the amino acid metabolism, lipid metabolism, and ALDH3F1 by participating in histone acetylation, regulating FLC gene (a key inhibitor of flowering time regulation) expression, and affects the plant flower organ development and flowering time. Moreover, it has been demonstrated ALDH genes were differentially expressed in soybean roots and leaves under selenium stress, and the level of gamma aminobutyric acid was regulated to reduce oxidative damage in cells under selenium stress, while maintaining redox balance in cells [41]. These studies provide some reference and guiding value for exploring the role and role of the ALDH gene family in various physiological processes in plants.
However, this study has some limitations. The experimental conditions were limited to controlled laboratory settings, and the stress responses of plants in actual field environments may differ. Future research should integrate field trials to validate the practical applicability and generalizability of the BjALDH gene family in conferring stress tolerance. While this work highlights potential linkages between BjALDH and key stress-responsive signaling pathways—particularly the ABA signaling pathway, ROS homeostasis, and the SOS pathway—the mechanistic interactions underlying these pathways remain to be fully elucidated. Subsequent investigations are required to dissect the molecular crosstalk and regulatory networks involving BjALDH under combinatorial stress scenarios. Overall, our study provides valuable insights into the functions and potential mechanisms of the ALDH gene family in B. juncea under drought and salt stress. The findings lay a theoretical foundation for future genetic improvement of stress-resistant mustard varieties and offer new perspectives for exploring the roles of the ALDH gene family in plant responses to abiotic stresses.

5. Conclusions

A total of 39 members of the mustard ALDH gene family were identified, distributed on 15 chromosomes. The ALDH genes of B. juncea are divided into 10 subgroups, with similar genes and protein structures within the same subgroup. There are 494 photoresponsive elements in the promoter region of the BjALDH family genes, which may help the plants adapt to light changes, enhance antioxidant defense, and regulate metabolic processes by regulating the expression of the ALDH genes. In addition, the expression of BjALDH was induced by salt stress and drought stress, indicating that it may be involved in the response process of mustard to salt/drought stress. Nine ALDH genes were upregulated significantly under salt stress, the most significant upregulation of them is BjALDH22, which is upregulated more than 40-fold compared with controls. BjALDH8 BjALDH25 were upregulated significantly, and seven ALDH genes were not significantly upregulated under drought stress.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/genes16050559/s1, Supplementary File S1: Detail sequence information of the B. napus BjALDH protein family. Supplementary File S2: ALDHs amino acid sequences in B. juncea, A. thaliana and C. sinensis in the phylogenetic tree.

Author Contributions

Conceptualization, S.W., L.H., R.C., W.Z., H.H. (Huachuan He), H.H. (Hanbing Hu), and X.L.; data curation, Y.Z. and S.W.; funding acquisition, H.W. and C.W.; investigation, Y.Z. and S.W.; methodology, Y.Z., S.W., L.H., R.C., W.Z., H.H. (Huachuan He), H.H. (Hanbing Hu) and X.L.; project administration, H.W. and C.W.; supervision, H.W. and C.W.; writing—original draft, Y.Z. and S.W.; writing—review and editing, L.H., R.C., W.Z., H.H. (Huachuan He), H.H. (Hanbing Hu), X.L., H.W. and C.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Hubei Provincial Department of Education Scientific Research Program (B2021057), National Natural Science Foundation of China (U22A20469) and Graduate Research Innovation Fund Project of Jianghan University (KYCXJJ202445).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All the data generated or analyzed during this study are included in the published article and its Supplementary Information Files.

Conflicts of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as potential conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
ALDHAldehyde Dehydrogenase
qRT-PCRquantitative Real-Time Polymerase Chain Reaction
NaClSodium Chloride
PBSPhosphate Buffered Saline
DNADeoxyribonucleic Acid
RNARibonucleic Acid
Gm.Glycine max
Ca.Capsicum annuum
At.Arabidopsis thaliana
St.Solanum tuberosum
Bj.Brassica juncea
Cs.Camellia sinensis
SSsalt stress
DSdrought stress
CKcontrol
mMmillimoles
Os.Oryza sativa
FLCFlowering Locus C
ABAAbscisic acid

