The Identification of Goat KCNJ15 Gene Copy Number Variation and Its Association with Growth Traits
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Samples and Trait Records
2.2. Sample Collection and Genomic DNA Extraction
2.3. Genomic DNA Identification and Primer Test
2.4. Detection of the CNV of the Goat KCNJ15 Gene
2.5. Statistical Analysis of the Data
3. Results
3.1. Distribution of the KCNJ15 Gene CNV in the Five Breeds of Goat
3.2. Effect of the KCNJ15 CNV on the Observed Traits in the Different Breeds of Goats
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Huang, Y.; Li, Y.; Wang, X.; Yu, J.; Cai, Y.; Zheng, Z.; Li, R.; Zhang, S.; Chen, N.; Asadollahpour Nanaei, H.; et al. An atlas of CNV maps in cattle, goat and sheep. Sci. China Life Sci. 2021, 64, 1747–1764. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sebat, J.; Lakshmi, B.; Troge, J.; Alexander, J.; Young, J.; Lundin, P.; Månér, S.; Massa, H.; Walker, M.; Chi, M.; et al. Large-scale copy number polymorphism in the human genome. Science 2004, 305, 525–528. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ladeira, G.C.; Pilonetto, F.; Fernandes, A.C.; Bóscollo, P.P.; Dauria, B.D.; Titto, C.G.; Coutinho, L.L.; e Silva, F.F.; Pinto, L.F.B.; Mourão, G.B. CNV detection and their association with growth, efficiency and carcass traits in Santa Inês sheep. J. Anim. Breed. Genet. 2022, 139, 476–487. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, C.; Fan, H.; Yuan, Z.; Hu, S.; Ma, X.; Xuan, J.; Wang, H.; Zhang, L.; Wei, C.; Zhang, Q.; et al. Genome-wide detection of CNVs in Chinese indigenous sheep with different types of tails using ovine high-density 600K SNP arrays. Sci. Rep. 2016, 6, 27822. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ernst, C.W.; Steibel, J.P. Molecular advances in QTL discovery and application in pig breeding. Trends Genet. 2013, 29, 215–224. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ge, F.; Jia, C.; Chu, M.; Liang, C.; Yan, P. Copy Number Variation of the CADM2 Gene and Its Association with Growth Traits in Yak. Animals 2019, 9, 1008. [Google Scholar] [CrossRef] [Scilit]
- Shuck, M.E.; Piser, T.M.; Bock, J.H.; Slightom, J.L.; Lee, K.S.; Bienkowski, M.J. Cloning and characterization of two K+ inward rectifier (Kir) 1.1 potassium channel homologs from human kidney (Kir1.2 and Kir1.3). J. Biol. Chem. 1997, 272, 586–593. [Google Scholar] [CrossRef] [Scilit]
- Lachheb, S.; Cluzeaud, F.; Bens, M.; Genete, M.; Hibino, H.; Lourdel, S.; Kurachi, Y.; Vandewalle, A.; Teulon, J.; Paulais, M. Kir4.1/Kir5.1 channel forms the major K+ channel in the basolateral membrane of mouse renal collecting duct principal cells. Am. J. Physiol. Renal Physiol. 2008, 294, F1398–F1407. [Google Scholar] [CrossRef] [Scilit]
- Nakajima, K.-I.; Zhu, K.; Sun, Y.-H.; Hegyi, B.; Zeng, Q.; Murphy, C.J.; Small, J.V.; Chen-Izu, Y.; Izumiya, Y.; Penninger, J.M.; et al. KCNJ15/Kir4.2 couples with polyamines to sense weak extracellular electric fields in galvanotaxis. Nat. Commun. 2015, 6, 8532. [Google Scholar] [CrossRef] [Scilit]
