Next Article in Journal
Multiplex Detection of SNPs for Genetic Monitoring in Laboratory Mice by Luminex xTAG Assay
Previous Article in Journal
Long Non-Coding RNAs as Diagnostic Biomarkers for Ischemic Stroke: A Systematic Review and Meta-Analysis
Previous Article in Special Issue
Mechanistic Role of TRIM26 in Viral Infection and Host Defense
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Complete Mitochondrial Genome of the Luciocyprinus langsoni (Cypriniformes: Cyprinidae): Characterization, Phylogeny, and Genetic Diversity Analysis

1
School of Fisheries, Xinyang Agriculture and Forestry University, Xinyang 464000, China
2
Fishery Biological Engineering Technology Research Center of Henan Province, Xinyang 464000, China
3
Shanghai Natural History Museum, Branch of Shanghai Science and Technology Museum, Shanghai 200041, China
4
Xinyang Nanwan Reservoir Fishery Development Co., Ltd., Xinyang 464000, China
*
Authors to whom correspondence should be addressed.
Genes 2024, 15(12), 1621; https://doi.org/10.3390/genes15121621
Submission received: 10 November 2024 / Revised: 9 December 2024 / Accepted: 17 December 2024 / Published: 18 December 2024
(This article belongs to the Special Issue Advances in Genes and Genomics of Aquatic Animals and Pathogens)

Abstract

Background: Luciocyprinus langsoni is a species belonging to the Cyprinidae family. The objective of this study is to gain a comprehensive understanding of its evolutionary history and genetic characteristics. Methods: The complete mitochondrial genome of L. langsoni was determined using overlapping PCR. A phylogenetic analysis was conducted based on 13 protein-coding genes from 48 species. A population genetic diversity analysis using the COI gene and a selection analysis of 13 protein-coding genes were also performed. Results: The mitogenome is 16,586 base pairs long and consists of 13 protein-coding genes, two ribosomal RNAs, 22 transfer RNAs, and two control regions. It has a high adenine-thymine (A + T) content. The phylogenetic analysis confirms the placement of L. langsoni within the subfamily Cyprininae. The population genetic diversity analysis reveals low variability in the Hechi Longjiang population. The selection analysis shows that all 13 protein-coding genes have evolved under purifying selection with Ka/Ks ratios below 1. Conclusions: These results enhance our understanding of L. langsoni’s evolutionary history and lay a genetic foundation for future studies in population genetics and phylogenetics.

1. Introduction

The mitochondrial genome (mitogenome) serves as a critical molecular marker in evolutionary and population genetics, characterized by unique properties distinct from nuclear DNA [1,2]. This fish mitogenome features a compact, circular structure, typically 15,000 to 18,000 base pairs long, composed of heavy and light strands, with transcription primarily on the heavy strand [3,4]. It encodes for a suite of essential genetic elements, including 13 protein-coding genes (PCGs), two ribosomal RNA genes (12S rRNA and 16S rRNA), 22 transfer RNA genes (tRNAs), and a control region that contains regulatory elements vital for transcription and replication [4]. Being capable of adopting a conserved secondary structure, the control region encompasses the origins of replication and transcription, thus highlighting its vital role in maintaining mitochondrial DNA (mtDNA) [5]. Mitochondrial DNA is distinguished by its matrilineal inheritance, rapid evolutionary pace, and minimal intermolecular recombination, making it an effective tool for delineating population genetic characteristics and conducting phylogenetic analyses [6]. Although mtDNA fails to capture the genetic information of the male population [7,8], its conservation in amino acid coding, coupled with other attributes, has established its utility in molecular evolution, phylogenetics, and comparative genomics [9]. Furthermore, the mitogenome’s tRNA molecular structure, gene arrangement, and models of replication-transcription control have been pivotal in facilitating deep-level phylogenetic inferences within taxonomy [10]. The sequencing and annotation of numerous fish mitogenomes have significantly broadened our comprehension of their phylogeny, biogeography, and population genetic structure [4]. Given the mitogenome’s simplicity, small size, and high copy number, it remains an indispensable resource in molecular biology and genetic research [3].
The genus Luciocyprinus, despite its morphological and behavioral similarities to the genus Elopichthys, is taxonomically distinct. The subfamily affiliation of Luciocyprinus has been a subject of debate. In 1933, Lin classified it into the subfamily Gobioninae based on the characteristic of having two rows of pharyngeal teeth [11]. Studies on skeletal structure by Wu (1977) and Chen (1984) led to its classification into the subfamily Barbinae [12,13]. However, Lei (2015), based on phylogenetic and polyploidy research, assigned Luciocyprinus to the subfamily Cyprininae [14,15]. Despite these classifications, some scholars still advocate for its placement within the subfamily Barbinae based on morphological considerations. The genus Luciocyprinus includes two reported species: L. langsoni (Vaillant, 1904) and Luciocyprinus striolatus (Cui and Chu, 1986) [16]. Due to extensive habitat destruction caused by industrial development and overfishing, the populations of both species have sharply declined, with local extinctions occurring in some areas [17]. Both species were rated as Vulnerable (VU) by the IUCN in 2012 [18] and listed as second-class protected animals in the 2021 “National Key Protected Wildlife List” [19]. L. langsoni is a predatory fish inhabiting the upper-middle water layers, recognized for its strong swimming ability and proactive hunting behavior. It typically resides in rivers and lakes with certain water flow speeds, while juveniles under 16 cm in length prefer slower-flowing bays or still waters. This species is primarily distributed in the Xijiang River system within the Pearl River basin. Given its delicious flesh, large size, and rapid growth, L. langsoni holds significant economic value if artificial breeding can be successfully achieved.
In this study, we sequenced, assembled, and characterized the complete mitochondrial genome of L. langsoni, examining its size, structure, organization, nucleotide composition, codon usage, tRNA molecular structures, and evolutionary rates. We also assessed the population genetic diversity of L. langsoni using the COI gene, which is essential for elucidating genetic variation among and within populations. Integrating our data with NCBI database information, we delineated the phylogenetic position of L. langsoni within the genus Luciocyprinus and subfamily Cyprininae, utilizing 13 PCGs. Our results establish a foundational dataset for future phylogenetic and taxonomic research on Luciocyprinus, illuminating the mitochondrial genome features and evolutionary relationships of this species.