References

  1. Kang, L.; Qian, L.W.; Zheng, M.; Chen, L.Y.; Chen, H.; Yang, L.; You, L.; Yang, B.; Yan, M.L.; Gu, Y.G.; et al. Genomic insights into the origin, domestication and diversification of Brassica juncea. Nat. Genet. 2021, 53, 1392–1402. [Google Scholar] [CrossRef] [PubMed]
  2. Yang, J.; Liu, D.; Wang, X.; Ji, C.; Cheng, F.; Liu, B.; Hu, Z.; Chen, S.; Pental, D.; Ju, Y.; et al. The genome sequence of allopolyploid Brassica juncea and analysis of differential homoeolog gene expression influencing selection. Nat. Genet. 2016, 48, 1225–1232. [Google Scholar] [CrossRef] [PubMed]
  3. Jabeen, A.; Narejo, G.A.; Mirbahar, A.A.; Yasin, S.; Afzal, T.; Sadia, H. Effect of foliar-applied Si in alleviating cadmium toxicity to different Raya (Brassica Junceae, L.) genotypes. Silicon 2024, 16, 3951–3970. [Google Scholar] [CrossRef]
  4. Singh, K.H.; Singh, G.; Singh, L.; Aftab, N.; Thakur, A.K. Delineation of inbred lines of Indian mustard into diverse gene pools based on agro-morphological traits. Czech J. Genet. Plant Breed. 2023, 59, 109–116. [Google Scholar] [CrossRef]
  5. Wang, P.; Zhao, Z.; Zhang, Z.; Cai, Z.; Liao, J.; Tan, Q.; Xiang, M.; Chang, L.; Xu, D.; Tian, Q.; et al. Genome-wide identification and analysis of NPR family genes in Brassica juncea var. tumida. Gene 2020, 769, 145210. [Google Scholar] [CrossRef] [PubMed]
  6. Munns, R.; Tester, M. Mechanisms of salinity tolerance. Annu. Rev. Plant. Biol. 2008, 59, 651–681. [Google Scholar] [CrossRef]
  7. Farooq, U.; Rehman, A.; Ashraf, M.A.; Rasheed, R.; Shahid, M.; Ali, S.; Sarker, P.K. Taurine priming improves redox balance, osmotic adjustment, and nutrient acquisition to lessen phytotoxic effects of neutral and alkaline salts on pea (Pisum sativum L.). Plant Signal Behav. 2025, 20, 2480224. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  8. Hazell, P.; Wood, S. Drivers of change in global agriculture. Philos. Trans. R. Soc. Lond. B Biol. Sci. 2008, 363, 495–515. [Google Scholar] [CrossRef]
  9. Wang, J.; Gao, X.; Wang, X.; Song, W.; Wang, Q.; Wang, X.; Li, S.; Fu, B. Exogenous melatonin ameliorates drought stress in Agropyron mongolicum by regulating flavonoid biosynthesis and carbohydrate metabolism. Front. Plant Sci. 2022, 13, 1051165. [Google Scholar] [CrossRef]
  10. Liu, J.; Wu, Y.; Dong, G.; Zhu, G.; Zhou, G. Progress of Research on the Physiology and Molecular Regulation of Sorghum Growth under Salt Stress by Gibberellin. Int. J. Mol. Sci. 2023, 24, 6777. [Google Scholar] [CrossRef]
  11. Jiang, Z.; Li, Y.P.; Gai, P.Z.; Gao, J.; Xu, L. Exogenously applied ABA alleviates dysplasia of maize (Zea mays L.) ear under drought stress by altering photosynthesis and sucrose transport. Plant Signal Behav. 2025, 20, 2462497. [Google Scholar] [PubMed]
  12. Tola, A.J.; Jaballi, A.; Germain, H.; Missihoun, T.D. Recent development on plant aldehyde dehydrogenase enzymes and their functions in plant development and stress signaling. Genes 2020, 12, 51. [Google Scholar] [CrossRef]
  13. Islam, S.; Mohtasim, M.; Islam, T.; Ghosh, A. Aldehyde dehydrogenase superfamily in sorghum: Genome-wide identification, evolution, and transcript profiling during development stages and stress conditions. BMC Plant Biol. 2022, 22, 316. [Google Scholar] [CrossRef]
  14. Guo, X.; Wang, Y.; Lu, H.; Cai, X.; Wang, X.; Zhou, Z.; Wang, C.; Wang, Y.; Zhang, Z.; Wang, K.; et al. Genome-wide characterization and expression analysis of the aldehyde dehydrogenase (ALDH) gene superfamily under abiotic stresses cotton. Gene 2017, 628, 230–245. [Google Scholar] [CrossRef]