- Guo, J.; Jiang, R.; Mao, A.; Liu, G.E.; Zhan, S.; Li, L.; Zhong, T.; Wang, L.; Cao, J.; Chen, Y.; et al. Genome-wide association study reveals 14 new SNPs and confirms two structural variants highly associated with the horned/polled phenotype in goats. BMC Genom. 2021, 22, 769. [Google Scholar] [CrossRef] [Scilit]
- Simon, R.; Lischer, H.E.L.; Pieńkowska-Schelling, A.; Keller, I.; Häfliger, I.M.; Letko, A.; Schelling, C.; Lühken, G.; Drögemüller, C. New genomic features of the polled intersex syndrome variant in goats unraveled by long-read whole-genome sequencing. Anim. Genet. 2020, 51, 439–448. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Okamoto, K.; Iwasaki, N.; Doi, K.; Noiri, E.; Iwamoto, Y.; Uchigata, Y.; Fujita, T.; Tokunaga, K. Inhibition of glucose-stimulated insulin secretion by KCNJ15, a newly identified susceptibility gene for type 2 diabetes. Diabetes 2012, 61, 1734–1741. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, X.; Chen, Y.; Mok, K.Y.; Zhao, Q.; Chen, K.; Chen, Y.; Hardy, J.; Li, Y.; Fu, A.K.Y.; Guo, Q.; et al. Identification of genetic risk factors in the Chinese population implicates a role of immune system in Alzheimer’s disease pathogenesis. Proc. Natl. Acad. Sci. USA 2018, 115, 1697–1706. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Loparev, V.N.; Cartas, M.A.; Monken, C.E.; Velpandi, A.; Srinivasan, A. An efficient and simple method of DNA extraction from whole blood and cell lines to identify infectious agents. J. Virol. Methods 1991, 34, 105–112. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- E, G.X.; Zhou, D.K.; Zheng, Z.Q.; Yang, B.G.; Li, X.L.; Li, L.H.; Zhou, R.Y.; Nai, W.H.; Jiang, X.P.; Zhang, J.H.; et al. Identification of a Goat Intersexuality-Associated Novel Variant Through Genome-Wide Resequencing and Hi-C. Front. Genet. 2020, 11, 616743. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xia, X.; Zhang, S.; Zhang, H.; Zhang, Z.; Chen, N.; Li, Z.; Sun, H.; Liu, X.; Lyu, S.; Wang, X.; et al. Assessing genomic diversity and signatures of selection in Jiaxian Red cattle using whole-genome sequencing data. BMC Genom. 2021, 22, 43. [Google Scholar] [CrossRef] [Scilit]
- Bae, J.S.; Cheong, H.S.; Kim, L.H.; NamGung, S.; Park, T.J.; Chun, J.-Y.; Kim, J.Y.; Pasaje, C.F.A.; Lee, J.S.; Shin, H.D. Identification of copy number variations and common deletion polymorphisms in cattle. BMC Genom. 2010, 11, 232. [Google Scholar] [CrossRef] [Scilit]
- Yang, P.; Zhang, Z.; Xu, J.; Qu, K.; Lyv, S.; Wang, X.; Cai, C.; Li, Z.; Wang, E.; Xie, J.; et al. The Association of the Copy Number Variation of the MLLT10 Gene with Growth Traits of Chinese Cattle. Animals 2020, 10, 250. [Google Scholar] [CrossRef] [Scilit]
- Xu, Z.; Wang, X.; Zhang, Z.; An, Q.; Wen, Y.; Wang, D.; Liu, X.; Li, Z.; Lyu, S.; Li, L.; et al. Copy number variation of CADM2 gene revealed its association with growth traits across Chinese Capra hircus (goat) populations. Gene 2020, 741, 144519. [Google Scholar] [CrossRef] [Scilit]
- Zhong, J.-L.; Xu, J.-W.; Wang, J.; Wen, Y.-F.; Niu, H.; Zheng, L.; He, H.; Peng, K.; He, P.; Shi, S.-Y.; et al. A novel SNP of PLAG1 gene and its association with growth traits in Chinese cattle. Gene 2019, 689, 166–171. [Google Scholar] [CrossRef] [Scilit]
- Feng, Z.; Li, X.; Cheng, J.; Jiang, R.; Huang, R.; Wang, D.; Huang, Y.; Pi, L.; Hu, L.; Chen, H. Copy Number Variation of the PIGY Gene in Sheep and Its Association Analysis with Growth Traits. Animals 2020, 10, 688. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, R.; Cheng, J.; Cao, X.-K.; Ma, Y.-L.; Chaogetu, B.; Huang, Y.-Z.; Lan, X.-Y.; Lei, C.-Z.; Hu, L.-Y.; Chen, H. Copy Number Variation of the SHE Gene in Sheep and Its Association with Economic Traits. Animals 2019, 9, 531. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pös, O.; Radvanszky, J.; Buglyó, G.; Pös, Z.; Rusnakova, D.; Nagy, B.; Szemes, T. DNA copy number variation: Main characteristics, evolutionary significance, and pathological aspects. Biomed. J. 2021, 44, 548–559. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ding, X.; Zhang, Z.; Hu, R.; Wen, Y.; Huang, Y.; Shi, Q.; Feng, Y.; Wang, E.; Lei, C.; He, H. A molecular marker of milk composition traits in NCAM2 gene of Chinese Holstein. Anim. Biotechnol. 2022, 33, 79–84. [Google Scholar] [CrossRef] [Scilit]



| Gene | Sequences (5′–3′) | Amplification Length (bp) | Tm (°C) |
|---|---|---|---|
| KCNJ15 | F1: CCGCTTTCTTGTGAACTTCCAT | 80 | 60 |
| R1: CTGTCACGTGTCCAGAAAGTAGA | |||
| MC1R | F2: GGGCAGTCCCTTGACAAAGA | 129 | 60 |
| R2: ATCTCCCCAGCCTCCTCATT |
| Growth Traits | CNV Type (Mean ± SE) | p-Value | |||
|---|---|---|---|---|---|
| Normal | Duplication | ||||
| CN = 2 (n = 5) | CN = 3 (n = 21) | CN = 4 (n = 22) | CN ≥ 5 (n = 78) | ||
| Body weight (kg) | 31.50 ± 1.40 | 27.46 ± 1.74 | 27.07 ± 1.05 | 26.85 ± 0.82 | 0.541 |
| Withers height (cm) | 63.40 ± 1.54 | 59.43 ± 1.31 | 60.91 ± 0.93 | 58.39 ± 0.70 | 0.113 |
| Body length (cm) | 61.40 ± 2.08 | 62.14 ± 1.68 | 60.95 ± 1.17 | 60.44 ± 0.74 | 0.76 |
| Chest measurement (cm) | 75.00 ± 0.63 | 74.81 ± 1.28 | 73.61 ± 0.95 | 73.45 ± 0.80 | 0.807 |
| Circumference of the cannon bone (cm) | 9.40 ± 0.25 a | 4.84 ± 0.93 b | 6.85 ± 0.75 ab | 6.87 ± 0.40 ab | 0.033 * |
| Growth Traits | CNV Type (Mean ± SE) | p-Value | ||
|---|---|---|---|---|
| Duplication | ||||
| CN = 3 (n = 2) | CN = 4 (n = 3) | CN ≥ 5 (n = 57) | ||
| Body weight (kg) | 44.34 ± 2.35 a | 22.19 ± 2.79 b | 26.96 ± 0.97 ab | 0.024 * |
| Chest measurement (cm) | 85.50 ± 1.50 a | 70 ± 1.50 b | 70.77 ± 0.92 b | 0.040 * |
| Growth Traits | CNV Type (Mean ± SE) | p-Value | |||
|---|---|---|---|---|---|
| Normal | Duplication | ||||
| CN = 2 (n = 5) | CN = 3 (n = 27) | CN = 4 (n = 37) | CN ≥ 5 (n = 225) | ||
| Withers height (cm) | 64.33 ± 2.67 | 65.85 ± 2.05 | 68.78 ± 0.64 | 67.84 ± 0.39 | 0.263 |
| Body length (cm) | 67.00 ± 3.51 | 72.29 ± 2.35 | 76.75 ± 1.17 | 75.73 ± 0.64 | 0.159 |
| Circumference of the cannon bone (cm) | 9.00 ± 0.58 | 10.02 ± 0.26 | 10.26 ± 0.16 | 10.09 ± 0.64 | 0.179 |
| Chest measurement (cm) | 78.33 ± 3.76 | 83.88 ± 3.00 | 92.21 ± 1.39 | 88.95 ± 1.01 | 0.138 |
| Body weight (kg) | 38.58 ± 5.41 | 49.40 ± 4.30 | 60.16 ± 3.03 | 58.63 ± 1.47 | 0.135 |
| Growth Traits | CNV Type (Mean ± SE) | p-Value | |||
|---|---|---|---|---|---|
| Normal | Duplication | ||||
| CN = 2 (n = 2) | CN = 3 (n = 15) | CN = 4 (n = 17) | CN ≥ 5 (n = 92) | ||
| Withers height (cm) | 51.50 ± 1.50 | 60.67 ± 1.58 | 61.12 ± 1.73 | 62.27 ± 1.55 | 0.052 |
| Body length (cm) | 52.00 ± 3.00 b | 60.80 ± 2.18 a | 61.03 ± 1.38 a | 63.19 ± 0.63 a | 0.044 * |
| Chest measurement (cm) | 59.00 ± 2.00 | 73.37 ± 2.08 | 73.97 ± 1.76 | 75.65 ± 0.99 | 0.074 |
| Circumference of the cannon bone (cm) | 7.50 ± 1.50 | 8.20 ± 0.22 | 8.44 ± 0.18 | 9.31 ± 0.78 | 0.889 |
| Body weight (kg) | 16.85 ± 2.10 | 31.27 ± 2.92 | 31.60 ± 2.27 | 34.47 ± 1.00 | 0.052 |
| Growth Traits | CNV Type (Mean ± SE) | p-Value | |||
|---|---|---|---|---|---|
| Normal | Duplication | ||||
| CN = 2 (n = 1) | CN = 3 (n = 0) | CN = 4 (n = 9) | CN ≥ 5 (n = 88) | ||
| Body length (cm) | 72.6 | 67.00 ± 0.85 | 64.27 ± 0.56 | 0.109 | |
| Withers height (cm) | 66.1 | 61.06 ± 0.67 | 58.22 ± 0.38 | 0.010 * | |
| Chest measurement (cm) | 82 | 78.98 ± 2.32 | 72.55 ± 0.86 | 0.056 | |
| Circumference of the cannon bone (cm) | 7.5 | 7.23 ± 0.18 | 7.41 ± 0.06 | 0.67 | |
| Body weight (kg) | 45.2 | 39.04 ± 2.46 | 31.15 ± 0.95 | 0.045 * | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhao, J.; Liu, Z.; Wang, X.; Xin, X.; Du, L.; Zhao, H.; An, Q.; Ding, X.; Zhang, Z.; Wang, E.; et al. The Identification of Goat KCNJ15 Gene Copy Number Variation and Its Association with Growth Traits. Genes 2024, 15, 250. https://doi.org/10.3390/genes15020250
Zhao J, Liu Z, Wang X, Xin X, Du L, Zhao H, An Q, Ding X, Zhang Z, Wang E, et al. The Identification of Goat KCNJ15 Gene Copy Number Variation and Its Association with Growth Traits. Genes. 2024; 15(2):250. https://doi.org/10.3390/genes15020250
Chicago/Turabian StyleZhao, Jiahao, Zhe Liu, Xianwei Wang, Xiaoling Xin, Lei Du, Huangqing Zhao, Qingming An, Xiaoting Ding, Zijing Zhang, Eryao Wang, and et al. 2024. "The Identification of Goat KCNJ15 Gene Copy Number Variation and Its Association with Growth Traits" Genes 15, no. 2: 250. https://doi.org/10.3390/genes15020250
APA StyleZhao, J., Liu, Z., Wang, X., Xin, X., Du, L., Zhao, H., An, Q., Ding, X., Zhang, Z., Wang, E., Xu, Z., & Huang, Y. (2024). The Identification of Goat KCNJ15 Gene Copy Number Variation and Its Association with Growth Traits. Genes, 15(2), 250. https://doi.org/10.3390/genes15020250