2. Materials and Methods

2.1. Sample Collection, DNA Isolation, PCR Amplification, and Sequencing

Adult specimens of L. langsoni were collected from the Longjiang River, Hechi City, Guangxi Province, China (24°30′ N, 108°37′ E). Our procedures followed international guidelines for laboratory animal care and treatment. Collected samples were preserved in 100% ethanol and stored at −80 °C until DNA extraction (voucher number: XYAFU-Mo-s190511630). Total DNA was extracted from muscle tissue using the Magnetic Animal Tissue Genomic DNA Kit (Tiangen Biotech Co., Beijing, China). DNA quality was assessed by 1.5% agarose gel electrophoresis, and the DNA was kept at −20 °C until PCR amplification of the entire mitogenomes. The complete mitochondrial genome of L. striolatus (GenBank accession number: AP012525) was used as a template for primer design. A total of 12 pairs of primers were designed based on their conserved regions for amplification by overlapping PCR (Table 1). The PCR amplification experiment was carried out using the LA Taq DNA polymerase reagent (Takara, Beijing, China) in a 50-microliter system. The system contents include 25 microliters of 2 × LA Taq Premix buffer, 2 microliters of template DNA, 1.5 microliters each of upstream and downstream primers (10 nM), and 20 microliters of deionized water. The PCR amplification program was set as follows: initial denaturation of DNA at 94 °C for 3 min, followed by 35 cycles of denaturation at 94 °C for 30 s, annealing at 49.9–58.2 °C (Table 1) for 30 s, and extension at 72 °C for 2 min. Finally, there is a long extension at 72 °C for 10 min to end the program. Amplified PCR products were verified on 1% agarose gels, and their sizes were estimated against a DNA Marker S (100–5000 bp) (Sangon Biotech, Shanghai, China). The PCR products were subjected to bidirectional sequencing using the same primers on a 3730xl DNA analyzer (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA) at Sangon Biotech, Shanghai, China, achieving 100% coverage of the amplified regions [20].

2.2. Sequence Assembly, Annotation, and Bioinformatics Analysis

The sequencing results of 12 amplified fragments were assembled into a circular sequence by using the SeqMan software (v 7.1.0) in the DNA STAR package (DNAStar Inc., Madison, WI, USA). The mitochondrial genome sequence annotation was performed automatically with the Galaxy Web Server’s MITOS2 de novo annotation tool [21]. tRNA genes were identified and annotated using the tRNAscan-SE 2.0 search server [22]. The base composition and codon usage of the mitochondrial genome of L. langsoni were analyzed using MEGA 11.0 software [23], while the relative synonymous codon usage (RSCU) for each protein-coding gene (PCG) was analyzed using CodonW 1.4.2 [24]. The A + T skew value was calculated using the formula A + T skew = (A% − T%)/(A% + T%), and the G + C skews was obtained by calculation using formula G + C skew = (G% − C%)/(G% + C%), respectively [25]. KaKs Calculator 3.0 [26] was employed to determine the substitution rates, including Ka (nonsynonymous substitution rate) and Ks (synonymous substitution rate), among closely related species.

2.3. Phylogenetic Analyses

A phylogenetic analysis encompassing 48 Cyprinidae species across 18 genera was conducted. AliView 1.2.6 software [27] facilitated the alignment of amino acid sequences derived from 13 PCGs. Mitogenome sequences for these 48 species were sourced from GenBank (Table 2). Sinogastromyzon szechuanensis (Fang, 1930) and Myxocyprinus asiaticus (Bleeker, 1864) were designated as outgroups [28]. PartitionFinder 2.1.1 identified the most suitable evolutionary models for our analysis [29]. After arranging and splicing the nucleotide sequences of 13 PCGs in a specific order, the maximum likelihood method (ML) and Bayesian inference method (BI) were used, respectively, to analyze the phylogenetic relationships. The ML tree was generated with IQ-TREE v. 2.3.6 [30], employing 1000 bootstrap replicates. MrBayes v. 3.2.7a [31] executed the BI analysis, with four Markov chain Monte Carlo (MCMC) chains running for 2 million generations, sampling every 1000. A burn-in of 25% was applied to the initial sampled data. FigTree v1.4.4 [32] was utilized for the generation and visualization of phylogenetic trees.

2.4. Population Genetic Diversity Analysis

In this research, we procured DNA samples from 30 adult specimens of L. langsoni and stored them. For assessing population genetic diversity, we finally selected the COI gene located on the mitochondrial genome of L. langsoni. We designed specific primers for COI gene amplification: LL-COI-F (5′-CCAGCGAGCATTCATCTACT-3′) and LL-COI-R (5′-AACCTGCGATTTCACCTTG-3′), aimed at amplifying an 1800 bp fragment. Subsequent bidirectional sequencing of the PCR products was performed by Shanghai Sangon Biotech, and the sequences were assembled using DNAstar software (v 7.1.0). The analysis of genetic diversity was then carried out using SeqMan software (v 7.1.0, DNAStar Inc., Madison, WI, USA).

3. Results and Discussion

3.1. Mitogenome Genome Organization of L. langsoni

The mitochondrial genome of L. langsoni (16,586 bp) was sequenced and annotated in this study, accessible under GenBank Accession No. MZ921933. It is nearly identical in size to that of L. striolatus (16,601 bp). This genome is composed of 13 PCGs, two rRNAs, 22 tRNAs, and two control regions (OH, OL), as depicted in Figure 1 and detailed in Table 3. A minority of genes, including tRNAGln, tRNAAla, tRNAAsn, tRNACys, tRNATyr, tRNASer2, tRNAGlu, tRNAPro, and nad6, are encoded on the light strand, with the remainder on the heavy strand. The gene composition and order in L. langsoni are consistent with those typically found in fish mitochondrial genomes [33].
The L. langsoni mitochondrial genome features 13 intergenic spacers, ranging from 1 bp to 99 bp in length (Table 3). The longest spacer is situated between OH and tRNAPhe (99 bp). There are 11 gene overlaps within the genome, with the smallest being 1 bp between OL and tRNACys, tRNACys and tRNATyr, atp6 and cox3, cox3 and tRNAArg, and tRNAThr and tRNAPro and the largest being 7 bp between atp8 and atp6 and nad4l and nad4. These gene overlaps and spacers are common among most Cyprininae fish species.
The nucleic acid composition information of the mitochondrial genome of L. langsoni is 32.04% A, 24.13% T, 27.88% C, and 15.94% G, exhibiting a gentle AT bias (56.17%) as detailed in Table 4. This composition is similar to other Cyprininae fish species. In the non-coding control region sequence, there is the highest A + T content (68.53%), while the lowest is in the first codon position of PCGs (47.94%). The AT skew is positive (0.1407) and the GC skew is negative (−0.2725) in L. langsoni, indicating a preference for A and C bases over T and G. Additionally, this study compared the AT and GC skew values of 13 PCGs between two species of Luciocyprinus. As shown in Figure 2, the AT skew values are positive for all genes except cox1 and nad6, suggesting an excess of A over T. The greatest difference between the two species is observed in the GC skew of the cox2 gene, with L. langsoni showing a positive value and L. striolatus showing a negative one.