  15. Kotchoni, S.O.; Jimenez-Lopez, J.C.; Kayodé, A.P.P.; Gachomo, E.W.; Baba-Moussa, L. The soybean aldehyde dehydrogenase (ALDH) protein superfamily. Gene 2012, 495, 128–133. [Google Scholar] [CrossRef]
  16. Yang, D.; Chen, H.; Zhang, Y.; Wang, Y.; Zhai, Y.; Xu, G.; Ding, Q.; Wang, M.; Zhang, Q.-A.; Lu, X.; et al. Genome-Wide Identification and Expression Analysis of the Melon Aldehyde Dehydrogenase (ALDH) Gene Family in Response to Abiotic and Biotic Stresses. Plants 2024, 13, 2939. [Google Scholar] [CrossRef] [PubMed]
  17. Bhuya, A.R.; Shuvo, M.R.K.; Nahid, A.A.; Ghosh, A. Genome-wide identification, classification, and expression profiling of the aldehyde dehydrogenase gene family in pepper. Plant Physiol. Biochem. 2024, 219, 109–413. [Google Scholar] [CrossRef] [PubMed]
  18. Kirch, H.H.; Schlingensiepen, S.; Kotchoni, S.; Sunkar, R.; Bartels, D. Detailed expression analysis of selected genes of the aldehyde dehydrogenase (ALDH) gene superfamily in Arabidopsis thaliana. Plant Mol. Biol. 2005, 57, 315–332. [Google Scholar] [CrossRef]
  19. Islam, S.; Hasan, S.; Hasan, N.; Prodhan, S.H.; Islam, T.; Ghosh, A. Genome-wide identification, evolution, and transcript profiling of Aldehyde dehydrogenase superfamily in potato during development stages and stress conditions. Sci. Rep. 2021, 11, 18284. [Google Scholar] [CrossRef]
  20. Zhang, Y.; Mao, L.; Wang, H.; Brocker, C.; Yin, X.; Vasiliou, V.; Fei, Z.; Wang, X. Genome-wide identification and analysis of grape aldehyde dehydrogenase (ALDH) gene superfamily. PLoS ONE 2012, 7, e32153. [Google Scholar] [CrossRef]
  21. Mistry, J.; Chuguransky, S.; Williams, L.; Qureshi, M.; Salazar, G.A.; Sonnhammer, E.L.L.; Tosatto, S.C.E.; Paladin, L.; Raj, S.; Richardson, L.J.; et al. Pfam: The protein families database in 2021. Nucleic Acids Res. 2021, 49, D412–D419. [Google Scholar] [CrossRef] [PubMed]
  22. Chou, K.C.; Shen, H.B. Plant-mPLoc: A top-down strategy to augment the power for predicting plant protein subcellular localization. PLoS ONE 2017, 5, e11335. [Google Scholar] [CrossRef]
  23. Duvaud, S.; Gabella, C.; Lisacek, F.; Stockinger, H.; Ioannidis, V.; Durinx, C. Expasy, the Swiss Bioinformatics Resource Portal, as designed by its users. Nucleic Acids Res. 2021, 49, W216–W227. [Google Scholar] [CrossRef] [PubMed]
  24. Chen, C.J.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.H.; Xia, R. TBtools: An Integrative Toolkit Developed for Interactive Analyses of Big Biological Data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef]
  25. Letunic, I.; Bork, P. Interactive Tree Of Life (iTOL) v5: An online tool for phylogenetic tree display and annotation. Nucleic Acids Res. 2021, 49, W293–W296. [Google Scholar] [CrossRef] [PubMed]
  26. Tamura, K.; Stecher, G.; Kumar, S. MEGA11:Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
  27. Nystrom, S.; McKay, D. Memes: A motif analysis environment in R using tools from the MEME Suite. PLoS Comput. Biol. 2021, 17, e1008991. [Google Scholar] [CrossRef]
  28. Lescot, M.; Déhais, P.; Thijs, G.; Marchal, K.; Moreau, Y.; Van de Peer, Y.; Rouzé, P.; Rombauts, S. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002, 30, 325–327. [Google Scholar] [CrossRef]
  29. Wang, Y.; Tang, H.; DeBarry, J.D.; Tan, X.; Li, J.; Wang, X.; Lee, T.H.; Jin, H.; Marler, B.; Guo, H.; et al. MCScanX: A toolkit for detection and evolutionary analysis of gene synteny and collinearity. Nucleic Acids Res. 2012, 40, e49. [Google Scholar] [CrossRef]
