Regulation of Smad2/3 Nuclear Exclusion by Follicle-Stimulating Hormone (FSH) in Chicken Follicular Granulosa Cells and Its Effect on FOXO3/4
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Study Design, Current Sampling, and Granulosa Cell Culture
2.3. Immunofluorescence Staining
2.4. Western Blot Analysis
2.5. Transfection of Overexpression and Interference Vectors
2.6. Quantitative Real-Time RT-PCR
2.7. Statistical Analysis
3. Results
3.1. FSH Induces Smad2/3 Phosphorylation and Nuclear Exclusion Through the PI3K Signaling Pathway
3.2. The Regulatory Effect of Smad2/3 on FOXO3/4 Protein Phosphorylation
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| FSH | Follicle-stimulating hormone |
| FSHR | FSH receptor |
| FOXO | Forkhead box O |
| PI3K | Phosphatidylinositol-3 kinase |
| Smad | Small mothers against decapentaplegic |
| AKT/PKB | Protein kinase B |
| GC | Granulosa cell |
| p-FOXO | Phosphorylated FOXO |
References
- Li, H.; Zhu, H.; Qin, Q.; Lei, M.; Shi, Z. Production of biologically active recombinant goose FSH in a single chain form with a CTP linker sequence. Mol. Biol. Rep. 2017, 44, 11–17. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Li, J.; Ying Wang, C.; Yan Kwok, A.H.; Leung, F.C. Epidermal growth factor (EGF) receptor ligands in the chicken ovary: I. Evidence for heparin-binding EGF-like growth factor (HB-EGF) as a potential oocyte-derived signal to control granulosa cell proliferation and HB-EGF and kit ligand expression. Endocrinology 2007, 148, 3426–3440. [Google Scholar] [CrossRef]
- Huang, H.; Tindall, D.J. Dynamic FOXO transcription factors. J. Cell Sci. 2007, 120, 2479–2487. [Google Scholar] [CrossRef] [PubMed]
- Monte, A.P.O.; Bezerra, M.É.S.; Menezes, V.G.; Gouveia, B.B.; Barberino, R.S.; Lins, T.L.B.G.; Barros, V.R.P.; Santos, J.M.S.; Donfack, N.J.; Matos, M.H.T. Involvement of Phosphorylated Akt and FOXO3a in the Effects of Growth and Differentiation Factor-9 (GDF-9) on Inhibition of Follicular Apoptosis and Induction of Granulosa Cell Proliferation After In Vitro Culture of Sheep Ovarian Tissue. Reprod. Sci. 2021, 28, 2174–2185. [Google Scholar] [CrossRef]
- Coutts, S.M.; Childs, A.J.; Fulton, N.; Collins, C.; Bayne, R.A.; McNeilly, A.S.; Anderson, R.A. Activin signals via SMAD2/3 between germ and somatic cells in the human fetal ovary and regulates kit ligand expression. Dev. Biol. 2007, 314, 189–199. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Xv, J.; Oakley, J.; Mcgee, E.A. Stage-specific expression of Smad2 and Smad3 during folliculogenesis. Biol. Reprod. 2002, 66, 1571–1578. [Google Scholar] [CrossRef]
- Billiar, R.B.; St Clair, J.B.; Zachos, N.C.; Burch, M.G.; Albrecht, E.D.; Pepe, G.J. Localization and developmental expression of the activin signal transduction proteins Smads 2, 3, and 4 in the baboon fetal ovary. Biol. Reprod. 2004, 70, 586–592. [Google Scholar] [CrossRef] [PubMed]
- Stitt, T.N.; Drujan, D.; Clarke, B.A.; Panaro, F.; Timofeyva, Y.; Kline, W.O.; Gonzalez, M.; Yancopoulos, G.D.; Glass, D.J. The IGF-1/PI3K/Akt Pathway Prevents Expression of Muscle Atrophy-Induced Ubiquitin Ligases by Inhibiting FOXO Transcription Factors. Mol. Cell 2004, 14, 395–403. [Google Scholar] [CrossRef]
- Mathew, S.J. InACTIVatINg cancer cachexia. Dis. Model. Mech. 2011, 4, 283–285. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Seoane, J.; Le, H.V.; Shen, L.; Anderson, S.A.; Massagué, J. Integration of Smad and Forkhead Pathways in the Control of Neuroepithelial and Glioblastoma Cell Proliferation. Cell 2004, 117, 211–223. [Google Scholar] [CrossRef] [PubMed]
- Daitoku, H.; Sakamaki, J.; Fukamizu, A. Regulation of FOXO transcription factors by acetylation and protein-protein interactions. Mol. Cell Res. 2011, 1813, 1954–1960. [Google Scholar] [CrossRef] [PubMed]
- Linden, R.; Chiarini, L.B. Nuclear exclusion of transcription factors associated with apoptosis in developing nervous tissue. Braz. J. Med. Biol. Res. 1999, 32, 813–820. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Biggs, W.H.; Meisenhelder, J.; Hunter, T.; Cavenee, W.K.; Arden, K.C. Protein kinase B/Akt-mediated phosphorylation promotes nuclear exclusion of the winged helix transcription factor FKHR1. Proc. Natl. Acad. Sci. USA 1999, 96, 7421–7426. [Google Scholar] [CrossRef]
- Sert, N.P.D.; Hurst, V.; Ahluwalia, A.; Sabina, A.; Hanno, W. The ARRIVE guidelines 2.0: Updated guidelines for reporting animal research. BMJ Open Sci. 2020, 4, 100115. [Google Scholar] [CrossRef]
- Xu, R.; Qin, N.; Xu, X.; Sun, X.; Chen, X.; Zhao, J. Inhibitory effect of SLIT2 on granulosa cell proliferation mediated by the CDC42-PAKs-ERK1/2 MAPK pathway in the prehierarchical follicles of the chicken ovary. Sci. Rep. 2018, 8, 9168. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.; Niu, X.; Qin, N.; Shan, X.; Zhao, J.; Ma, C.; Xu, R.; Mishra, B. Novel insights into the regulation of LATS2 kinase in prehierarchical follicle development via the Hippo pathway in hen ovary. Poult. Sci. 2021, 100, 101454. [Google Scholar] [CrossRef]
- Cui, C. Expression of FOXO3 Gene in Chicken Follicles and its Effect on Granulosa Cell Proliferation and Apoptosis. Master’s Dissertation, Sichuan Agricultural University, Ya’an, China, 2018. (In Chinese). [Google Scholar]
- Matsuzaki, H.; Daitoku, H.; Hatta, M.; Aoyama, H.; Yoshimochi, K.; Fukamizu, A. Acetylation of Foxo1 alters its DNA-binding ability and sensitivity to phosphorylation. Proc. Natl. Acad. Sci. USA 2005, 102, 11278–11283. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.; Liswaniso, S.; Shan, X.; Zhao, J.; Chimbaka, I.M.; Xu, R.; Qin, N. The opposite effects of VGLL1 and VGLL4 genes on granulosa cell proliferation and apoptosis of hen ovarian prehierarchical follicles. Theriogenology 2022, 181, 95–104. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Chen, Q.; Liu, Z.; Guo, X.; Du, Y.; Yuan, Z.; Guo, M.; Kang, L.; Sun, Y.; Jiang, Y. Transcriptome Analysis on Single Small Yellow Follicles Reveals That Wnt4 Is Involved in Chicken Follicle Selection. Front. Endocrinol. 2017, 8, 317. [Google Scholar] [CrossRef] [PubMed]
- Tilly, J.L. Stage of ovarian follicular development associated with the initiation of steroidogenic competence in avian granulosa cells. Biol. Reprod. 1991, 44, 305–314. [Google Scholar] [CrossRef] [PubMed]
- Akbarzadeh, M.; Mihanfar, A.; Akbarzadeh, S.; Yousefi, B.; Majidinia, M. Crosstalk between miRNA and PI3K/AKT/mTOR signaling pathway in cancer. Life Sci. 2021, 285, 119984. [Google Scholar] [CrossRef] [PubMed]
- Bakin, A.V.; Tomlinson, A.K.; Bhowmick, N.A.; Moses, H.L.; Arteaga, C.L. Phosphatidylinositol 3-kinase function is required for transforming growth factor beta-mediated epithelial to mesenchymal transition and cell migration. J. Biol. Chem. 2000, 275, 36803–36810. [Google Scholar] [CrossRef] [PubMed]
- Runyan, C.E.; Schnaper, H.W.; Poncelet, A. The phosphatidylinositol 3-kinase/Akt pathway enhances Smad3-stimulated mesangial cell collagen I expression in response to transforming growth factor-beta1. J. Biol. Chem. 2004, 279, 2632–2639. [Google Scholar] [CrossRef] [PubMed]
- Remy, I.; Montmarquette, A.; Michnick, S.W. PKB/Akt modulates TGF-beta signalling through a direct interaction with Smad3. Nat. Cell Biol. 2004, 6, 358–365. [Google Scholar] [CrossRef] [PubMed]
- Conery, A.R.; Cao, Y.; Thompson, E.A.; Townsend, C.M., Jr.; Ko, T.C.; Luo, K. Akt interacts directly with Smad3 to regulate the sensitivity to TGF-beta induced apoptosis. Nat. Cell Biol. 2004, 6, 366–372. [Google Scholar] [CrossRef]
- Roffe, S.; Hagai, Y.; Pines, M.; Halevy, O. Halofuginone inhibits Smad3 phosphorylation via the PI3K/Akt and MAPK/ERK pathways in muscle cells: Effect on myotube fusion. Exp. Cell Res. 2010, 316, 1061–1069. [Google Scholar] [CrossRef] [PubMed]
- Woods, Y.L.; Rena, G. Effect of multiple phosphorylation events on the transcription factors FKHR, FKHRL1 and AFX. Biochem. Soc. Trans. 2002, 30, 391–397. [Google Scholar] [CrossRef]
- Zhang, H.Y.; Zhang, X.L.; Ji, S.F.; Bing, L.J.; Hao, J. Regulation of bone morphologenetic protein 4/Smad signaling pathway on the apoptosis of mouse primordial follicle oocytes. Acta Anat. Sin. 2014, 45, 375–382. [Google Scholar]
- Gordon, K.J.; Blobe, G.C. Role of transforming growth factor-beta superfamily signaling pathways in human disease. BBA-Mol. Basis Dis. 2008, 1782, 197–228. [Google Scholar] [CrossRef] [PubMed]





| Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
|---|---|---|
| Smad2 | GTGGTGGAGAACAGAATGGAC | CAGTCCCCAAATTTCAGAGCA |
| Smad3 | GAGGAGAAGTGGTGCGAGAAG | GCACTTGGTGTTCACGTTCT |
| 18s rRNA | TAGTTGGTGGAGCGATTTGTCT | CGGACATCTAAGGGCATCACA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sun, Y.; Liswaniso, S.; Wu, H.; Sun, X.; Yan, C.; Qin, N.; Xu, R. Regulation of Smad2/3 Nuclear Exclusion by Follicle-Stimulating Hormone (FSH) in Chicken Follicular Granulosa Cells and Its Effect on FOXO3/4. Genes 2025, 16, 283. https://doi.org/10.3390/genes16030283
Sun Y, Liswaniso S, Wu H, Sun X, Yan C, Qin N, Xu R. Regulation of Smad2/3 Nuclear Exclusion by Follicle-Stimulating Hormone (FSH) in Chicken Follicular Granulosa Cells and Its Effect on FOXO3/4. Genes. 2025; 16(3):283. https://doi.org/10.3390/genes16030283
Chicago/Turabian StyleSun, Yuhan, Simushi Liswaniso, Hengsong Wu, Xue Sun, Chunchi Yan, Ning Qin, and Rifu Xu. 2025. "Regulation of Smad2/3 Nuclear Exclusion by Follicle-Stimulating Hormone (FSH) in Chicken Follicular Granulosa Cells and Its Effect on FOXO3/4" Genes 16, no. 3: 283. https://doi.org/10.3390/genes16030283
APA StyleSun, Y., Liswaniso, S., Wu, H., Sun, X., Yan, C., Qin, N., & Xu, R. (2025). Regulation of Smad2/3 Nuclear Exclusion by Follicle-Stimulating Hormone (FSH) in Chicken Follicular Granulosa Cells and Its Effect on FOXO3/4. Genes, 16(3), 283. https://doi.org/10.3390/genes16030283