3.2. Protein-Coding Genes and Codon Usage

The cumulative nucleotide length of the 13 PCGs in L. langsoni is 11,382 bp. Most PCGs initiate with the standard ATN start codon, with the exception of the cox1 gene, which begins with GTG, a recognized canonical mitochondrial start codon for teleosts [20,34,35]. Termination codons in these PCGs predominantly consist of TAA and TAG. Specifically, nad2, atp8, nad3, and nad6 conclude with TAG, while nad1, cox1, atp6, cox3, nad4l, and nad5 end with TAA; the leftover genes, cox2, nad4, and cob, utilize the incomplete T- as their stop codon. This incomplete stop codon, common in metazoan mitogenomes, is hypothesized to be completed through post-transcriptional polyadenylation [36].
Codon usage has important applications in fields such as gene expression optimization, genetic engineering, evolutionary research, bioinformatics, and vaccine design [37]. The summary of the RSCU values of protein-coding sequences in the mitochondrial genome of L. langsoni and L. striolatus is shown in Figure 3. A grand sum of 3804 triplet codons was used in the 13 PCGs (Table 5). As depicted in Figure 4, the most frequently used amino acids in both L. langsoni and L. striolatus are Leu, followed by Ala, Thr, Ile, and Gly, with Cys being the least common. In L. langsoni, the most common codon is CUA, followed by ACA, UUC, AUU, and GCC, while the least frequent codon, excluding stop codons, is AAG.

3.3. Ribosomal and Transfer RNA Genes

In the L. langsoni mitogenome, the ribosomal RNA genes, essential for ribosome structure and protein synthesis, include the small (12S) and large (16S) rRNA genes. These genes, measuring 955 bp and 1641 bp, respectively, are encoded on the heavy strand and situated adjacent to each other, with the 12S rRNA gene positioned between tRNAPhe and tRNAVal and the 16S rRNA gene positioned between tRNAVal and tRNALeu2 (Table 3). The A + T content of these rRNA genes is 54.39%, and their concatenated sequence shows a positive A + T skew of 0.2904 and a negative G + C skew of −0.0980, indicating a compositional bias towards A and T nucleotides over G and C (Table 4).
In this study, we analyzed and compared the secondary structures of the transfer RNA (tRNA) genes of two species within the genus Luciocyprinus, L. langsoni and L. striolatus. Figure 5 illustrates the secondary structures of the 22 tRNA genes, which varied in size from 67 bp (tRNACys) to 76 bp (tRNALeu2 and tRNALys). We observed that only tRNASer1 lacked the dihydrouridine (DHU) arm in both species, while the rest formed the typical cloverleaf secondary structure, a feature commonly absent in many fish species [38]. These tRNA genes are distributed across the mitogenome and exhibit a high A + T bias of 54.44%, with a positive A + T skew of 0.0399 and a positive G + C skew of 0.0435 (Table 4). The mitogenome of L. langsoni comprises 22 tRNA genes (two for Ser and Leu and one for each of the other amino acids), accounting for 9.4% (1565 bp) of the total genome length. Of these, 15 tRNA genes are encoded on the H strand and 7 are encoded on the L strand (Table 3), a pattern consistent with other Cyprininae species [39,40].

3.4. Selection Analysis

To elucidate the evolutionary dynamics of the 13 PCGs and discern the impact of selective pressures, we determined the Ka, Ks, and Ka/Ks (ω) ratios for each gene (Figure 6). The cox1 gene exhibited the lowest Ka value of 0.0046, while the atp8 gene displayed the highest at 0.0584. This is in stark contrast to the analysis results of L. laticeps, where the nad4l gene had the lowest value at 0.486 and the nad3 gene had the highest at 0.78. Conversely, atp8 had the lowest Ks value of 0.3390, and nad3 possessed the highest at 0.6203, which is also greatly different from the results of L. laticeps [34]. The mean ω was 0.0409, ranging from 0.0084 for cox1 to 0.1722 for atp8. Although there are differences in values, the genes with the maximum and minimum ω values are consistent with those of L. laticeps and Hemiculterella wui [35]. However, different species may show different results. For example, in Triplophysa labiate [41], the gene with the smallest ω value is cox2, and in Onychostoma ovale [20], the gene with the largest ω value is nad6. In this paper, these findings suggest that the atp8 gene may be under more rapid evolutionary pressure compared to other mitochondrial PCGs. Since all PCGs’ ω values are significantly below one, it indicates that these genes have evolved under purifying selection in L. langsoni [42].

3.5. Phylogenetic Analyses

In this study, we constructed phylogenetic trees utilizing a nucleotide dataset comprising 13 PCGs from 48 species, with Cyanoplax cavema and Nudibranchia californica as outgroups. The optimal models selected by PartitionFinder were MTMAM + I + G + F for nad1, nad2, nad3, nad5, cox2, and atp6; JTT + I + G + F for cox1; MTMAM + G for atp8; MTREV + I + G + F for cox3; MTMAM + G + F for nad4l; MTMAM + I + G for nad4; and HIVB + I + G + F for nad6. The resulting topologies were largely congruent across different analytical methods (Figure 7). L. langsoni and L. striolatus clustered together within the genus Luciocyprinus with posterior probabilities of 1 and bootstrap proportions of 100%. The phylogeny indicates that Luciocyprinus, along with Cyprinus, Carassioides, and Carassius, form a larger clade while being more distantly related to the morphologically similar Elopichthys. Our findings support the taxonomic classification of Luciocyprinus within the subfamily Cyprininae rather than Barbinae [14]. However, due to limited research on Luciocyprinus, further studies are needed to refine its specific taxonomic affiliations.