  30. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  31. Chen, L.; Tan, X.; Ming, R.; Huang, D.; Tan, Y.; Li, L.; Huang, R.; Yao, S. Genome-Wide Identification of the bHLH Gene Family in Callerya speciosa Reveals Its Potential Role in the Regulation of Isoflavonoid Biosynthesis. Int. J. Mol. Sci. 2024, 25, 11900. [Google Scholar] [CrossRef] [PubMed]
  32. Zhu, C.; Ming, C.; Zhao-Shi, X.; Lian-Cheng, L.; Xue-Ping, C.; You-Zhi, M. Characteristics and Expression Patterns of the Aldehyde Dehydrogenase (ALDH) Gene Superfamily of Foxtail Millet (Setaria italica L.). PLoS ONE 2014, 9, e101136. [Google Scholar] [CrossRef] [PubMed]
  33. Xu, J.; Liu, L.; Huang, H.; Shang, C.; Pan, H.; Fan, H.; Han, X.; Qiu, W.; Lu, Z.; Qiao, G.; et al. Genome-wide characterization and gene expression analyses of ALDH gene family in response to drought stress in moso bamboo (Phyllostachys edulis). Plant Physiol. Biochem. 2023, 202, 107954. [Google Scholar] [CrossRef] [PubMed]
  34. Stiti, N.; Giarola, V.; Bartels, D. From algae to vascular plants: The multistep evolutionary trajectory of the ALDH superfamily towards functional promiscuity and the emergence of structural characteristics, Environmental and Experimental. Botany 2021, 185, 104376. [Google Scholar] [CrossRef]
  35. Chen, J.; Wan, H.; Zhao, H.; Dai, X.; Wu, W.; Liu, J.; Xu, J.; Yang, R.; Xu, B.; Zeng, C.; et al. Identification and expression analysis of the Xyloglucan transglycosylase/hydrolase (XTH) gene family under abiotic stress in oilseed (Brassica napus L.). BMC Plant Biol. 2024, 24, 400. [Google Scholar] [CrossRef]
  36. Islam, M.S.; Ghosh, A. Evolution, family expansion, and functional diversification of plant aldehyde dehydrogenases. Gene 2022, 829, 146522. [Google Scholar] [CrossRef]
  37. Jimenez-Lopez, J.C.; Lopez-Valverde, F.J.; Robles-Bolivar, P.; Lima-Cabello, E.; Gachomo, E.W.; Kotchoni, S.O. Genome-Wide Identification and Functional Classification of Tomato (Solanum lycopersicum) Aldehyde Dehydrogenase (ALDH) Gene Superfamily. PLoS ONE 2016, 11, e0164798. [Google Scholar] [CrossRef]
  38. Guo, J.; Sun, W.; Liu, H.; Chi, J.; Odiba, A.S.; Li, G.; Jin, L.; Xin, C. Aldehyde dehydrogenase plays crucial roles in response to lower temperature stress in Solanum tuberosum and Nicotiana benthamiana. Plant Sci. 2020, 297, 110525. [Google Scholar] [CrossRef]
  39. Gao, C.; Han, B. Evolutionary and expression study of the aldehyde dehydrogenase (ALDH) gene superfamily in rice (Oryza sativa). Gene 2009, 431, 86–94. [Google Scholar] [CrossRef]
  40. Li, X.; Guo, R.; Li, J.; Singer, S.D.; Zhang, Y.; Yin, X.; Zheng, Y.; Fan, C.; Wang, X. Genome-wide identification and analysis of the aldehyde dehydrogenase (ALDH) gene superfamily in apple (Malus × domestica Borkh.). Plant Physiol. Biochem. 2013, 71, 268–282. [Google Scholar] [CrossRef]
  41. Liu, Y.; Li, J.; Shi, J.; Pan, Y.; Yang, S.; Xue, Y. Combined metabolome and transcriptome analysis reveals the key pathways involved in the responses of soybean plants to high Se stress. Ecotoxicol. Environ. Saf. 2024, 287, 117262. [Google Scholar] [CrossRef] [PubMed]
Genes 16 00559 g001
Figure 1. The arrangement of BjALDH across the chromosomes of B. juncea. Each chromosome name is indicated on the left side of the respective blue bar, with gene names presented on the right. The scale on the far left denotes the physical position in megabases (Mb).
Figure 1. The arrangement of BjALDH across the chromosomes of B. juncea. Each chromosome name is indicated on the left side of the respective blue bar, with gene names presented on the right. The scale on the far left denotes the physical position in megabases (Mb).
