The Complete Mitochondrial Genome of the Luciocyprinus langsoni (Cypriniformes: Cyprinidae): Characterization, Phylogeny, and Genetic Diversity Analysis
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection, DNA Isolation, PCR Amplification, and Sequencing
2.2. Sequence Assembly, Annotation, and Bioinformatics Analysis
2.3. Phylogenetic Analyses
2.4. Population Genetic Diversity Analysis
3. Results and Discussion
3.1. Mitogenome Genome Organization of L. langsoni
3.2. Protein-Coding Genes and Codon Usage
3.3. Ribosomal and Transfer RNA Genes
3.4. Selection Analysis
3.5. Phylogenetic Analyses
3.6. Population Genetic Diversity
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Boore, J.L. Animal mitochondrial genomes. Nucleic Acids Res. 1999, 27, 1767–1780. [Google Scholar] [CrossRef] [PubMed]
- Moritz, C. Applications of mitochondrial DNA analysis in conservation: A critical review. Mol. Ecol. 1994, 3, 401–411. [Google Scholar] [CrossRef]
- Guo, X.H.; Liu, S.J.; Liu, Q.; Liu, Y. New progresses on mitochondrial DNA in fish. Yi Chuan Xue Bao = Acta Genet. Sin. 2004, 31, 983–1000. [Google Scholar] [PubMed]
- Brown, K.H. Fish mitochondrial genomics: Sequence, inheritance and functional variation. J. Fish Biol. 2008, 72, 355–374. [Google Scholar] [CrossRef]
- Wirgin, I.; Grunwald, C.; Carlson, E.; Stabile, J.; Peterson, D.L.; Waldman, J. Range-wide population structure of shortnose sturgeonAcipenser brevirostrum based on sequence analysis of the mitochondrial DNA control region. Estuaries 2005, 28, 406–421. [Google Scholar] [CrossRef]
- Avise, J.C. Phylogeography: The History and Formation of Species. Master’s Thesis, Harvard University Press, Cambridge, MA, USA, 2000. [Google Scholar]
- Hurst, G.D.; Jiggins, F.M. Problems with mitochondrial DNA as a marker in population, phylogeographic and phylogenetic studies: The effects of inherited symbionts. Proc. R. Soc. B Biol. Sci. 2005, 272, 1525–1534. [Google Scholar] [CrossRef]
- White, D.J.; Wolff, J.N.; Pierson, M.; Gemmell, N.J. Revealing the hidden complexities of mtDNA inheritance. Mol. Ecol. 2008, 17, 4925–4942. [Google Scholar] [CrossRef]
- Bernt, M.; Braband, A.; Schierwater, B.; Stadler, P.F. Genetic aspects of mitochondrial genome evolution. Mol. Phylogenetics Evol. 2013, 69, 328–338. [Google Scholar] [CrossRef]
- Jühling, F.; Pütz, J.; Bernt, M.; Donath, A.; Middendorf, M.; Florentz, C.; Stadler, P.F. Improved systematic tRNA gene annotation allows new insights into the evolution of mitochondrial tRNA structures and into the mechanisms of mitochondrial genome rearrangements. Nucleic Acids Res. 2012, 40, 2833–2845. [Google Scholar] [CrossRef]
- Lin, S. One new fishes from Kweichow province, China. Lingnan Sci. J. 1932, 11, 515–519. [Google Scholar]
- Wu, H. Chinese Cyprinidae Fish Genera Monograph: Vol. 2. Master’s Thesis, Shanghai Scientific and Technical Publishers, Shanghai, China, 1977. [Google Scholar]
- Chen, X.; Yue, P.; Lin, R. Major groups within the family Cyprinidae and their phylogenetic relationships. Acta Zootaxonomica Sin. 1984, 9, 424–440. [Google Scholar]
- Yang, L.; Sado, T.; Hirt, M.V.; Pasco-Viel, E.; Arunachalam, M.; Li, J.; Wang, X.; Freyhof, J.; Saitoh, K.; Simons, A.M.; et al. Phylogeny and polyploidy: Resolving the classification of cyprinine fishes (Teleostei: Cypriniformes). Mol. Phylogenetics Evol. 2015, 85, 97–116. [Google Scholar] [CrossRef] [PubMed]
- Tan, M.; Armbruster, J.W. Phylogenetic classification of extant genera of fishes of the order Cypriniformes (Teleostei: Ostariophysi). Zootaxa 2018, 4476, 6–39. [Google Scholar] [CrossRef]
- Tchang, T.L. Two New Species of Barbus from Yunnan. Bull. Fan Meml. Inst. Biol. Peiping (Zool. Ser.) 1935, 6, 60–64. [Google Scholar]
- Kottelat, M. Status of Luciocyprinus and Fustis (Osteichthyes: Cyprinidae). Zool. Res. 1983, 4, 383–387. [Google Scholar]
- Allen, D. Luciocyprinus langsoni. The IUCN Red List of Threatened Species 2012: e.T166043A1107712. Available online: https://www.iucnredlist.org/species/166043/1107712 (accessed on 16 December 2024).