3.6. Population Genetic Diversity

Genetic diversity underpins a species’ survival, evolution, and adaptability to environmental changes; higher genetic diversity correlates with greater adaptability and evolutionary potential. The COI gene sequence, known for its high genetic polymorphism, has been widely utilized in genetic diversity studies of various fish species [43]. In this study, we obtained the majority of the COI gene sequence from L. langsoni, yielding a total length of 1664 base pairs (bp) after alignment and refinement, with only two distinct haplotypes identified. Within this research, the population of L. langsoni from Hechi Longjiang exhibited a haplotype diversity (Hd) of 0.497 and a nucleotide diversity (π) of 0.0003, indicating low haplotype diversity (Hd < 0.5) and low nucleotide diversity (π < 0.005) (Table 6). These findings suggest that the population may have undergone a genetic bottleneck, implying a significant reduction in population size in the past with few founding individuals, leading to reduced genetic diversity [44]. This is further supported by the positive value of Tajima’s D for the Hechi Longjiang population, indicating a sudden population size reduction followed by a subsequent recovery [45].

4. Conclusions

We successfully determined the mitogenome sequence of L. langsoni through overlapping PCR, which spanned 16,586 bp and encompassed 13 PCGs, 22 tRNA genes, 2 rRNA genes, and two control regions (OH, OL). This gene arrangement and nucleotide composition, with a marked A + T bias, are consistent with those reported in other teleosts. The majority of PCGs initiate with the ATG start codon and terminate with the TAA stop codon. Ka/Ks ratio analysis revealed that all 13 PCGs in L. langsoni have evolved under purifying selection, with ratios all below 1. These findings, along with the phylogenetic trees, support the classification of Luciocyprinus within the subfamily Cyprininae rather than Barbinae. The low genetic diversity observed in the Hechi Longjiang population, based on COI gene analysis, suggests the population may have experienced a genetic bottleneck. This study’s results enhance our understanding of phylogenetic relationships and provide foundational genetic data for future population genetic studies and phylogenetic analysis of L. langsoni and related genera.
Due to its large body size and beautiful morphology, L. langsoni is a species with great aquaculture prospects. The mitochondrial genome obtained in this study, along with the result of low population genetic diversity, can assist in analyzing the kinship between individuals in the formulation of breeding strategies in the aquaculture industry [46]. For example, in the process of selecting the parents of L. langsoni, it is appropriate to choose individuals from different river systems or those with distant kinship. Additionally, some genes in the mitochondrial genome, such as the COI gene, are often used in environmental DNA analysis. For instance, the COI gene is commonly employed as a template for designing environmental DNA amplification primers to identify species diversity in a certain area or the presence of a certain species [47,48]. The mitochondrial genome obtained in this paper can serve as a primer design template, enabling the detection of whether L. langsoni exists in different rivers by using environmental DNA detection technology. It can also be applied to conduct process evaluations for the future stock enhancement and release of L. langsoni and the restoration of its biological community.

Author Contributions

Conceptualization, T.Y., L.Z. and F.L.; Data curation, T.Y., W.Z. (Wenchao Zhang), X.H. and Z.H.; Methodology, T.Y., F.L., Z.H. and C.S.; Project administration, L.Z.; Resources, T.Y., F.L., C.T., Y.M. and L.Z.; Validation, T.Y., L.Z., C.T., Y.M. and F.L.; Software, T.Y., L.Z., W.Z. (Wenchao Zhang), X.H., W.Z. (Wenxu Zou), J.K. and Q.H.; Formal analysis, L.Z., X.H., W.Z. (Wenxu Zou), C.T., Y.M., J.K. and Q.H.; Writing—original draft, T.Y. and L.Z.; Writing—review and editing, T.Y., L.Z. and F.L. Visualization, T.Y., L.Z. and F.L. All authors have read and agreed to the published version of the manuscript.

Funding

The study was funded by the Youth Fund Project of Xinyang Agriculture and Forestry College (No. QN2021020), Natural Science Foundation of Henan (No. 232300421273, No. 242300420175), Key Scientific Research Projects of Colleges and Universities in Henan Province (No. 23B240003, No. 24B240001).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The mitochondrial DNA sequence generated from the sample has been deposited in the GenBank database (https://www.ncbi.nlm.nih.gov, 13 September 2022) with the accession number MZ921933.

Acknowledgments

We appreciate anonymous reviewers for providing valuable comments on this study.