Genes 16 00559 g001
Genes 16 00559 g002
Figure 2. The phylogenetic tree of the ALDH proteins from A. thaliana (At), C. sinensis (Cs), and B. juncea (Bj). Different colors represent different subfamilies, numbers represent the numbering of each subfamilies, yellow stars represent ALDHs from Bj, red circles represent ALDHs from At, and blue diamonds represent ALDHs from Cs.
Figure 2. The phylogenetic tree of the ALDH proteins from A. thaliana (At), C. sinensis (Cs), and B. juncea (Bj). Different colors represent different subfamilies, numbers represent the numbering of each subfamilies, yellow stars represent ALDHs from Bj, red circles represent ALDHs from At, and blue diamonds represent ALDHs from Cs.
Genes 16 00559 g002
Genes 16 00559 g003
Figure 3. Conserved motifs of the B. juncea ALDH family (A), conserved domains (B), gene structure (C), and promoter cis-regulatory elements (D) analysis.
Figure 3. Conserved motifs of the B. juncea ALDH family (A), conserved domains (B), gene structure (C), and promoter cis-regulatory elements (D) analysis.
Genes 16 00559 g003
Genes 16 00559 g004
Figure 4. The collinearity relationship of ALDH genes between A. thaliana, B. juncea, and C. sinensis.
Figure 4. The collinearity relationship of ALDH genes between A. thaliana, B. juncea, and C. sinensis.
Genes 16 00559 g004
Genes 16 00559 g005
Figure 5. Synteny analysis among BjALDH. The circles in this diagram represent the unknown base ratio (N ratio), genetic density, GC ratio, GC skew, and chromosome length from the inside to the out. The names of the chromosomes are marked at the bottom of each chromosome, and indicate the location of BjALDH.
Figure 5. Synteny analysis among BjALDH. The circles in this diagram represent the unknown base ratio (N ratio), genetic density, GC ratio, GC skew, and chromosome length from the inside to the out. The names of the chromosomes are marked at the bottom of each chromosome, and indicate the location of BjALDH.
Genes 16 00559 g005
Genes 16 00559 g006
Figure 6. Non-biological stress-induced expression patterns of BjALDH. The x-axis represents various treatments of B. juncea. The y-axis indicates relative expression levels, calculated using the 2−∆∆Ct method. CK: normal; SS: salt stress; DS: drought stress; ** significant differences between treatments at p < 0.01; * significant differences between treatments at p < 0.05; ns: no significant difference. Data represent the mean ± SD for three biological replicates (n = 3).
Figure 6. Non-biological stress-induced expression patterns of BjALDH. The x-axis represents various treatments of B. juncea. The y-axis indicates relative expression levels, calculated using the 2−∆∆Ct method. CK: normal; SS: salt stress; DS: drought stress; ** significant differences between treatments at p < 0.01; * significant differences between treatments at p < 0.05; ns: no significant difference. Data represent the mean ± SD for three biological replicates (n = 3).
Genes 16 00559 g006
Table 1. Primer sequence information used in this study.
Table 1. Primer sequence information used in this study.
Gene NameForward Primer (5′ 3′)Reverse Primer (5′ 3′)
BjALDH3CTCGGAAGGTTGGCCCTGTGCAAATTCAGCCGCAGC
BjALDH5GGTCGGCCACATCATCCCCTGCTGGCTTGACCACCA
BjALDH7TGTGAGGACGCCGATGTCCACCCGCACAGTTTTGCC
BjALDH8GCAAGCTGCGGGTGAAGTGGACCATAAGGCCAGCGG
BjALDH11TGGGGTGGAGTCAAACGCGCATCCCCATGGGTCGTT
BjALDH15GCCGTGAAGGAGACTGTGGCTCCGAGCTGTGCCTTCC
BjALDH21CAACTGCTGGAGCTGCCAGATTGCTTGCTGCTGCGG
BjALDH22GCCATGGAGGAGACTGTGGTCCGAGCTGTGCCTTCCT
BjALDH25GCACTGGTCTGCGGAAACTGGCACCGGGTAAACTGT
GAPDHFTCAGTTGTTGACCTCACGGTTCTGTCACCAACGAAGTCAGT
Table 2. Physicochemical properties and subcellular localization prediction of the BjALDH proteins.
Table 2. Physicochemical properties and subcellular localization prediction of the BjALDH proteins.
Gene IDGene NameNumber of Amino
Acids		Formula Weight/Da
Molecular Weight		Isoelectric Point
pI		Instability Index
Instability Index		Average Hydrophobicity
Gravy
BjuA01g40020SBjALDH158564,272.488.3540.060.082
BjuA01g41590SBjALDH248153,511.237.5636.24−0.023
BjuA02g19160SBjALDH320522,174.788.2731.460.219
BjuA03g04550SBjALDH448453,896.728.2935.02−0.035
BjuA03g21040SBjALDH550154,329.365.9931.97−0.085
BjuA05g18570SBjALDH657363,434.638.4740.460.068
BjuA05g35930SBjALDH766673,865.628.4542.260.098
BjuA06g17280SBjALDH855761,799.076.4536.19−0.137
BjuA06g19000SBjALDH950354,788.035.8328.18−0.049
BjuA06g19030SBjALDH1053758,771.018.6333.06−0.147
BjuA07g24680SBjALDH1190999,378.235.4436.320.009
BjuA07g37710SBjALDH1255659,787.017.0743.290.088
BjuA08g01080SBjALDH1350954,209.345.4434.60.052
BjuA08g05370SBjALDH1448253,035.768.1138.350.062
BjuA08g18560SBjALDH1549254,640.658.3334.98−0.013
BjuA08g23210SBjALDH1653758,617.067.1927.45−0.089
BjuA10g06430SBjALDH1725428,363.279.0844.80.017
BjuB02g32810SBjALDH18585911.948.2126.450.66
BjuB02g74420SBjALDH1948453,958.688.0536.4−0.062
BjuB03g14960SBjALDH2012613,802.944.2734.530.329
BjuB03g38000SBjALDH2150154,415.445.9335.62−0.077
BjuB03g47710SBjALDH2248854,232.298.4733.90.011
BjuB04g00710SBjALDH2347552,727.589.3437.01−0.005
BjuB04g01700SBjALDH2420522,113.565.7329.670.074
BjuB04g08660SBjALDH2512413,520.874.9934.830.513
BjuB04g21940SBjALDH2652356,972.187.6726.38−0.054
BjuB05g01010SBjALDH2713314,099.388.4642.560.237
BjuB05g60440SBjALDH2848153,471.127.0737.24−0.029
BjuB06g01260SBjALDH2952856,475.967.5441.710.005
BjuB06g14620SBjALDH30869294.799.4628.44−0.206
BjuB06g16690SBjALDH3190698,933.925.5935.440.03
BjuB06g26910SBjALDH3248253,166.878.1340.760.068
BjuB06g30770SBjALDH3325326,986.026.4422.420.068
BjuB06g31160SBjALDH349610,132.999.6936.50.493
BjuB06g47790SBjALDH3552057,688.286.935.8−0.171
BjuB07g01690SBjALDH3650854,135.265.44350.05
BjuB07g08290SBjALDH3755560,815.458.0142.870.018
BjuB07g14010SBjALDH3824226,062.946.4425.970.002
BjuB08g11910SBjALDH3953858,501.858.0632.23−0.073
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zheng, Y.; Wang, S.; He, L.; Chen, R.; Zhang, W.; He, H.; Hu, H.; Liu, X.; Wan, H.; Wu, C. Identification of Mustard Aldehyde Dehydrogenase (ALDH) Gene Family and Expression Analysis Under Salt and Drought Stress. Genes 2025, 16, 559. https://doi.org/10.3390/genes16050559

AMA Style

Zheng Y, Wang S, He L, Chen R, Zhang W, He H, Hu H, Liu X, Wan H, Wu C. Identification of Mustard Aldehyde Dehydrogenase (ALDH) Gene Family and Expression Analysis Under Salt and Drought Stress. Genes. 2025; 16(5):559. https://doi.org/10.3390/genes16050559

Chicago/Turabian Style

Zheng, Yuling, Shanshan Wang, Ling He, Rui Chen, Wei Zhang, Huachuan He, Hanbing Hu, Xiaoyun Liu, Heping Wan, and Chunhong Wu. 2025. "Identification of Mustard Aldehyde Dehydrogenase (ALDH) Gene Family and Expression Analysis Under Salt and Drought Stress" Genes 16, no. 5: 559. https://doi.org/10.3390/genes16050559

APA Style

Zheng, Y., Wang, S., He, L., Chen, R., Zhang, W., He, H., Hu, H., Liu, X., Wan, H., & Wu, C. (2025). Identification of Mustard Aldehyde Dehydrogenase (ALDH) Gene Family and Expression Analysis Under Salt and Drought Stress. Genes, 16(5), 559. https://doi.org/10.3390/genes16050559

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop