Bioinformatics Analysis of the Genome of Rhodococcus rhodochrous IEGM 1362, an (−)-Isopulegol Biotransformer
Abstract
1. Introduction
2. Materials and Methods
2.1. Culture
2.2. Whole Genome Sequencing
2.3. Bioinformatics Analysis
2.4. Primer Design
2.5. Determination of Genes Encoding Enzymes Involved in (–)-Isopulegol Transformation
Stage 1: | 95.0 °C; 3 min. |
Stage 2: | 95.0 °C; 30 s. |
Stage 3: | Gradient 55.0–65.0 °C; 30 s. |
Stage 4: | 72.0 °C; 1:30 min. |
Repetition of Stages 2–4 34 times. | |
Stage 5: | Melting curve from 65.0 to 95.0 °C, step 0.5 °C; 5 s. |
Stage 6: | 72.0 °C; 10 min. |
3. Results and Discussion
3.1. Phylogeny and Overall Genome Characteristics
3.2. The Whole Genome Analysis
3.3. Determination of Putative Monoterpenoid Transformation Genes
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Minh Le, T.; Szakonyi, Z. Enantiomeric Isopulegol as the Chiral Pool in the Total Synthesis of Bioactive Agents. Chem. Rec. 2022, 22, e202100194. [Google Scholar] [CrossRef]
- Su, A.; Kiokekli, S.; Naviwala, M.; Shirke, A.N.; Pavlidis, I.V.; Gross, R.A. Cutinases as Stereoselective Catalysts: Specific Activity and Enantioselectivity of Cutinases and Lipases for Menthol and Its Analogs. Enzyme Microb. Technol. 2020, 133, 109467. [Google Scholar] [CrossRef]
- Shukla, O.P.; Bartholomus, R.C.; Gunsalus, I.C. Microbial Transformation of Menthol and Menthane-3,4-diol. Can. J. Microbiol. 1987, 33, 489–497. [Google Scholar] [CrossRef]
- Krivoruchko, A.; Kuyukina, M.; Ivshina, I. Advanced Rhodococcus Biocatalysts for Environmental Biotechnologies. Catalysts 2019, 9, 236. [Google Scholar] [CrossRef]
- Ivshina, I.B.; Vikhareva, E.V.; Richkova, M.I.; Mukhutdinova, A.N.; Karpenko, J.N. Biodegradation of Drotaverine Hydrochloride by Free and Immobilized Cells of Rhodococcus rhodochrous IEGM 608. World J. Microbiol. Biotechnol. 2012, 28, 2997–3006. [Google Scholar] [CrossRef]
- Huizenga, J.M.; Schindler, J.; Simonich, M.T.; Truong, L.; Garcia-Jaramillo, M.; Tanguay, R.L.; Semprini, L. PAH Bioremediation with Rhodococcus rhodochrous ATCC 21198: Impact of Cell Immobilization and Surfactant Use on PAH Treatment and Post-Remediation Toxicity. J. Hazard. Mater. 2024, 470, 134109. [Google Scholar] [CrossRef]
- Ivanova, K.M.; Grishko, V.V.; Ivshina, I.B. Highly Efficient Biodegradation of Ecotoxic Dehydroabietic Acid by Resting Cells of Rhodococcus rhodochrous IEGM 107. Microbiology 2022, 91, 364–377. [Google Scholar] [CrossRef]
- Elkin, A.A.; Kylosova, T.I.; Grishko, V.V.; Ivshina, I.B. Enantioselective Oxidation of Sulfides to Sulfoxides by Gordonia terrae IEGM 136 and Rhodococcus rhodochrous IEGM 66. J. Mol. Catal. B Enzym. 2013, 89, 82–85. [Google Scholar] [CrossRef]
- Grishko, V.V.; Tarasova, E.V.; Ivshina, I.B. Biotransformation of Betulin to Betulone by Growing and Resting Cells of the Actinobacterium Rhodococcus rhodochrous IEGM 66. Process Biochem. 2013, 48, 1640–1644. [Google Scholar] [CrossRef]
- Luchnikova, N.A.; Grishko, V.V.; Kostrikina, N.A.; Sorokin, V.V.; Mulyukin, A.L.; Ivshina, I.B. Biotransformation of Oleanolic Acid Using Rhodococcus rhodochrous IEGM 757. Catalysts 2022, 12, 1352. [Google Scholar] [CrossRef]
- Luchnikova, N.A.; Tarasova, E.V.; Grishko, V.V.; Ivshina, I.B. Rhodococcus rhodochrous IEGM 1360, an Effective Biocatalyst of C3 Oxidative Transformation of Oleanane Triterpenoids. Microbiology 2023, 92, 204–214. [Google Scholar] [CrossRef]
- Sahu, R.; Meghavarnam, A.K.; Janakiraman, S. Response Surface Methodology: An Effective Optimization Strategy for Enhanced Production of Nitrile Hydratase (NHase) by Rhodococcus rhodochrous (RS-6). Heliyon 2020, 6, e05111. [Google Scholar] [CrossRef]
- Ivshina, I.B.; Luchnikova, N.A.; Maltseva, P.Y.; Ilyina, I.V.; Volcho, K.P.; Gatilov, Y.V.; Korchagina, D.V.; Kostrikina, N.A.; Sorokin, V.V.; Mulyukin, A.L.; et al. Biotransformation of (–)-Isopulegol by Rhodococcus rhodochrous. Pharmaceuticals 2022, 15, 964. [Google Scholar] [CrossRef]
- Ivshina, I.B.; Luchnikova, N.A.; Maltseva, P.Y.; Ilyina, I.V.; Volcho, K.P.; Salakhutdinov, N.F. Method for Biotransformation of Plant Monoterpenoid (−)-Isopulegol to Obtain Biologically Active Compounds. Patent of the Russian Federation No. 2796679, 29 May 2023. [Google Scholar]
- de Carvalho, C.C.C.R.; da Fonseca, M.M.R. Biotransformations. Compr. Biotechnol. Second Ed. 2011, 2, 451–460. [Google Scholar] [CrossRef]
- Van Der Werf, M.J.; Van Der Ven, C.; Barbirato, F.; Eppink, M.H.M.; De Bont, J.A.M.; Van Berkel, W.J.H. Stereoselective Carveol Dehydrogenase from Rhodococcus erythropolis DCL14: A Novel Nicotinoprotein Belonging to the Short Chain Dehydrogenase/Reductase Superfamily. J. Biol. Chem. 1999, 274, 26296–26304. [Google Scholar] [CrossRef]
- Van Der Werf, M.J.; Swarts, H.J.; De Bont, J.A.M. Rhodococcus erythropolis DCL14 Contains a Novel Degradation Pathway for Limonene. Appl. Environ. Microbiol. 1999, 65, 2092–2102. [Google Scholar] [CrossRef]
- Jakubovska, J.; Meškys, R. Characterization of 1,8-Cineole Degradation Encoding Operon from Rhodococcus sp. TMP1. Chemija 2016, 27, 84–91. [Google Scholar]
- Giang, P.D.; Churchman, L.R.; Buczynski, J.B.; Bell, S.G.; Stok, J.E.; De Voss, J.J. CYP108N14: A Monoterpene Monooxygenase from Rhodococcus globerulus. Arch. Biochem. Biophys. 2024, 752, 109852. [Google Scholar] [CrossRef]
- Giang, P.D.; Churchman, L.R.; Stok, J.E.; Soo, R.M.; De Voss, J.J. CYP108N12 Initiates p-Cymene Biodegradation in Rhodococcus globerulus. Arch. Biochem. Biophys. 2022, 730, 109410. [Google Scholar] [CrossRef]
- Brettin, T.; Davis, J.J.; Disz, T.; Edwards, R.A.; Gerdes, S.; Olsen, G.J.; Olson, R.; Overbeek, R.; Parrello, B.; Pusch, G.D.; et al. RASTtk: A Modular and Extensible Implementation of the RAST Algorithm for Building Custom Annotation Pipelines and Annotating Batches of Genomes. Sci. Rep. 2015, 5, 8365. [Google Scholar] [CrossRef]
- Meier-Kolthoff, J.P.; Göker, M. TYGS Is an Automated High-Throughput Platform for State-of-the-Art Genome-Based Taxonomy. Nat. Commun. 2019, 10, 2182. [Google Scholar] [CrossRef]
- Yoon, S.-H.; Ha, S.; Lim, J.; Kwon, S.; Chun, J. A Large-Scale Evaluation of Algorithms to Calculate Average Nucleotide Identity. Antonie Van Leeuwenhoek 2017, 110, 1281–1286. [Google Scholar] [CrossRef]
- Blin, K.; Shaw, S.; Kloosterman, A.M.; Charlop-Powers, Z.; Van Wezel, G.P.; Medema, M.H.; Weber, T. AntiSMASH 6.0: Improving Cluster Detection and Comparison Capabilities. Nucleic Acids Res. 2021, 49, W29–W35. [Google Scholar] [CrossRef]
- Kanehisa, M.; Sato, Y.; Morishima, K. BlastKOALA and GhostKOALA: KEGG Tools for Functional Characterization of Genome and Metagenome Sequences. J. Mol. Biol. 2016, 428, 726–731. [Google Scholar] [CrossRef]
- Chun, J.; Oren, A.; Ventosa, A.; Christensen, H.; Arahal, D.R.; da Costa, M.S.; Rooney, A.P.; Yi, H.; Xu, X.W.; De Meyer, S.; et al. Proposed Minimal Standards for the Use of Genome Data for the Taxonomy of Prokaryotes. Int. J. Syst. Evol. Microbiol. 2018, 68, 461–466. [Google Scholar] [CrossRef]
- Meier-Kolthoff, J.P.; Auch, A.F.; Klenk, H.P.; Göker, M. Genome Sequence-Based Species Delimitation with Confidence Intervals and Improved Distance Functions. BMC Bioinform. 2013, 14, 60. [Google Scholar] [CrossRef]
- Kuzuyama, T. Mevalonate and Nonmevalonate Pathways for the Biosynthesis of Isoprene Units. Biosci. Biotechnol. Biochem. 2002, 66, 1619–1627. [Google Scholar] [CrossRef]
- Tarasova, E.V.; Luchnikova, N.A.; Grishko, V.V.; Ivshina, I.B. Actinomycetes as Producers of Biologically Active Terpenoids: Current Trends and Patents. Pharmaceuticals 2023, 16, 872. [Google Scholar] [CrossRef]
- Helgeson, J.P.; Leonard, N.J. Cytokinins: Identification of Compounds Isolated from Corynebacterium fascians. Proc. Natl. Acad. Sci. USA 1966, 56, 60–63. [Google Scholar] [CrossRef]
- Rudolf, J.D.; Alsup, T.A.; Xu, B.; Li, Z. Bacterial Terpenome. Nat. Prod. Rep. 2021, 38, 905. [Google Scholar] [CrossRef]
- Styczynski, M.; Rogowska, A.; Gieczewska, K.; Garstka, M.; Szakiel, A.; Dziewit, L. Genome-Based Insights into the Production of Carotenoids by Antarctic Bacteria, Planococcus sp. ANT_H30 and Rhodococcus sp. ANT_H53B. Molecules 2020, 25, 4357. [Google Scholar] [CrossRef] [PubMed]
- Jiang, W.; Sun, J.; Gao, H.; Tang, Y.; Wang, C.; Jiang, Y.; Zhang, W.; Xin, F.; Jiang, M. Carotenoids Production and Genome Analysis of a Novel Carotenoid Producing Rhodococcus aetherivorans N1. Enzyme Microb. Technol. 2023, 164, 110190. [Google Scholar] [CrossRef]
- Cappelletti, M.; Presentato, A.; Piacenza, E.; Firrincieli, A.; Turner, R.J.; Zannoni, D. Biotechnology of Rhodococcus for the Production of Valuable Compounds. Appl. Microbiol. Biotechnol. 2020, 104, 8567–8594. [Google Scholar] [CrossRef]
- Maltseva, P.Y.; Plotnitskaya, N.A.; Ivshina, I.B. Transformation of Terpenoids and Steroids Using Actinomycetes of the Genus Rhodococcus. Molecules 2024, 29, 3378. [Google Scholar] [CrossRef] [PubMed]
Feature | Value |
---|---|
Size, bp | 5,733,046 |
GC content, % | 67.8 |
N50, bp | 126,441 |
L50 | 13 |
Number of contigs | 140 |
Number of coding sequences | 5331 |
Number of RNAs | 67 |
Genome coverage | 53.0× |
Subject Type Strain | dDDH, % * | G+C Content Difference, % | ANI, % |
---|---|---|---|
R. rhodochrous NBRC 16069 | 79.7 | 0.45 | 97.86 |
R. rhodochrous NCTC10210 | 79.4 | 0.38 | 97.89 |
R. rhodochrous DSM 43241 | 79.6 | 0.45 | 97.81 |
R. pyridinivorans TG9 | 60.4 | 0.25 | 95.15 |
R. pyridinivorans DSM 44555 | 58.9 | 0.05 | 94.91 |
R. gordoniae DSM 44689 | 41.6 | 0.15 | 90.81 |
Coding Element | Number of Clusters |
---|---|
Non-ribosomal peptide synthetase | 6 |
Terpene | 3 |
Ectoine | 1 |
beta-Lactone | 2 |
Butyrolactone | 1 |
ε-Poly-L-lysine | 1 |
T1 Polyketide synthase | 1 |
Gene No. | Contig ID | Gene Location (Gene Size, bp) | Primer Direction | Primer Sequence (5′ → 3′) | Tm, °C | Amplicon Size, bp |
---|---|---|---|---|---|---|
1 | NODE_57_length_21710_cov_10.083492 | 20,649–18,289 (2361) | Forward | TACAGCCCCGAACTCGACTA | 55.7 | 311 |
Reverse | TGTCCGGTATCGATGAAGCG | |||||
2 | NODE_33_length_49450_cov_11.184397 | 41,128–42,420 (1293) | Forward | GTTCATCGAGGGCCTGAACA | 57 | 373 |
Reverse | CTCGAAACGCAGTGTCTCCT | |||||
3 | NODE_17_length_96204_cov_10.945325 | 67,773–69,119 (1347) | Forward | CGACGACATCTTCTCGGTGT | 59 | 389 |
Reverse | TGTGGTGGGAGAAGTGCATC | |||||
4 | NODE_54_length_24166_cov_8.603810 | 6580–7959 (1380) | Forward | TCGTTCGCTTTGCACTACCT | 59 | 370 |
Reverse | CGAATGGCTTGTATGCGTGG | |||||
5 | NODE_2_length_337154_cov_11.648399 | 238,563–237,184 (1380) | Forward | CACGTCGACCATCACGATCT | 61.4 | 448 |
Reverse | TTGGTGGACGATCGCTTTGA | |||||
6 | NODE_27_length_73775_cov_9.719571 | 62,892–64,214 (1323) | Forward | GCTCTGACGCAGGAGTTCTT | 61.4 | 444 |
Reverse | ACGCAGTGTGTAGTCCTGTG | |||||
7 | NODE_33_length_49450_cov_11.184397 | 31,096–29,762 (1335) | Forward | ATCGGTTCACCCAGAACCTG | 59 | 403 |
Reverse | GAGGACAGGATCACGAAGCC | |||||
8 | NODE_2_length_337154_cov_11.648399 | 99,355–98,144 (1212) | Forward | CCGATCTCGTAGCCCAGTTC | 61.4 | 554 |
Reverse | TTCGCTGATCTCGATTCCCG | |||||
9 | NODE_20_length_89047_cov_8.544141 | 82,615–81,383 (1233) | Forward | CATCTCCCACGGCCTGTATC | 63.3 | 461 |
Reverse | TGTACTCGACACGAAGGTGC |
Gene No. | Identities for DNA Sequences, % | Identities for Amino Acid Sequences, % | ||
---|---|---|---|---|
With R. rhodochrous Strains | With R. pyridinivorans Strains | With R. rhodochrous Strains | With R. pyridinivorans Strains | |
1 | 88.72–99.36 (5 *) | 89.63–92.09 (10) | 92.88–100.00 (15) | 95.17–99.49 (13) |
2 | 95.75–99.92 (6) | 95.44–97.91 (15) | 97.67–100.00 (5) | 97.21–99.07 (7) |
3 | 95.84–99.85 (6) | 95.92 (1) | 98.50–100.00 (6) | 98.44 (1) |
4 | 93.19–100.00 (3) | 82.05–93.19 (4) | 56.36–100.00 (12) | 56.11–96.70 (27) |
5 | 96.16–97.10 (5) | 95.14–96.74 (15) | 97.17–100.00 (10) | 96.95–98.26 (17) |
6 | Not found | 99.85–99.92 (4) | 94.55 (1) | 99.77 (1) |
7 | 95.43–96.70 (6) | 95.73–96.55 (15) | 61.56–99.55 (9) | 97.52–98.37 (9) |
8 | 97.11–99.67 (6) | 96.29–98.76 (15) | 85.11–99.26 (6) | 95.45–99.75 (5) |
9 | 99.92 (1) | 99.35 (1) | 100.00 (1) | 98.78 (1) |
Gene No. | Nearby Genes | |||
---|---|---|---|---|
Upstream Transcriptional Regulators | Proteins Participating in Electron Transfers and Redox Reactions | Mobile Elements and Transposases | Other | |
1 | IclR family | No | No | Two-component system, L-proline/glycine betaine transporter ProP; enoyl-CoA hydratase; predicted hydrolase/acyltransferase |
2 | MarR family | CYP450 gene no. 7; oxidoreductase, short-chain dehydrogenase/reductase family | No | Two uncharacterized MFS-type transporters |
3 | IclR family | TTP-dependent protein, related to E1 component of pyruvate/2-oxoglutarate/acetoin dehydrogenase; thioredoxin reductase; 2 acyl-CoA-dehydrogenases | No | Putative hydrolase; two fluoride ion transporters CrcB; a permease and translocation protein for amino acids; enzymes for synthesis of lipids and fatty acids |
4 | XRE family | No | One mobile element protein | Putative peptidase; putative transmembrane protein |
5 | AcrR family | 4-Hydroxyphenylpyruvate dioxygenase; alcohol dehydrogenase; 2 acyl-CoA-dehydrogenases; putative short-chain dehydrogenase | No | Other transcriptional regulators; two methylated-DNA--protein-cysteine methyltransferases; RNA polymerase sigma factor RpoE; DNA-3-methyladenine glycosylase II; DNA polymerase I |
6 | No | Ferredoxin, 2Fe-2S; ferredoxin reductase; alcohol dehydrogenase; succinate-semialdehyde dehydrogenase [NAD] [NADP+] | One mobile element protein | Enzymes for synthesis of lipids and fatty acids |
7 | AcrR family | Oxidoreductase, short-chain dehydrogenase/reductase family; CYP450 gene no. 1; putative dioxygenase | No | Two peptidases; two-component system; long-chain-fatty-acid-CoA ligase; putative esterase |
8 | AraC family | 1,2-Dihydroxycyclohexa-3,5-diene-1- carboxylate dehydrogenase; oxidoreductase FAD-binding domain protein; benzoate 1,2-dioxygenase alpha and beta subunits; 2-polyprenylphenol hydroxylase; 4-hydroxyphenylacetate 3-monooxygenase; NADH-FMN oxidoreductase; catechol 1,2-dioxygenase | No | Two benzoate transporters; other transcriptional regulators; muconate cycloisomerase; muconolactone isomerase |
9 | TetR family | Three oxidoreductases, short-chain dehydrogenase/reductase family; 3-oxosteroid 1-dehydrogenase | One mobile element protein | Isochorismatase; enoyl-CoA hydratase; conserved protein associated with acetyl-CoA C-acyltransferase |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Maltseva, P.Y.; Plotnitskaya, N.A.; Krivoruchko, A.V.; Beletskiy, A.V.; Rakitin, A.L.; Mardanov, A.V.; Ivshina, I.B. Bioinformatics Analysis of the Genome of Rhodococcus rhodochrous IEGM 1362, an (−)-Isopulegol Biotransformer. Genes 2024, 15, 992. https://doi.org/10.3390/genes15080992
Maltseva PY, Plotnitskaya NA, Krivoruchko AV, Beletskiy AV, Rakitin AL, Mardanov AV, Ivshina IB. Bioinformatics Analysis of the Genome of Rhodococcus rhodochrous IEGM 1362, an (−)-Isopulegol Biotransformer. Genes. 2024; 15(8):992. https://doi.org/10.3390/genes15080992
Chicago/Turabian StyleMaltseva, Polina Yu., Natalia A. Plotnitskaya, Anastasiia V. Krivoruchko, Aleksey V. Beletskiy, Andrey L. Rakitin, Andrey V. Mardanov, and Irina B. Ivshina. 2024. "Bioinformatics Analysis of the Genome of Rhodococcus rhodochrous IEGM 1362, an (−)-Isopulegol Biotransformer" Genes 15, no. 8: 992. https://doi.org/10.3390/genes15080992
APA StyleMaltseva, P. Y., Plotnitskaya, N. A., Krivoruchko, A. V., Beletskiy, A. V., Rakitin, A. L., Mardanov, A. V., & Ivshina, I. B. (2024). Bioinformatics Analysis of the Genome of Rhodococcus rhodochrous IEGM 1362, an (−)-Isopulegol Biotransformer. Genes, 15(8), 992. https://doi.org/10.3390/genes15080992