Conflicts of Interest

Author Yuanye Ma was employed by the company Xinyang Nanwan Reservoir Fishery Development Co., Ltd. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Boore, J.L. Animal mitochondrial genomes. Nucleic Acids Res. 1999, 27, 1767–1780. [Google Scholar] [CrossRef] [PubMed]
  2. Moritz, C. Applications of mitochondrial DNA analysis in conservation: A critical review. Mol. Ecol. 1994, 3, 401–411. [Google Scholar] [CrossRef]
  3. Guo, X.H.; Liu, S.J.; Liu, Q.; Liu, Y. New progresses on mitochondrial DNA in fish. Yi Chuan Xue Bao = Acta Genet. Sin. 2004, 31, 983–1000. [Google Scholar] [PubMed]
  4. Brown, K.H. Fish mitochondrial genomics: Sequence, inheritance and functional variation. J. Fish Biol. 2008, 72, 355–374. [Google Scholar] [CrossRef]
  5. Wirgin, I.; Grunwald, C.; Carlson, E.; Stabile, J.; Peterson, D.L.; Waldman, J. Range-wide population structure of shortnose sturgeonAcipenser brevirostrum based on sequence analysis of the mitochondrial DNA control region. Estuaries 2005, 28, 406–421. [Google Scholar] [CrossRef]
  6. Avise, J.C. Phylogeography: The History and Formation of Species. Master’s Thesis, Harvard University Press, Cambridge, MA, USA, 2000. [Google Scholar]
  7. Hurst, G.D.; Jiggins, F.M. Problems with mitochondrial DNA as a marker in population, phylogeographic and phylogenetic studies: The effects of inherited symbionts. Proc. R. Soc. B Biol. Sci. 2005, 272, 1525–1534. [Google Scholar] [CrossRef]
  8. White, D.J.; Wolff, J.N.; Pierson, M.; Gemmell, N.J. Revealing the hidden complexities of mtDNA inheritance. Mol. Ecol. 2008, 17, 4925–4942. [Google Scholar] [CrossRef]
  9. Bernt, M.; Braband, A.; Schierwater, B.; Stadler, P.F. Genetic aspects of mitochondrial genome evolution. Mol. Phylogenetics Evol. 2013, 69, 328–338. [Google Scholar] [CrossRef]
  10. Jühling, F.; Pütz, J.; Bernt, M.; Donath, A.; Middendorf, M.; Florentz, C.; Stadler, P.F. Improved systematic tRNA gene annotation allows new insights into the evolution of mitochondrial tRNA structures and into the mechanisms of mitochondrial genome rearrangements. Nucleic Acids Res. 2012, 40, 2833–2845. [Google Scholar] [CrossRef]
  11. Lin, S. One new fishes from Kweichow province, China. Lingnan Sci. J. 1932, 11, 515–519. [Google Scholar]
  12. Wu, H. Chinese Cyprinidae Fish Genera Monograph: Vol. 2. Master’s Thesis, Shanghai Scientific and Technical Publishers, Shanghai, China, 1977. [Google Scholar]
  13. Chen, X.; Yue, P.; Lin, R. Major groups within the family Cyprinidae and their phylogenetic relationships. Acta Zootaxonomica Sin. 1984, 9, 424–440. [Google Scholar]
  14. Yang, L.; Sado, T.; Hirt, M.V.; Pasco-Viel, E.; Arunachalam, M.; Li, J.; Wang, X.; Freyhof, J.; Saitoh, K.; Simons, A.M.; et al. Phylogeny and polyploidy: Resolving the classification of cyprinine fishes (Teleostei: Cypriniformes). Mol. Phylogenetics Evol. 2015, 85, 97–116. [Google Scholar] [CrossRef] [PubMed]
  15. Tan, M.; Armbruster, J.W. Phylogenetic classification of extant genera of fishes of the order Cypriniformes (Teleostei: Ostariophysi). Zootaxa 2018, 4476, 6–39. [Google Scholar] [CrossRef]
  16. Tchang, T.L. Two New Species of Barbus from Yunnan. Bull. Fan Meml. Inst. Biol. Peiping (Zool. Ser.) 1935, 6, 60–64. [Google Scholar]
  17. Kottelat, M. Status of Luciocyprinus and Fustis (Osteichthyes: Cyprinidae). Zool. Res. 1983, 4, 383–387. [Google Scholar]
  18. Allen, D. Luciocyprinus langsoni. The IUCN Red List of Threatened Species 2012: e.T166043A1107712. Available online: https://www.iucnredlist.org/species/166043/1107712 (accessed on 16 December 2024).
  19. National Forestry and Grassland Administration. National Key Protected Wildlife List; National Forestry and Grassland Administration: Beijing, China, 2021. [Google Scholar]
  20. Zhang, R.; Zhu, T.; Luo, Q. The Complete Mitochondrial Genome of the Freshwater Fish Onychostoma ovale (Cypriniformes, Cyprinidae): Genome Characterization and Phylogenetic Analysis. Genes 2023, 14, 1227. [Google Scholar] [CrossRef]
  21. Donath, A.; Jühling, F.; Al-Arab, M.; Bernhart, S.H.; Reinhardt, F.; Stadler, P.F.; Middendorf, M.; Bernt, M. Improved annotation of protein-coding genes boundaries in metazoan mitochondrial genomes. Nucleic Acids Res. 2019, 47, 10543–10552. [Google Scholar] [CrossRef]
  22. Lowe, T.M.; Chan, P.P. tRNAscan-SE On-line: Integrating search and context for analysis of transfer RNA genes. Nucleic Acids Res. 2016, 44, W54–W57. [Google Scholar] [CrossRef]
  23. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
  24. Choudhuri, S.; Sau, K. CodonU: A Python Package for Codon Usage Analysis. IEEE/ACM Trans. Comput. Biol. Bioinform. 2024, 21, 36–44. [Google Scholar] [CrossRef]
  25. Sahyoun, A.H.; Bernt, M.; Stadler, P.F.; Tout, K. GC skew and mitochondrial origins of replication. Mitochondrion 2014, 17, 56–66. [Google Scholar] [CrossRef] [PubMed]
  26. Zhang, Z. KaKs_Calculator 3.0: Calculating Selective Pressure on Coding and Non-Coding Sequences. Genom. Proteom. Bioinform. 2022, 20, 536–540. [Google Scholar] [CrossRef] [PubMed]
  27. Larsson, A. AliView: A fast and lightweight alignment viewer and editor for large datasets. Bioinformatics 2014, 30, 3276–3278. [Google Scholar] [CrossRef]
  28. Liu, S.-Q.; Mayden, R.L.; Zhang, J.-B.; Yu, D.; Tang, Q.-Y.; Deng, X.; Liu, H.-Z. Phylogenetic relationships of the Cobitoidea (Teleostei: Cypriniformes) inferred from mitochondrial and nuclear genes with analyses of gene evolution. Gene 2012, 508, 60–72. [Google Scholar] [CrossRef]
  29. Lanfear, R.; Frandsen, P.B.; Wright, A.M.; Senfeld, T.; Calcott, B. PartitionFinder 2: New Methods for Selecting Partitioned Models of Evolution for Molecular and Morphological Phylogenetic Analyses. Mol. Biol. Evol. 2017, 34, 772–773. [Google Scholar] [CrossRef]
  30. Minh, B.Q.; Schmidt, H.A.; Chernomor, O.; Schrempf, D.; Woodhams, M.D.; Von Haeseler, A.; Lanfear, R. IQ-TREE 2: New Models and Efficient Methods for Phylogenetic Inference in the Genomic Era. Mol. Biol. Evol. 2020, 37, 1530–1534. [Google Scholar] [CrossRef]
  31. Ronquist, F.; Teslenko, M.; van der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian Phylogenetic Inference and Model Choice Across a Large Model Space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef]
  32. Rambant, A. FigTree v1.4.4: Tree Figure Drawing Tool. Available online: http://tree.bio.ed.ac.uk/software/figtree/ (accessed on 25 November 2018).
  33. Satoh, T.P.; Miya, M.; Mabuchi, K.; Nishida, M. Structure and variation of the mitochondrial genome of fishes. BMC Genom. 2016, 17, 719. [Google Scholar] [CrossRef]
  34. Zhang, R.; Zhu, T.; Li, H.; Deng, L. The Mitochondrial Genome of Linichthys laticeps (Cypriniformes: Cyprinidae): Characterization and Phylogeny. Genes 2023, 14, 1938. [Google Scholar] [CrossRef]
  35. Zhang, R.; Zhu, T.; Yu, F. The New Mitochondrial Genome of Hemiculterella wui (Cypriniformes, Xenocyprididae): Sequence, Structure, and Phylogenetic Analyses. Genes 2023, 14, 2110. [Google Scholar] [CrossRef]
  36. Chrzanowska-Lightowlers, Z.M.; Lightowlers, R.N. Mitochondrial RNA maturation. RNA Biol. 2024, 21, 28–39. [Google Scholar] [CrossRef] [PubMed]
  37. Zhou, L.; Huang, S.; Wang, Q.; Li, Z.; Li, Z.; He, A.; Chen, J.; Liu, L.; Zou, K. Novel evolutionary insights into nemacheilid cavefish: Evidence from comparative analysis of mitochondrial genomes. J. Oceanol. Limnol. 2022, 40, 1640–1653. [Google Scholar] [CrossRef]
  38. Maduna, S.N.; Vivian-Smith, A.; Jónsdóttir, D.B.; Imsland, A.K.; Klütsch, C.F.; Nyman, T.; Eiken, H.G.; Hagen, S.B. Mitogenomics of the suborder Cottoidei (Teleostei: Perciformes): Improved assemblies, mitogenome features, phylogeny, and ecological implications. Genomics 2022, 114, 110297. [Google Scholar] [CrossRef] [PubMed]
  39. Luo, Q.; Zhang, R. The complete mitochondrial genome and phylogenetic analysis of Sinocyclocheilus angularis (Cypriniformes: Cyprinidae). Mitochondrial DNA Part B 2021, 6, 3438–3439. [Google Scholar] [CrossRef]
  40. Zhang, X.; Yue, B.; Jiang, W.; Song, Z. The complete mitochondrial genome of rock carp Procypris rabaudi (Cypriniformes: Cyprinidae) and phylogenetic implications. Mol. Biol. Rep. 2009, 36, 981–991. [Google Scholar] [CrossRef]
  41. Feng, Y.; Li, Q.; Yu, H.; Kong, L. Complete mitochondrial genome sequence of Cucullaea labiata (Arcoida: Cucullaeidae) and phylogenetic implications. Genes Genom. 2017, 39, 867–875. [Google Scholar] [CrossRef]
  42. Hurst, L.D. The Ka/Ks ratio: Diagnosing the form of sequence evolution. Trends Genet. 2002, 18, 486–487. [Google Scholar] [CrossRef]
  43. Gong, J.; Chen, B.; Li, B.; Zhou, Z.; Shi, Y.; Ke, Q.; Zhang, D.; Xu, P. Genetic analysis of whole mitochondrial genome of Lateolabrax maculatus (Perciformes: Moronidae) indicates the presence of two populations along the Chinese coast. Zoologia 2020, 37, e49046. [Google Scholar] [CrossRef]
  44. Peery, M.Z.; Kirby, R.; Reid, B.N.; Stoelting, R.; Doucet-Bëer, E.; Robinson, S.; Vásquez-Carrillo, C.; Pauli, J.N.; Palsbøll, P.J. Reliability of genetic bottleneck tests for detecting recent population declines. Mol. Ecol. 2012, 21, 3403–3418. [Google Scholar] [CrossRef]
  45. Xu, D.; Lou, B.; Shi, H.; Geng, Z.; Li, S.; Zhang, Y. Genetic diversity and population structure of Nibea albiflora in the China Sea revealed by mitochondrial COI sequences. Biochem. Syst. Ecol. 2012, 45, 158–165. [Google Scholar] [CrossRef]
  46. Städele, V.; Vigilant, L. Strategies for determining kinship in wild populations using genetic data. Ecol. Evol. 2016, 6, 6107–6120. [Google Scholar] [CrossRef] [PubMed]
  47. Jo, T.; Takao, K.; Minamoto, T. Linking the state of environmental DNA to its application for biomonitoring and stock assessment: Targeting mitochondrial/nuclear genes, and different DNA fragment lengths and particle sizes. Environ. DNA 2022, 4, 271–283. [Google Scholar] [CrossRef]
  48. Andújar, C.; Arribas, P.; Yu, D.W.; Vogler, A.P.; Emerson, B.C. Why the COI barcode should be the community DNA metabarcode for the metazoa. Mol. Ecol. 2018, 27, 3968–3975. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Circular representation of the mitogenome of L. langsoni. Image of the L. langsoni is shown in the middle. The concentric circles from outermost to innermost illustrate genes located on the heavy chain, genes located on the light chain, GC content (black), and GC skew (purple).
Figure 1. Circular representation of the mitogenome of L. langsoni. Image of the L. langsoni is shown in the middle. The concentric circles from outermost to innermost illustrate genes located on the heavy chain, genes located on the light chain, GC content (black), and GC skew (purple).
Genes 15 01621 g001
Figure 2. Visualization of the AT and GC skew in the protein-coding genes (PCGs) of L. langsoni (A) and L. striolatus (B).
Figure 2. Visualization of the AT and GC skew in the protein-coding genes (PCGs) of L. langsoni (A) and L. striolatus (B).
Genes 15 01621 g002
Figure 3. The summary of the RSCU values of PCGs in the mitochondrial genome of L. langsoni (A) and L. striolatus (B).
Figure 3. The summary of the RSCU values of PCGs in the mitochondrial genome of L. langsoni (A) and L. striolatus (B).
Genes 15 01621 g003
Figure 4. Codon frequency distribution in the mitogenomes of L. langsoni and L. striolatus. The left side numbers indicate the total count of each codon, with codon families plotted along the X-axis.
Figure 4. Codon frequency distribution in the mitogenomes of L. langsoni and L. striolatus. The left side numbers indicate the total count of each codon, with codon families plotted along the X-axis.
Genes 15 01621 g004
Figure 5. Projected molecular structure for the tRNA genes in the L. langsoni (LL) and L. striolatus (LS).
Figure 5. Projected molecular structure for the tRNA genes in the L. langsoni (LL) and L. striolatus (LS).
Genes 15 01621 g005
Figure 6. The Ka, Ks, and Ka/Ks values of 13PCGs in L. langsoni.
Figure 6. The Ka, Ks, and Ka/Ks values of 13PCGs in L. langsoni.
Genes 15 01621 g006
Figure 7. Phylogenetic analyses of L. langsoni based on the amino acid sequences of the 13 PCGs within the mitogenome. Branch labels denote posterior probabilities from Bayesian inference (BI) and maximum likelihood (ML) methods. Distinct colors correspond to different genera, “-” indicates that no values are presented.
Figure 7. Phylogenetic analyses of L. langsoni based on the amino acid sequences of the 13 PCGs within the mitogenome. Branch labels denote posterior probabilities from Bayesian inference (BI) and maximum likelihood (ML) methods. Distinct colors correspond to different genera, “-” indicates that no values are presented.
Genes 15 01621 g007
Table 1. Twelve pairs of PCR primers designed in this study for amplifying the full-length mitochondrial genome of L. langsoni.
Table 1. Twelve pairs of PCR primers designed in this study for amplifying the full-length mitochondrial genome of L. langsoni.
Primer NamePrimer Sequences (5′-3′)Annealing Temperature
LL-F1ACATGCAAGTCTCCGCAACC57.9 °C
LL-R1TTGGCTTACACTTGTGCTTGGA
LL-F2CAGCCACCTAAACAGAAAGCG55.8 °C
LL-R2GGGCGATGTTAAATGTTTGTAG
LL-F3TCCTATTTATCCTAGCCCTGTC52.8 °C
LL-R3AATCCTGTGAGTGGTGGTAGG
LL-F4CGCAGCATTCCTAACCCTAA54.4 °C
LL-R4GGATGTAAAGTATGCACGAGTGT
LL-F5CACCACATTCTTCGACCCG56.2 °C
LL-R5TCCTAGCGAGGCGTCTTCTAG
LL-F6CGACTAAATCAAACCGCCTTCA58.2 °C
LL-R6CTTGTTTGCGTTCTCCTTCCA
LL-F7CCAACACCAGAATTAGGAGGAT54.6 °C
LL-R7CATTGAGTCGTTCGGTTTGAT
LL-F8ATACATCTCACTCCTTGCCTCA51.4 °C
LL-R8TTATGGCTACTAGGAATGTGAG
LL-F9CTGACAATGAATAAACACCCAAAC55.5 °C
LL-R9TCGTGCGGTTTAGAGGAGG
LL-F10ATCAGCCGCCACCCAACT58.1 °C
LL-R10TTGGGATTGATCGTAGGATTGC
LL-F11TTTCCACCCATACTTCTCATA49.9 °C
LL-R11AGCGGTTTGGTGATAATACA
LL-F12CTCCCTAGCGCCCAGAAA54.9 °C
LL-F12AGGGTTTCGGGCACCTAG
Table 2. Detailed species information of mitochondrial genomes used for evolutionary relationship analysis in this paper.
Table 2. Detailed species information of mitochondrial genomes used for evolutionary relationship analysis in this paper.
GenusSpeciesLength (bp)GenBank Accession Number
ElopichthysElopichthys bambusa16,619KM196112
LuciocyprinusL. langsoni16,586MZ921933 (this study)
L. striolatus16,601AP012525
CyprinusCyprinus multitaeniata16,573KU373073
Cyprinus carpio carpio16,581JN105352
Cyprinus acutidorsalis16,580KR869144
Cyprinus megalophthalmus16,580KR869143
ProcyprisProcypris rabaudi16,595EU082030
CarassioidesCarassioides acuminatus16,579KX602324
CarassiusCarassius auratus16,576KJ874431
C. auratus auratus16,580JN105355
C. auratus grandoculis16,579AP011239
LabeoLabeo bata16,605AP011198
Labeo boggut16,603AP013338
Labeo fimbriatus16,614KP025676
Labeo gonius16,614KT001152
PoropuntiusPoropuntius bantamensis16,594AP011352
Poropuntius normani16,592AP011320
CyclocheilichthysCyclocheilichthys janthochir16,580AP011185
Cyclocheilichthys enoplos16,579JQ700301
OnychonstomaOnychostoma barbatum16,592NC_019630
Onychostoma gerlachi16,601NC_026549
Onychostoma lepturum16,601NC_054158
Onychostoma macrolepis16,595NC_023799
SpinibarbusSpinibarbus sinensis16,591KC579368
Spinibarbus denticulatus16,549NC_021616
Spinibarbus hollandi16,521NC_026129
AcrossocheilusAcrossocheilus kreyenbergii16,596KY094969
Acrossocheilus parallens16,592NC_026973
Acrossocheilus wenchowensis16,591NC_020145
TorTor douronensis16,586KJ880045
Tor khudree16,576KX950700
Tor sinensis16,579NC_022702
Tor tambra16,581KJ880044
SinocyclocheilusSinocyclocheilus angularis16,586MW362289
Sinocyclocheilus grahami16,585NC_013189
Sinocyclocheilus longibarbatus16,787NC_056194
Sinocyclocheilus tingi16,584NC_039594
Sinocyclocheilus yishanensis16,573MK387704
PercocyprisPercocypris pingi16,586NC_018601
Percocypris tchangi retrodorslis16,576MT527960
HypsibarbusHypsibarbus vernayi16,590NC_031621
PuntiusPuntius semifasciolatus16,594NC_020096
Puntius ticto17,302NC_008658
MystacoleucusMystacoleucus marginatus16,611NC_023106
ScaphiodonichthysScaphiodonichthys acanthopterus16,612NC_018789
SinogastromyzonS. szechuanensis16,565MN241814
MyxocyprinusM. asiaticus16,636AY526869
Table 3. The gene characteristic information of the mitochondrial genome of L. langsoni. H: heavy chain; L: light chain.
Table 3. The gene characteristic information of the mitochondrial genome of L. langsoni. H: heavy chain; L: light chain.
NameStrandLocationSize (bp)Intergenic LengthAnti-CodonStart CodonStop Codon
tRNAPheH1–69690GAA--
12S rRNAH70–10249552---
tRNAValH1027–10987218TAC--
16S rRNAH1117–2757164125---
tRNALeu2H2783–2858761TAA--
nad1H2860–38349754-ATGTAA
tRNAIleH3839–391072−2GAT--
tRNAGlnL3909–3979711TTG--
tRNAMetH3981–4049690CAT--
nad2H4050–50961047−2-ATGTAG
tRNATrpH5095–5165712TCA--
tRNAAlaL5168–5236691TGC--
tRNAAsnL5238–5310732GTT--
OLH5313–534432−1---
tRNACysL5344–541067−1GCA--
tRNATyrL5410–5480711GTA--
cox1H5482–703215510-GTGTAA
tRNASer2L7033–7103713TGA--
tRNAAspH7107–71787213GTC--
cox2H7192–78826910-ATGT(AA)
tRNALysH7883–7958761TTT--
atp8H7960–8124165−7-ATGTAG
atp6H8118–8801684−1-ATGTAA
cox3H8801–9586786−1-ATGTAA
tRNAGlyH9586–9657720TCC--
nad3H9658–10,008351−2-ATGTAG
tRNAArgH10,007–10,077710TCG--
nad4lH10,078–10,374297−7-ATGTAA
nad4H10,368–11,74813810-ATGT(AA)
tRNAHisH11,749–11,817690GTG--
tRNASer1H11,818–11,886691GCT--
tRNALeu1H11,888–11,960733TAG--
nad5H11,964–13,7871824−4-ATGTAA
nad6L13,784–14,3055220-ATGTAG
tRNAGluL14,306–14,374695TTC--
cobH14,380–15,52011410-ATGT(AA)
tRNAThrH15,521–15,59373−1TGT--
tRNAProL15,593–15,6627018TGG--
OHH15,681–16,48780799---
Table 4. Table of nucleic acid composition and skewness information of the mitochondrial genome of L. langsoni.
Table 4. Table of nucleic acid composition and skewness information of the mitochondrial genome of L. langsoni.
LocationSize (bp)ATGCA + TG + CA + T SkewG + C Skew
Genome16,58632.0424.1315.9427.8856.1743.830.1407−0.2725
PCGs11,38229.8526.0315.4528.6655.8944.110.0684−0.2993
1st codon position379427.1020.8525.7526.3047.9452.060.1303−0.0106
2nd codon position379418.3740.4313.6327.5758.8041.20−0.3752−0.3385
3rd codon position379444.1016.826.9832.1060.9139.090.4479−0.6426
rRNA259635.0919.3020.5725.0454.3945.610.2904−0.0980
tRNA156528.3126.1323.7721.7954.4445.560.03990.0435
control region80735.1933.3313.6317.8468.5331.470.0271−0.1339
Table 5. Codon number and RSCU of mitochondrial PCGs in L. langsoni.
Table 5. Codon number and RSCU of mitochondrial PCGs in L. langsoni.
Amino AcidCodonCountRSCUAmino AcidCodonCountRSCU
PheUUU750.66TyrUAU360.63
PheUUC1511.34TyrUAC781.37
LeuUUA1051stop codonUAA62.4
LeuUUG140.13stop codonUAG41.6
LeuCUU770.74HisCAU250.48
LeuCUC900.86HisCAC791.52
LeuCUA2972.84GlnCAA971.92
LeuCUG440.42GlnCAG40.08
IleAUU1451.01AsnAAU310.5
IleAUC1430.99AsnAAC921.5
MetAUA1241.47LysAAA741.92
MetAUG450.53LysAAG30.08
ValGUU480.86AspGAU200.53
ValGUC430.77AspGAC551.47
ValGUA1061.89GluGAA871.69
ValGUG270.48GluGAG160.31
SerUCU380.97CysUGU50.4
SerUCC511.3CysUGC201.6
SerUCA902.3TrpUGA1061.77
SerUCG80.2TrpUGG140.23
ProCCU190.36ArgCGU100.53
ProCCC470.9ArgCGC130.68
ProCCA1322.53ArgCGA492.58
ProCCG110.21ArgCGG40.21
ThrACU350.43SerAGU50.13
ThrACC1181.46SerAGC431.1
ThrACA1622.01stop codonAGA00
ThrACG80.1stop codonAGG00
AlaGCU470.57GlyGGU220.35
AlaGCC1451.77GlyGGC500.81
AlaGCA1231.5GlyGGA1211.95
AlaGCG120.15GlyGGG550.89
Table 6. Genetic diversity parameters of COI gene in Hechi Longjiang population.
Table 6. Genetic diversity parameters of COI gene in Hechi Longjiang population.
PopulationNumber of HaplotypesHaplotype (Gene) DiversityAverage Number of Nucleotide DifferenceNucleotide DiversityTajima’s D
Hechi Longjiang20.4970.4970.00031.5078
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Yang, T.; Tan, C.; Zhao, L.; Hu, Z.; Su, C.; Li, F.; Ma, Y.; Zhang, W.; Hao, X.; Zou, W.; et al. The Complete Mitochondrial Genome of the Luciocyprinus langsoni (Cypriniformes: Cyprinidae): Characterization, Phylogeny, and Genetic Diversity Analysis. Genes 2024, 15, 1621. https://doi.org/10.3390/genes15121621

AMA Style

Yang T, Tan C, Zhao L, Hu Z, Su C, Li F, Ma Y, Zhang W, Hao X, Zou W, et al. The Complete Mitochondrial Genome of the Luciocyprinus langsoni (Cypriniformes: Cyprinidae): Characterization, Phylogeny, and Genetic Diversity Analysis. Genes. 2024; 15(12):1621. https://doi.org/10.3390/genes15121621

Chicago/Turabian Style

Yang, Tiezhu, Chenxi Tan, Liangjie Zhao, Zhiguo Hu, Chaoqun Su, Fan Li, Yuanye Ma, Wenchao Zhang, Xiaoyu Hao, Wenxu Zou, and et al. 2024. "The Complete Mitochondrial Genome of the Luciocyprinus langsoni (Cypriniformes: Cyprinidae): Characterization, Phylogeny, and Genetic Diversity Analysis" Genes 15, no. 12: 1621. https://doi.org/10.3390/genes15121621

APA Style

Yang, T., Tan, C., Zhao, L., Hu, Z., Su, C., Li, F., Ma, Y., Zhang, W., Hao, X., Zou, W., Kang, J., & He, Q. (2024). The Complete Mitochondrial Genome of the Luciocyprinus langsoni (Cypriniformes: Cyprinidae): Characterization, Phylogeny, and Genetic Diversity Analysis. Genes, 15(12), 1621. https://doi.org/10.3390/genes15121621

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop