Exploration of Genes Related to Intramuscular Fat Deposition in Xinjiang Brown Cattle
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Sample Collection
2.3. Determination of IMF Content
2.4. Histology
2.5. Total RNA Extraction, Library Construction and Sequencing
2.6. Real-Time Quantitative PCR (RT-qPCR)
2.7. Data Processing
2.7.1. Quality Control, Transcript Assembly and Splicing
2.7.2. Sequence Data Mining and Analysis
2.7.3. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) Enrichment Analysis of Differentially Expressed Genes
2.7.4. Statistical Analysis
3. Results
3.1. Comparison of IMF Content and Morphological Observation of the Longissimus Dorsi Muscle in Two Groups
3.2. Transcriptome Sequencing Data Analysis
3.3. Quantitative Analysis of Transcriptome Sequencing
3.4. Transcriptome Sequencing of Differentially Expressed Genes
3.5. GO Enrichment Analysis
3.6. KEGG Pathway Analysis
3.7. RT-qPCR Validation of RNA-Seq Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Chen, Q.; Xu, L.; Zhang, M.; Zhang, T.; Yan, M.; Zhai, M.; Huang, X. Whole genome resequencing reveals the genetic contribution of Kazakh and Swiss Brown Cattle to a population of Xinjiang Brown Cattle. Gene 2022, 839, 146725. [Google Scholar] [CrossRef]
- Yan, X.M.; Ma, Z.; Yuan, L.X.; Fu, H.Y.; Zhang, J.S.; Zhou, J.Z.; Li, H.B. Efficacy evaluation of population breeding of Xinjiang browncattle (meat breed lines). Anim. Husb. Vet. Med. 2024, 56, 1–6. (In Chinese) [Google Scholar]
- Yan, X.M.; Zhang, J.S.; Li, H.B.; Li, N.; Du, W.; Zhou, Z.Y.; Zhang, Y. Comparative study on carcass traits and meat quality of different month old of Xinjiang Brown Cattle steers. China Anim. Husb. Vet. Med. 2015, 42, 2954–2960. (In Chinese) [Google Scholar] [CrossRef]
- Pickworth, C.L.; Loerch, S.C.; Velleman, S.G.; Pate, J.L.; Poole, D.H.; Fluharty, F.L. Adipogenic differentiation state-specific gene expression as related to bovine carcass adiposity. J. Anim. Sci. 2011, 89, 355–366. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Du, M.; Huang, Y.; Das, A.K.; Yang, Q.; Duarte, M.S.; Dodson, M.V.; Zhu, M.J. Meat Science and Muscle Biology Symposium: Manipulating mesenchymal progenitor cell differentiation to optimize performance and carcass value of beef cattle. J. Anim. Sci. 2013, 91, 1419–1427. [Google Scholar] [CrossRef] [PubMed]
- Zheng, Y.; Chen, J.; Wang, X.; Han, L.; Yang, Y.; Wang, Q.; Yu, Q. Metagenomic and transcriptomic analyses reveal the differences and associations between the gut microbiome and muscular genes in ang-us and Chinese Simmental Cattle. Front. Microbiol. 2022, 13, 815915. [Google Scholar] [CrossRef]
- Liu, S.; Huang, J.; Wang, X.; Ma, Y. Transcription factors regulate adipocyte differentiation in beef cattle. Anim. Genet. 2020, 51, 351–357. [Google Scholar] [CrossRef]
- Li, Y.M.; Li, S.X.; Li, X.S.; Li, C.Y. Transcriptome studies with the third-generation sequencing technology. Life Sci. Instrum. 2018, 16, 114–121+113. (In Chinese) [Google Scholar]
- Berton, M.P.; Fonseca, L.F.; Gimenez, D.F.; Utembergue, B.L.; Cesar, A.S.; Coutinho, L.L.; de Lemos, M.V.; Aboujaoude, C.; Pereira, A.S.; Silva, R.M.; et al. Gene expression profile of intramuscular muscle in Nellore cattle with extreme values of fatty acid. BMC Genom. 2016, 17, 972. [Google Scholar] [CrossRef] [PubMed]
- Cesar, A.S.; Regitano, L.C.; Koltes, J.E.; Fritz-Waters, E.R.; Lanna, D.P.; Gasparin, G.; Mourão, G.B.; Oliveira, P.S.; Reecy, J.M.; Coutinho, L.L. Putative regulatory factors associated with intramuscular fat content. PLoS ONE 2015, 10, e0128350. [Google Scholar] [CrossRef]
- Essén-Gustavsson, B.; Karlsson, A.; Lundström, K.; Enfält, A.C. Intramuscular fat and muscle fibre lipid contents in halothane-gene-free pigs fed high or low protein diets and its relation to meat quality. Meat Sci. 1994, 38, 269–277. [Google Scholar] [CrossRef] [PubMed]
- Nishimura, T.; Hattori, A.; Takahashi, K. Structural changes in intramuscular connective tissue during the fattening of Japanese black cattle: Effect of marbling on beef tenderization. Anim. Sci. 1999, 77, 93–104. [Google Scholar] [CrossRef] [PubMed]
- He, H.; Liu, X. Characterization of transcriptional complexity during longissimus muscle development in bovines using high-throughput sequencing. PLoS ONE 2013, 8, e64356. [Google Scholar] [CrossRef] [PubMed]
- Li, N. Study on Molecular Mechanism of miRNA and MRNAregulating the Meaty Fat-Forming Traits of Xinjiang Brown Cattle and Kazakh Cattle. Ph.D. Thesis, Gansu Agricultural University, Lanzhou, China, 2019. [Google Scholar] [CrossRef]
- DiMauro, S.; Schon, E.A. Mitochondrial disorders in the nervous system. Annu. Rev. Neurosci. 2008, 31, 91–123. [Google Scholar] [CrossRef] [PubMed]
- Keating, D.J. Mitochondrial dysfunction, oxidative stress, regulation of exocytosis and their relevance to neurodegenerative diseases. J. Neurochem. 2008, 104, 298–305. [Google Scholar] [CrossRef]
- Taniguchi, M.; Guan, L.L.; Zhang, B.; Dodson, M.V.; Okine, E.; Moore, S.S. Adipogenesis of bovine perimuscular preadipocytes. Biochem. Biophys. Res. Commun. 2008, 366, 54–59. [Google Scholar] [CrossRef]
- Forest, C.; Tordjman, J.; Glorian, M.; Duplus, E.; Chauvet, G.; Quette, J.; Beale, E.G.; Antoine, B. Fatty acid recycling in adipocytes: A role for glyceroneogenesis and phosphoenolpyruvate carboxykinase. Biochem. Soc. Trans. 2003, 31, 1125–1129. [Google Scholar] [CrossRef]
- Chaves, V.E.; Frasson, D.; Kawashita, N.H. Several agents and pathways regulate lipolysis in adipocytes. Biochimie 2011, 93, 1631–1640. [Google Scholar] [CrossRef]
- Jaubert, A.M.; Penot, G.; Niang, F.; Durant, S.; Forest, C. Rapid nitration of adipocyte phosphoenolpyruvate carboxykinase by leptin reduces glyceroneogenesis and induces fatty acid release. PLoS ONE 2012, 7, e40650. [Google Scholar] [CrossRef] [PubMed]
- Wei, Z.; Huang, L.; Cui, L.; Zhu, X. Mannose: Good player and assister in pharmacotherapy. Biomed. Pharmacother. 2020, 129, 110420. [Google Scholar] [CrossRef]
- Sharma, V.; Smolin, J.; Nayak, J.; Ayala, J.E.; Scott, D.A.; Peterson, S.N.; Freeze, H.H. Mannose Alters Gut Microbiome, Prevents Diet-Induced Obesity, and Improves Host Metabolism. Cell Rep. 2018, 24, 3087–3098. [Google Scholar] [CrossRef]
- Zhu, X.; Yan, H.; Xia, M.; Chang, X.; Xu, X.; Wang, L.; Sun, X.; Lu, Y.; Bian, H.; Li, X.; et al. Metformin attenuates triglyceride accumulation in HepG2 cells through decreasing stearyl-coenzyme A desaturase 1 expression. Lipids Health Dis. 2018, 17, 114. [Google Scholar] [CrossRef]
- Salmani Izadi, M.; Naserian, A.A.; Nasiri, M.R.; Majidzadeh Heravi, R.; Valizadeh, R. Evaluation of SCD and FASN gene expression in Baluchi, Iran-Black, and Arman Sheep. Rep. Biochem. Mol. Biol. 2016, 5, 33–39. [Google Scholar]
- Igal, R.A.; Sinner, D.I. Stearoyl-CoA desaturase 5 (SCD5), a Δ-9 fatty acyl desaturase in search of a function. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2021, 1866, 158840. [Google Scholar] [CrossRef]
- Ren, H.; Xiao, W.; Qin, X.; Cai, G.; Chen, H.; Hua, Z.; Cheng, C.; Li, X.; Hua, W.; Xiao, H.; et al. Myostatin regulates fatty acid desaturation and fat deposition through MEF2C/miR222/SCD5 cascade in pigs. Commun. Biol. 2020, 3, 612. [Google Scholar] [CrossRef]
- Gervais, R.; McFadden, J.W.; Lengi, A.J.; Corl, B.A.; Chouinard, P.Y. Effects of intravenous infusion of trans-10, cis-12 18:2 on mammary lipid metabolism in lactating dairy cows. J. Dairy. Sci. 2009, 92, 5167–5177. [Google Scholar] [CrossRef]
- Zhang, H.B.; Guan, J.Q.; Zhou, X.J.; Liao, X.P.; Guo, D.S.; Luo, X.L. Correlation Analysis of Intramuscular Fat Content and Fat Metabolism Related Gene Expression in Different Muscle Tissues of Yaks. Chin. J. Anim. Sci. 2020, 56, 73–77. (In Chinese) [Google Scholar] [CrossRef]
- Fang, Q.H.; Bai, W.Z.; Li, Z.M.; Chen, H.B.; Bi, Z.T. Studies on the effect of pig SCD5 gene deletion on fatty acid composition. Chin. J. Anim. Sci. 2023, 59, 224–231. (In Chinese) [Google Scholar] [CrossRef]
- Chen, X.; Shang, L.; Deng, S.; Li, P.; Chen, K.; Gao, T.; Zhang, X.; Chen, Z.; Zeng, J. Peroxisomal oxidation of erucic acid suppresses mitochondrial fatty acid oxidation by stimulating malonyl-CoA formation in the rat liver. J. Biol. Chem. 2020, 295, 10168–10179. [Google Scholar] [CrossRef]
- Takahashi, A.; Dohi, H.; Egashira, Y.; Hirai, S. Erucic acid derived from rosemary regulates differentiation of mesenchymal stem cells into osteoblasts/adipocytes via suppression of peroxisome proliferator-activated receptor γ transcriptional activity. Phytother. Res. 2020, 34, 1358–1366. [Google Scholar] [CrossRef]
- Roa-Mansergas, X.; Fadó, R.; Atari, M.; Mir, J.F.; Muley, H.; Serra, D.; Casals, N. CPT1C promotes human mesenchymal stem cells survival under glucose deprivation through the modulation of autophagy. Sci. Rep. 2018, 8, 6997. [Google Scholar] [CrossRef] [PubMed]
- Hada, T.; Yamamoto, T.; Yamamoto, A.; Ohkura, K.; Yamazaki, N.; Takiguchi, Y.; Shinohara, Y. Comparison of the catalytic activities of three isozymes of carnitine palmitoyltransferase 1 expressed in COS7 cells. Appl. Biochem. Biotechnol. 2014, 172, 1486–1496. [Google Scholar] [CrossRef] [PubMed]
- Sierra, A.Y.; Gratacós, E.; Carrasco, P.; Clotet, J.; Ureña, J.; Serra, D.; Asins, G.; Hegardt, F.G.; Casals, N. CPT1c is localized in endoplasmic reticulum of neurons and has carnitine palmitoyltransferase activity. J. Biol. Chem. 2008, 283, 6878–6885. [Google Scholar] [CrossRef]
- Chen, P.; Zhang, Q.; Zhang, H.; Gao, Y.; Zhou, Y.; Chen, Y.; Guan, L.; Jiao, T.; Zhao, Y.; Huang, M.; et al. Carnitine palmitoyltransferase 1C reverses cellular senescence of MRC-5 fibroblasts via regulating lipid accumulation and mitochondrial function. J. Cell. Physiol. 2021, 236, 958–970. [Google Scholar] [CrossRef] [PubMed]
- Wu, C.; Khan, S.A.; Peng, L.J.; Lange, A.J. Roles for fructose-2,6-bisphosphate in the control of fuel metabolism: Beyond its allosteric effects on glycolytic and gluconeogenic enzymes. Adv. Enzym. Regul. 2006, 46, 72–88. [Google Scholar] [CrossRef] [PubMed]
- Dzugaj, A. Localization and regulation of muscle fructose-1,6-bisphosphatase, the key enzyme of glyconeogenesis. Adv. Enzym. Regul. 2006, 46, 51–71. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Wang, J.; Xu, H.; Xing, R.; Pan, Y.; Li, W.; Cui, J.; Zhang, H.; Lu, Y. Decreased fructose-1,6-bisphosphatase-2 expression promotes glycolysis and growth in gastric cancer cells. Mol. Cancer 2013, 12, 110. [Google Scholar] [CrossRef]
- Bakshi, I.; Suryana, E.; Small, L.; Quek, L.E.; Brandon, A.E.; Turner, N.; Cooney, G.J. Fructose bisphosphatase 2 overexpression increases glucose uptake in skeletal muscle. J. Endocrinol. 2018, 237, 101–111. [Google Scholar] [CrossRef]
- Rukkwamsuk, T.; Wensing, T.; Geelen, M.J. Effect of fatty liver on hepatic gluconeogenesis in periparturient dairy cows. J. Dairy Sci. 1999, 82, 500–505. [Google Scholar] [CrossRef]
Gene | mRNA Accession Number | Primer Sequences (5′~3′) | Product Size |
---|---|---|---|
β-actin | NM_173979.3 | Forward: AAGTACCCCATTGAGCACGG Reverse: TCCTTGATGTCACGGACGATTT | 189 bp |
SEC14L5 | NM_001191259.3 | Forward: CCACAAAGGCAAGATCCCCA Reverse: AGCTCAAGGACTGACACAGC | 104 bp |
C8G | NM_001110076.2 | Forward: TCCCCTATCAGCACCATCCA Reverse: GCAGATTCCATCCAGCTTTCG | 198 bp |
CPT1C | XM_002695120.6 | Forward: GGCTTCCGACCCTCACTGAC; Reverse: CAGAAACGGGAGAGATGCCTT | 116 bp |
ACOT11 | NM_001103275.2 | Forward: ATCCAGACTGTTGGAAATCACCT Reverse: CTCGCCATCTGCCATGTTGT | 111 bp |
SCD5 | NM_001076945.1 | Forward: TGGGTGCCATTGGTGAAGGT Reverse: CCCAGCCAACACATGAAGTC | 124 bp |
FBP2 | NM_001046164.2 | Forward: TTCATGCTTGACCCAGCTCTT Reverse: CCTCCATAGACAAGGGTGCG | 230 bp |
UCP3 | NM_174210.1 | Forward: CCCAACATCACGAGGAATGC Reverse: CAGGGGAAGTTGTCGGTGAG | 107 bp |
PLIN2 | NM_173980.2 | Forward: CTCCATTCCGCCTTCAACCT Reverse: ACGTGACTCAATGTGCTCAG | 171 bp |
UGP2 | NM_174212.2 | Forward: TGCGGATGTAAAGGGTGGGA Reverse: CATGCGCTTTTGGCACTTGA | 83 bp |
LPIN1 | NM_001206156.2 | Forward: TCTTCCCACTTCCACGCTTC Reverse: ATCCGCAGATTTGCTGACCA | 90 bp |
Item 1 | IMF Content (%) | Minimum (%) | Maximum (%) | p-Value |
---|---|---|---|---|
HIMF | 6.996 ± 0.723 A | 5.863 | 7.824 | 0.002 |
LIMF | 4.790 ± 0.783 B | 3.874 | 5.624 |
Sample | Raw Reads | Raw Bases | Clean Reads | Clean Bases | Error Rate | Q20 | Q30 | GC pct |
---|---|---|---|---|---|---|---|---|
T1 | 43,246,440 | 6.49 G | 42,439,552 | 6.37 G | 0.03 | 97.81 | 93.85 | 51.02 |
T2 | 43,426,076 | 6.51 G | 42,377,682 | 6.36 G | 0.03 | 97.87 | 94.04 | 52.11 |
T3 | 41,992,442 | 6.3 G | 41,202,940 | 6.18 G | 0.02 | 98.03 | 94.47 | 52.4 |
T4 | 41,644,788 | 6.25 G | 40,126,880 | 6.02 G | 0.02 | 98.02 | 94.46 | 52.64 |
T5 | 48,098,022 | 7.21 G | 46,682,976 | 7.0 G | 0.03 | 97.9 | 94.16 | 51.8 |
C1 | 42,494,264 | 6.37 G | 41,037,266 | 6.16 G | 0.03 | 97.9 | 94.1 | 54.01 |
C2 | 43,497,090 | 6.52 G | 42,302,406 | 6.35 G | 0.02 | 98.03 | 94.44 | 51.74 |
C3 | 46,125,528 | 6.92 G | 43,760,976 | 6.56 G | 0.02 | 97.95 | 94.24 | 52.16 |
C4 | 48,924,916 | 7.34 G | 47,173,470 | 7.08 G | 0.02 | 98.08 | 94.58 | 50.79 |
C5 | 47,427,100 | 7.11 G | 45,659,038 | 6.85 G | 0.02 | 98.07 | 94.53 | 51.84 |
Sample | Total Reads | Total Map | Map Rate | Unique Map | Unique Map Rate | Multi Map | Multi Map Rate |
---|---|---|---|---|---|---|---|
T1 | 42,439,552 | 40,217,936 | 94.77% | 39,141,933 | 92.23% | 1,076,003 | 2.54% |
T2 | 42,377,682 | 40,157,154 | 94.76% | 38,944,182 | 91.9% | 1,212,972 | 2.86% |
T3 | 41,202,940 | 39,045,874 | 94.76% | 37,817,486 | 91.78% | 1,228,388 | 2.98% |
T4 | 40,126,880 | 38,521,569 | 96.0% | 37,350,423 | 93.08% | 1,171,146 | 2.92% |
T5 | 46,682,976 | 44,779,474 | 95.92% | 43,397,543 | 92.96% | 1,381,931 | 2.96% |
C1 | 41,037,266 | 39,309,911 | 95.79% | 38,015,521 | 92.64% | 1,294,390 | 3.15% |
C2 | 42,302,406 | 40,332,401 | 95.34% | 39,075,620 | 92.37% | 1,256,781 | 2.97% |
C3 | 43,760,976 | 40,739,851 | 93.10% | 39,403,210 | 90.04% | 1,336,641 | 3.05% |
C4 | 47,173,470 | 44,649,391 | 94.65% | 43,182,346 | 91.54% | 1,467,045 | 3.11% |
C5 | 45,659,038 | 43,293,569 | 94.82% | 41,735,269 | 91.41% | 1,558,300 | 3.41% |
KEGG ID | KEGG Description | p-Value | Upregulated Genes | Downregulated Genes |
---|---|---|---|---|
bta04152 | AMPK signaling pathway | 0.0710 | FBP2; SCD5 | CPT1C |
bta04921 | Oxytocin signaling pathway | 0.1093 | RGS2; PTGS2 | NFATC3 |
bta05230 | Central carbon metabolism in cancer | 0.1063 | ENSBTAG00000032217; LDHB | / |
bta04360 | Axon guidance | 0.0550 | RND1 | SSH2; UNC5A; NFATC3 |
bta00270 | Cysteine and methionine metabolism | 0.0682 | ENSBTAG00000032217; LDHB | / |
bta00071 | Fatty acid degradation | 0.0417 | CPT1C | ENSBTAG00000052243 |
bta00051 | Fructose and mannose metabolism | 0.0312 | / | FBP2; ALDOA |
bta00350 | Tyrosine metabolism | 0.0280 | ENSBTAG00000046264 | TYRP1 |
bta00640 | Propanoate metabolism | 0.0264 | ENSBTAG00000032217; LDHB | / |
bta01230 | Biosynthesis of amino acids | 0.0222 | / | ALDOA; ENSBTAG00000018554 |
bta00030 | Pentose phosphate pathway | 0.0205 | / | FBP2; ALDOA |
bta04936 | Alcoholic liver disease | 0.0175 | SCD5; CPT1C | LPIN1; ENSBTAG00000052243 |
bta01200 | Carbon metabolism | 0.0129 | / | FBP2; ALDOA; ENSBTAG00000018554 |
bta01212 | Fatty acid metabolism | 0.0118 | SCD5; CPT1C | ENSBTAG00000052243 |
bta04625 | C-type lectin receptor signaling pathway | 0.0083 | EGR3; PTGS2 | CCL22; NFATC3 |
bta04922 | Glucagon signaling pathway | 0.0072 | ENSBTAG00000032217; LDHB; CPT1C | FBP2 |
bta00620 | Pyruvate metabolism | 0.0047 | ACOT11; ENSBTAG00000032217; LDHB | / |
bta03320 | PPAR signaling pathway | 0.0026 | SCD5; CPT1C | ENSBTAG00000052243; PLIN2 |
bta04066 | HIF-1 signaling pathway | 0.0018 | ENSBTAG00000032217; LDHB | ALDOA; ENSBTAG00000018554 |
bta00010 | Glycolysis/gluconeogenesis | <0.0001 | ENSBTAG00000032217; LDHB | FBP2; ALDOA; ENSBTAG00000018554 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gao, Y.; Yang, L.; Yao, K.; Wang, Y.; Shao, W.; Yang, M.; Zhang, X.; Wei, Y.; Ren, W. Exploration of Genes Related to Intramuscular Fat Deposition in Xinjiang Brown Cattle. Genes 2024, 15, 1121. https://doi.org/10.3390/genes15091121
Gao Y, Yang L, Yao K, Wang Y, Shao W, Yang M, Zhang X, Wei Y, Ren W. Exploration of Genes Related to Intramuscular Fat Deposition in Xinjiang Brown Cattle. Genes. 2024; 15(9):1121. https://doi.org/10.3390/genes15091121
Chicago/Turabian StyleGao, Yu, Liang Yang, Kangyu Yao, Yiran Wang, Wei Shao, Min Yang, Xinyu Zhang, Yong Wei, and Wanping Ren. 2024. "Exploration of Genes Related to Intramuscular Fat Deposition in Xinjiang Brown Cattle" Genes 15, no. 9: 1121. https://doi.org/10.3390/genes15091121
APA StyleGao, Y., Yang, L., Yao, K., Wang, Y., Shao, W., Yang, M., Zhang, X., Wei, Y., & Ren, W. (2024). Exploration of Genes Related to Intramuscular Fat Deposition in Xinjiang Brown Cattle. Genes, 15(9), 1121. https://doi.org/10.3390/genes15091121