- National Forestry and Grassland Administration. National Key Protected Wildlife List; National Forestry and Grassland Administration: Beijing, China, 2021. [Google Scholar]
- Zhang, R.; Zhu, T.; Luo, Q. The Complete Mitochondrial Genome of the Freshwater Fish Onychostoma ovale (Cypriniformes, Cyprinidae): Genome Characterization and Phylogenetic Analysis. Genes 2023, 14, 1227. [Google Scholar] [CrossRef]
- Donath, A.; Jühling, F.; Al-Arab, M.; Bernhart, S.H.; Reinhardt, F.; Stadler, P.F.; Middendorf, M.; Bernt, M. Improved annotation of protein-coding genes boundaries in metazoan mitochondrial genomes. Nucleic Acids Res. 2019, 47, 10543–10552. [Google Scholar] [CrossRef]
- Lowe, T.M.; Chan, P.P. tRNAscan-SE On-line: Integrating search and context for analysis of transfer RNA genes. Nucleic Acids Res. 2016, 44, W54–W57. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
- Choudhuri, S.; Sau, K. CodonU: A Python Package for Codon Usage Analysis. IEEE/ACM Trans. Comput. Biol. Bioinform. 2024, 21, 36–44. [Google Scholar] [CrossRef]
- Sahyoun, A.H.; Bernt, M.; Stadler, P.F.; Tout, K. GC skew and mitochondrial origins of replication. Mitochondrion 2014, 17, 56–66. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z. KaKs_Calculator 3.0: Calculating Selective Pressure on Coding and Non-Coding Sequences. Genom. Proteom. Bioinform. 2022, 20, 536–540. [Google Scholar] [CrossRef] [PubMed]
- Larsson, A. AliView: A fast and lightweight alignment viewer and editor for large datasets. Bioinformatics 2014, 30, 3276–3278. [Google Scholar] [CrossRef]
- Liu, S.-Q.; Mayden, R.L.; Zhang, J.-B.; Yu, D.; Tang, Q.-Y.; Deng, X.; Liu, H.-Z. Phylogenetic relationships of the Cobitoidea (Teleostei: Cypriniformes) inferred from mitochondrial and nuclear genes with analyses of gene evolution. Gene 2012, 508, 60–72. [Google Scholar] [CrossRef]
- Lanfear, R.; Frandsen, P.B.; Wright, A.M.; Senfeld, T.; Calcott, B. PartitionFinder 2: New Methods for Selecting Partitioned Models of Evolution for Molecular and Morphological Phylogenetic Analyses. Mol. Biol. Evol. 2017, 34, 772–773. [Google Scholar] [CrossRef]
- Minh, B.Q.; Schmidt, H.A.; Chernomor, O.; Schrempf, D.; Woodhams, M.D.; Von Haeseler, A.; Lanfear, R. IQ-TREE 2: New Models and Efficient Methods for Phylogenetic Inference in the Genomic Era. Mol. Biol. Evol. 2020, 37, 1530–1534. [Google Scholar] [CrossRef]
- Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian Phylogenetic Inference and Model Choice Across a Large Model Space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef]
- Rambant, A. FigTree v1.4.4: Tree Figure Drawing Tool. Available online: http://tree.bio.ed.ac.uk/software/figtree/ (accessed on 25 November 2018).
- Satoh, T.P.; Miya, M.; Mabuchi, K.; Nishida, M. Structure and variation of the mitochondrial genome of fishes. BMC Genom. 2016, 17, 719. [Google Scholar] [CrossRef]
- Zhang, R.; Zhu, T.; Li, H.; Deng, L. The Mitochondrial Genome of Linichthys laticeps (Cypriniformes: Cyprinidae): Characterization and Phylogeny. Genes 2023, 14, 1938. [Google Scholar] [CrossRef]
- Zhang, R.; Zhu, T.; Yu, F. The New Mitochondrial Genome of Hemiculterella wui (Cypriniformes, Xenocyprididae): Sequence, Structure, and Phylogenetic Analyses. Genes 2023, 14, 2110. [Google Scholar] [CrossRef]
- Chrzanowska-Lightowlers, Z.M.; Lightowlers, R.N. Mitochondrial RNA maturation. RNA Biol. 2024, 21, 28–39. [Google Scholar] [CrossRef] [PubMed]
- Zhou, L.; Huang, S.; Wang, Q.; Li, Z.; Li, Z.; He, A.; Chen, J.; Liu, L.; Zou, K. Novel evolutionary insights into nemacheilid cavefish: Evidence from comparative analysis of mitochondrial genomes. J. Oceanol. Limnol. 2022, 40, 1640–1653. [Google Scholar] [CrossRef]
- Maduna, S.N.; Vivian-Smith, A.; Jónsdóttir, D.B.; Imsland, A.K.; Klütsch, C.F.; Nyman, T.; Eiken, H.G.; Hagen, S.B. Mitogenomics of the suborder Cottoidei (Teleostei: Perciformes): Improved assemblies, mitogenome features, phylogeny, and ecological implications. Genomics 2022, 114, 110297. [Google Scholar] [CrossRef] [PubMed]
- Luo, Q.; Zhang, R. The complete mitochondrial genome and phylogenetic analysis of Sinocyclocheilus angularis (Cypriniformes: Cyprinidae). Mitochondrial DNA Part B 2021, 6, 3438–3439. [Google Scholar] [CrossRef]
- Zhang, X.; Yue, B.; Jiang, W.; Song, Z. The complete mitochondrial genome of rock carp Procypris rabaudi (Cypriniformes: Cyprinidae) and phylogenetic implications. Mol. Biol. Rep. 2009, 36, 981–991. [Google Scholar] [CrossRef]
- Feng, Y.; Li, Q.; Yu, H.; Kong, L. Complete mitochondrial genome sequence of Cucullaea labiata (Arcoida: Cucullaeidae) and phylogenetic implications. Genes Genom. 2017, 39, 867–875. [Google Scholar] [CrossRef]
- Hurst, L.D. The Ka/Ks ratio: Diagnosing the form of sequence evolution. Trends Genet. 2002, 18, 486–487. [Google Scholar] [CrossRef]
- Gong, J.; Chen, B.; Li, B.; Zhou, Z.; Shi, Y.; Ke, Q.; Zhang, D.; Xu, P. Genetic analysis of whole mitochondrial genome of Lateolabrax maculatus (Perciformes: Moronidae) indicates the presence of two populations along the Chinese coast. Zoologia 2020, 37, e49046. [Google Scholar] [CrossRef]
- Peery, M.Z.; Kirby, R.; Reid, B.N.; Stoelting, R.; Doucet-Bëer, E.; Robinson, S.; Vásquez-Carrillo, C.; Pauli, J.N.; Palsbøll, P.J. Reliability of genetic bottleneck tests for detecting recent population declines. Mol. Ecol. 2012, 21, 3403–3418. [Google Scholar] [CrossRef]
- Xu, D.; Lou, B.; Shi, H.; Geng, Z.; Li, S.; Zhang, Y. Genetic diversity and population structure of Nibea albiflora in the China Sea revealed by mitochondrial COI sequences. Biochem. Syst. Ecol. 2012, 45, 158–165. [Google Scholar] [CrossRef]
- Städele, V.; Vigilant, L. Strategies for determining kinship in wild populations using genetic data. Ecol. Evol. 2016, 6, 6107–6120. [Google Scholar] [CrossRef] [PubMed]
- Jo, T.; Takao, K.; Minamoto, T. Linking the state of environmental DNA to its application for biomonitoring and stock assessment: Targeting mitochondrial/nuclear genes, and different DNA fragment lengths and particle sizes. Environ. DNA 2022, 4, 271–283. [Google Scholar] [CrossRef]
- Andújar, C.; Arribas, P.; Yu, D.W.; Vogler, A.P.; Emerson, B.C. Why the COI barcode should be the community DNA metabarcode for the metazoa. Mol. Ecol. 2018, 27, 3968–3975. [Google Scholar] [CrossRef] [PubMed]







| Primer Name | Primer Sequences (5′-3′) | Annealing Temperature |
|---|---|---|
| LL-F1 | ACATGCAAGTCTCCGCAACC | 57.9 °C |
| LL-R1 | TTGGCTTACACTTGTGCTTGGA | |
| LL-F2 | CAGCCACCTAAACAGAAAGCG | 55.8 °C |
| LL-R2 | GGGCGATGTTAAATGTTTGTAG | |
| LL-F3 | TCCTATTTATCCTAGCCCTGTC | 52.8 °C |
| LL-R3 | AATCCTGTGAGTGGTGGTAGG | |
| LL-F4 | CGCAGCATTCCTAACCCTAA | 54.4 °C |
| LL-R4 | GGATGTAAAGTATGCACGAGTGT | |
| LL-F5 | CACCACATTCTTCGACCCG | 56.2 °C |
| LL-R5 | TCCTAGCGAGGCGTCTTCTAG | |
| LL-F6 | CGACTAAATCAAACCGCCTTCA | 58.2 °C |
| LL-R6 | CTTGTTTGCGTTCTCCTTCCA | |
| LL-F7 | CCAACACCAGAATTAGGAGGAT | 54.6 °C |
| LL-R7 | CATTGAGTCGTTCGGTTTGAT | |
| LL-F8 | ATACATCTCACTCCTTGCCTCA | 51.4 °C |
| LL-R8 | TTATGGCTACTAGGAATGTGAG | |
| LL-F9 | CTGACAATGAATAAACACCCAAAC | 55.5 °C |
| LL-R9 | TCGTGCGGTTTAGAGGAGG | |
| LL-F10 | ATCAGCCGCCACCCAACT | 58.1 °C |
| LL-R10 | TTGGGATTGATCGTAGGATTGC | |
| LL-F11 | TTTCCACCCATACTTCTCATA | 49.9 °C |
| LL-R11 | AGCGGTTTGGTGATAATACA | |
| LL-F12 | CTCCCTAGCGCCCAGAAA | 54.9 °C |
| LL-F12 | AGGGTTTCGGGCACCTAG |
| Genus | Species | Length (bp) | GenBank Accession Number |
|---|---|---|---|
| Elopichthys | Elopichthys bambusa | 16,619 | KM196112 |
| Luciocyprinus | L. langsoni | 16,586 | MZ921933 (this study) |
| L. striolatus | 16,601 | AP012525 | |
| Cyprinus | Cyprinus multitaeniata | 16,573 | KU373073 |
| Cyprinus carpio carpio | 16,581 | JN105352 | |
| Cyprinus acutidorsalis | 16,580 | KR869144 | |
| Cyprinus megalophthalmus | 16,580 | KR869143 | |
| Procypris | Procypris rabaudi | 16,595 | EU082030 |
| Carassioides | Carassioides acuminatus | 16,579 | KX602324 |
| Carassius | Carassius auratus | 16,576 | KJ874431 |
| C. auratus auratus | 16,580 | JN105355 | |
| C. auratus grandoculis | 16,579 | AP011239 | |
| Labeo | Labeo bata | 16,605 | AP011198 |
| Labeo boggut | 16,603 | AP013338 | |
| Labeo fimbriatus | 16,614 | KP025676 | |
| Labeo gonius | 16,614 | KT001152 | |
| Poropuntius | Poropuntius bantamensis | 16,594 | AP011352 |
| Poropuntius normani | 16,592 | AP011320 | |
| Cyclocheilichthys | Cyclocheilichthys janthochir | 16,580 | AP011185 |
| Cyclocheilichthys enoplos | 16,579 | JQ700301 | |
| Onychonstoma | Onychostoma barbatum | 16,592 | NC_019630 |
| Onychostoma gerlachi | 16,601 | NC_026549 | |
| Onychostoma lepturum | 16,601 | NC_054158 | |
| Onychostoma macrolepis | 16,595 | NC_023799 | |
| Spinibarbus | Spinibarbus sinensis | 16,591 | KC579368 |
| Spinibarbus denticulatus | 16,549 | NC_021616 | |
| Spinibarbus hollandi | 16,521 | NC_026129 | |
| Acrossocheilus | Acrossocheilus kreyenbergii | 16,596 | KY094969 |
| Acrossocheilus parallens | 16,592 | NC_026973 | |
| Acrossocheilus wenchowensis | 16,591 | NC_020145 | |
| Tor | Tor douronensis | 16,586 | KJ880045 |
| Tor khudree | 16,576 | KX950700 | |
| Tor sinensis | 16,579 | NC_022702 | |
| Tor tambra | 16,581 | KJ880044 | |
| Sinocyclocheilus | Sinocyclocheilus angularis | 16,586 | MW362289 |
| Sinocyclocheilus grahami | 16,585 | NC_013189 | |
| Sinocyclocheilus longibarbatus | 16,787 | NC_056194 | |
| Sinocyclocheilus tingi | 16,584 | NC_039594 | |
| Sinocyclocheilus yishanensis | 16,573 | MK387704 | |
| Percocypris | Percocypris pingi | 16,586 | NC_018601 |
| Percocypris tchangi retrodorslis | 16,576 | MT527960 | |
| Hypsibarbus | Hypsibarbus vernayi | 16,590 | NC_031621 |
| Puntius | Puntius semifasciolatus | 16,594 | NC_020096 |
| Puntius ticto | 17,302 | NC_008658 | |
| Mystacoleucus | Mystacoleucus marginatus | 16,611 | NC_023106 |
| Scaphiodonichthys | Scaphiodonichthys acanthopterus | 16,612 | NC_018789 |
| Sinogastromyzon | S. szechuanensis | 16,565 | MN241814 |
| Myxocyprinus | M. asiaticus | 16,636 | AY526869 |
| Name | Strand | Location | Size (bp) | Intergenic Length | Anti-Codon | Start Codon | Stop Codon |
|---|---|---|---|---|---|---|---|
| tRNAPhe | H | 1–69 | 69 | 0 | GAA | - | - |
| 12S rRNA | H | 70–1024 | 955 | 2 | - | - | - |
| tRNAVal | H | 1027–1098 | 72 | 18 | TAC | - | - |
| 16S rRNA | H | 1117–2757 | 1641 | 25 | - | - | - |
| tRNALeu2 | H | 2783–2858 | 76 | 1 | TAA | - | - |
| nad1 | H | 2860–3834 | 975 | 4 | - | ATG | TAA |
| tRNAIle | H | 3839–3910 | 72 | −2 | GAT | - | - |
| tRNAGln | L | 3909–3979 | 71 | 1 | TTG | - | - |
| tRNAMet | H | 3981–4049 | 69 | 0 | CAT | - | - |
| nad2 | H | 4050–5096 | 1047 | −2 | - | ATG | TAG |
| tRNATrp | H | 5095–5165 | 71 | 2 | TCA | - | - |
| tRNAAla | L | 5168–5236 | 69 | 1 | TGC | - | - |
| tRNAAsn | L | 5238–5310 | 73 | 2 | GTT | - | - |
| OL | H | 5313–5344 | 32 | −1 | - | - | - |
| tRNACys | L | 5344–5410 | 67 | −1 | GCA | - | - |
| tRNATyr | L | 5410–5480 | 71 | 1 | GTA | - | - |
| cox1 | H | 5482–7032 | 1551 | 0 | - | GTG | TAA |
| tRNASer2 | L | 7033–7103 | 71 | 3 | TGA | - | - |
| tRNAAsp | H | 7107–7178 | 72 | 13 | GTC | - | - |
| cox2 | H | 7192–7882 | 691 | 0 | - | ATG | T(AA) |
| tRNALys | H | 7883–7958 | 76 | 1 | TTT | - | - |
| atp8 | H | 7960–8124 | 165 | −7 | - | ATG | TAG |
| atp6 | H | 8118–8801 | 684 | −1 | - | ATG | TAA |
| cox3 | H | 8801–9586 | 786 | −1 | - | ATG | TAA |
| tRNAGly | H | 9586–9657 | 72 | 0 | TCC | - | - |
| nad3 | H | 9658–10,008 | 351 | −2 | - | ATG | TAG |
| tRNAArg | H | 10,007–10,077 | 71 | 0 | TCG | - | - |
| nad4l | H | 10,078–10,374 | 297 | −7 | - | ATG | TAA |
| nad4 | H | 10,368–11,748 | 1381 | 0 | - | ATG | T(AA) |
| tRNAHis | H | 11,749–11,817 | 69 | 0 | GTG | - | - |
| tRNASer1 | H | 11,818–11,886 | 69 | 1 | GCT | - | - |
| tRNALeu1 | H | 11,888–11,960 | 73 | 3 | TAG | - | - |
| nad5 | H | 11,964–13,787 | 1824 | −4 | - | ATG | TAA |
| nad6 | L | 13,784–14,305 | 522 | 0 | - | ATG | TAG |
| tRNAGlu | L | 14,306–14,374 | 69 | 5 | TTC | - | - |
| cob | H | 14,380–15,520 | 1141 | 0 | - | ATG | T(AA) |
| tRNAThr | H | 15,521–15,593 | 73 | −1 | TGT | - | - |
| tRNAPro | L | 15,593–15,662 | 70 | 18 | TGG | - | - |
| OH | H | 15,681–16,487 | 807 | 99 | - | - | - |
| Location | Size (bp) | A | T | G | C | A + T | G + C | A + T Skew | G + C Skew |
|---|---|---|---|---|---|---|---|---|---|
| Genome | 16,586 | 32.04 | 24.13 | 15.94 | 27.88 | 56.17 | 43.83 | 0.1407 | −0.2725 |
| PCGs | 11,382 | 29.85 | 26.03 | 15.45 | 28.66 | 55.89 | 44.11 | 0.0684 | −0.2993 |
| 1st codon position | 3794 | 27.10 | 20.85 | 25.75 | 26.30 | 47.94 | 52.06 | 0.1303 | −0.0106 |
| 2nd codon position | 3794 | 18.37 | 40.43 | 13.63 | 27.57 | 58.80 | 41.20 | −0.3752 | −0.3385 |
| 3rd codon position | 3794 | 44.10 | 16.82 | 6.98 | 32.10 | 60.91 | 39.09 | 0.4479 | −0.6426 |
| rRNA | 2596 | 35.09 | 19.30 | 20.57 | 25.04 | 54.39 | 45.61 | 0.2904 | −0.0980 |
| tRNA | 1565 | 28.31 | 26.13 | 23.77 | 21.79 | 54.44 | 45.56 | 0.0399 | 0.0435 |
| control region | 807 | 35.19 | 33.33 | 13.63 | 17.84 | 68.53 | 31.47 | 0.0271 | −0.1339 |
| Amino Acid | Codon | Count | RSCU | Amino Acid | Codon | Count | RSCU |
|---|---|---|---|---|---|---|---|
| Phe | UUU | 75 | 0.66 | Tyr | UAU | 36 | 0.63 |
| Phe | UUC | 151 | 1.34 | Tyr | UAC | 78 | 1.37 |
| Leu | UUA | 105 | 1 | stop codon | UAA | 6 | 2.4 |
| Leu | UUG | 14 | 0.13 | stop codon | UAG | 4 | 1.6 |
| Leu | CUU | 77 | 0.74 | His | CAU | 25 | 0.48 |
| Leu | CUC | 90 | 0.86 | His | CAC | 79 | 1.52 |
| Leu | CUA | 297 | 2.84 | Gln | CAA | 97 | 1.92 |
| Leu | CUG | 44 | 0.42 | Gln | CAG | 4 | 0.08 |
| Ile | AUU | 145 | 1.01 | Asn | AAU | 31 | 0.5 |
| Ile | AUC | 143 | 0.99 | Asn | AAC | 92 | 1.5 |
| Met | AUA | 124 | 1.47 | Lys | AAA | 74 | 1.92 |
| Met | AUG | 45 | 0.53 | Lys | AAG | 3 | 0.08 |
| Val | GUU | 48 | 0.86 | Asp | GAU | 20 | 0.53 |
| Val | GUC | 43 | 0.77 | Asp | GAC | 55 | 1.47 |
| Val | GUA | 106 | 1.89 | Glu | GAA | 87 | 1.69 |
| Val | GUG | 27 | 0.48 | Glu | GAG | 16 | 0.31 |
| Ser | UCU | 38 | 0.97 | Cys | UGU | 5 | 0.4 |
| Ser | UCC | 51 | 1.3 | Cys | UGC | 20 | 1.6 |
| Ser | UCA | 90 | 2.3 | Trp | UGA | 106 | 1.77 |
| Ser | UCG | 8 | 0.2 | Trp | UGG | 14 | 0.23 |
| Pro | CCU | 19 | 0.36 | Arg | CGU | 10 | 0.53 |
| Pro | CCC | 47 | 0.9 | Arg | CGC | 13 | 0.68 |
| Pro | CCA | 132 | 2.53 | Arg | CGA | 49 | 2.58 |
| Pro | CCG | 11 | 0.21 | Arg | CGG | 4 | 0.21 |
| Thr | ACU | 35 | 0.43 | Ser | AGU | 5 | 0.13 |
| Thr | ACC | 118 | 1.46 | Ser | AGC | 43 | 1.1 |
| Thr | ACA | 162 | 2.01 | stop codon | AGA | 0 | 0 |
| Thr | ACG | 8 | 0.1 | stop codon | AGG | 0 | 0 |
| Ala | GCU | 47 | 0.57 | Gly | GGU | 22 | 0.35 |
| Ala | GCC | 145 | 1.77 | Gly | GGC | 50 | 0.81 |
| Ala | GCA | 123 | 1.5 | Gly | GGA | 121 | 1.95 |
| Ala | GCG | 12 | 0.15 | Gly | GGG | 55 | 0.89 |
| Population | Number of Haplotypes | Haplotype (Gene) Diversity | Average Number of Nucleotide Difference | Nucleotide Diversity | Tajima’s D |
|---|---|---|---|---|---|
| Hechi Longjiang | 2 | 0.497 | 0.497 | 0.0003 | 1.5078 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, T.; Tan, C.; Zhao, L.; Hu, Z.; Su, C.; Li, F.; Ma, Y.; Zhang, W.; Hao, X.; Zou, W.; et al. The Complete Mitochondrial Genome of the Luciocyprinus langsoni (Cypriniformes: Cyprinidae): Characterization, Phylogeny, and Genetic Diversity Analysis. Genes 2024, 15, 1621. https://doi.org/10.3390/genes15121621
Yang T, Tan C, Zhao L, Hu Z, Su C, Li F, Ma Y, Zhang W, Hao X, Zou W, et al. The Complete Mitochondrial Genome of the Luciocyprinus langsoni (Cypriniformes: Cyprinidae): Characterization, Phylogeny, and Genetic Diversity Analysis. Genes. 2024; 15(12):1621. https://doi.org/10.3390/genes15121621
Chicago/Turabian StyleYang, Tiezhu, Chenxi Tan, Liangjie Zhao, Zhiguo Hu, Chaoqun Su, Fan Li, Yuanye Ma, Wenchao Zhang, Xiaoyu Hao, Wenxu Zou, and et al. 2024. "The Complete Mitochondrial Genome of the Luciocyprinus langsoni (Cypriniformes: Cyprinidae): Characterization, Phylogeny, and Genetic Diversity Analysis" Genes 15, no. 12: 1621. https://doi.org/10.3390/genes15121621
APA StyleYang, T., Tan, C., Zhao, L., Hu, Z., Su, C., Li, F., Ma, Y., Zhang, W., Hao, X., Zou, W., Kang, J., & He, Q. (2024). The Complete Mitochondrial Genome of the Luciocyprinus langsoni (Cypriniformes: Cyprinidae): Characterization, Phylogeny, and Genetic Diversity Analysis. Genes, 15(12), 1621. https://doi.org/10.3390/genes15121621

