Interferon Regulatory Factors (IRF1, IRF4, IRF5, IRF7 and IRF9) in Sichuan taimen (Hucho bleekeri): Identification and Functional Characterization
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Gene Identification and Biological Information Analysis
2.3. Tissue Expression Analysis
2.4. In Vitro Stimulation
2.5. Real-Time PCR
2.6. Data Statistics
3. Results
3.1. IRF cDNA Sequence Characteristics
3.2. Amino Acid Structures of IRF1, IRF4, IRF5, IRF7 and IRF9
3.3. 3D Protein Structure Prediction of IRF1, IRF4, IRF5, IRF7 and IRF9
3.4. IRF Amino Acid Homology Among Species
3.5. Phylogenetic Analysis
3.6. IRF Gene Expression in Healthy Tissue
3.7. Changes in IRF Gene Expression Following LPS Induction
3.8. Changes in IRF Gene Expression Following Poly(I:C) Induction
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Akira, S.; Uematsu, S.; Takeuchi, O. Pathogen recognition and innate immunity. Cell 2006, 124, 783–801. [Google Scholar] [CrossRef]
- Beutler, B.; Eidenschenk, C.; Crozat, K.; Imler, J.L.; Takeuchi, O.; Hoffmann, J.A.; Akira, S. Genetic analysis of resistance to viral infection. Nat. Rev. Immunol. 2007, 7, 753–766. [Google Scholar] [CrossRef]
- Medzhitov, R. Recognition of microorganisms and activation of the immune response. Nature 2007, 449, 819–826. [Google Scholar] [CrossRef]
- Kawai, T.; Takahashi, K.; Sato, S.; Coban, C.; Kumar, H.; Kato, H.; Ishii, K.J.; Takeuchi, O.; Akira, S. IPS-1, an adaptor triggering RIG-I- and MDA5-mediated type I interferon induction. Nat. Immunol. 2005, 6, 981–988. [Google Scholar] [CrossRef]
- Seth, R.B.; Sun, L.; Ea, C.K.; Chen, Z.J. Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-κB and IRF3. Cell 2005, 122, 669–682. [Google Scholar] [CrossRef]
- Meylan, E.; Curran, J.; Hofmann, K.; Moradpour, D.; Binder, M.; Bartenschlager, R.; Tschopp, J. Cardif is an adaptor protein in the RIG-I antiviral pathway and is targeted by hepatitis C virus. Nature 2005, 437, 1167–1172. [Google Scholar] [CrossRef]
- Xu, L.G.; Wang, Y.Y.; Han, K.J.; Li, L.Y.; Zhai, Z.H.; Shu, H.B. Visa is an adapter protein required for virus-triggered IFN-beta signaling. Mol. Cell 2005, 19, 727–740. [Google Scholar] [CrossRef]
- Suzuki, H.; Kameyama, T.; Takaoka, A. Bincard2 as a positive regulator of interferon response in innate immunity. Biochem. Biophys. Res. Commun. 2019, 511, 287–293. [Google Scholar] [CrossRef]
- Antonczyk, A.; Krist, B.; Sajek, M.; Michalska, A.; Piaszyk-Borychowska, A.; Plens-Galaska, M.; Wesoly, J.; Bluyssen, H.A.R. Direct inhibition of IRF-dependent transcriptional regulatory mechanisms associated with disease. Front. Immunol. 2019, 10, 1176. [Google Scholar] [CrossRef]
- Zhao, X.Y.; Huo, R.X.; Yan, X.L.; Xu, T.J. IRF3 negatively regulates toll-like receptor-mediated NF-κB signaling by targeting TRIF for degradation in teleost fish. Front. Immunol. 2018, 9, 867. [Google Scholar] [CrossRef]
- Escalante, C.R.; Yie, J.; Thanos, D.; Aggarwal, A.K. Structure of IRF-1 with bound DNA reveals determinants of interferon regulation. Nature 1998, 391, 103–106. [Google Scholar] [CrossRef]
- Tamura, T.; Yanai, H.; Savitsky, D.; Taniguchi, T. The IRF family transcription factors in immunity and oncogenesis. Annu. Rev. Immunol. 2008, 26, 535–584. [Google Scholar] [CrossRef]
- Battistini, A. Interferon regulatory factors in hematopoietic cell differentiation and immune regulation. J. Interferon Cytokine Res. 2009, 29, 765–780. [Google Scholar] [CrossRef]
- Laghari, Z.A.; Li, L.; Chen, S.N.; Huo, H.J.; Huang, B.; Zhou, Y.; Nie, P. Composition and transcription of all interferon regulatory factors (IRFs), IRF1-11 in a perciform fish, the mandarin fish, Siniperca chuatsi. Dev. Comp. Immunol. 2018, 81, 127–140. [Google Scholar] [CrossRef]
- Huang, B.; Qi, Z.T.; Xu, Z.; Nie, P. Global characterization of interferon regulatory factor (IRF) genes in vertebrates: Glimpse of the diversification in evolution. BMC Immunol. 2010, 11, 22. [Google Scholar] [CrossRef]
- Guan, Y.; Chen, X.; Luo, T.; Ao, J.; Ai, C.; Chen, X. Molecular characterization of the interferon regulatory factor (IRF) family and functional analysis of IRF11 in the large yellow croaker (Larimichthys crocea). Fish Shellfish Immunol. 2020, 107, 218–229. [Google Scholar] [CrossRef]
- Kim, K.-H.; Joo, M.-S.; Kang, G.; Woo, W.-S.; Sohn, M.-Y.; Son, H.-J.; Park, C.-I. Characterization of red sea bream (Pagrus major) interferon regulatory factor 5 and 6 genes and their expression in response to RSIV infection. Fishes 2023, 8, 114. [Google Scholar] [CrossRef]
- Zhu, Y.; Qi, C.; Shan, S.; Zhang, F.; Li, H.; An, L.; Yang, G. Characterization of common carp (Cyprinus carpio I) Interferon regulatory factor 5 (IRF5) and its expression in response to viral and bacterial challenges. BMC Vet. Res. 2016, 12, 127. [Google Scholar] [CrossRef]
- Zhu, Y.; Shan, S.; Feng, H.; Jiang, L.; An, L.; Yang, G.; Li, H. Molecular characterization and functional analysis of interferon regulatory factor 9 (IRF9) in common carp Cyprinus carpio: A pivotal molecule in the IFN response against pathogens. J. Fish Biol. 2019, 95, 510–519. [Google Scholar] [CrossRef]
- Krishnan, R.; Kurcheti, P.P.; Mushtaq, Z.; Jeena, K.; Vismai, N.T. Interferon-regulatory factors, IRF3 and IRF7 in Asian seabass, Lates calcarifer: Characterization, ontogeny and transcriptional modulation upon challenge with nervous necrosis virus. Fish Shellfish Immunol. 2019, 89, 468–476. [Google Scholar] [CrossRef]
- Yang, Q.; Cui, J.; Song, W.; Zhao, X.; Xu, T. The evolution and functional characterization of miiuy croaker interferon regulatory factor 9 involved in immune response. Fish Shellfish Immunol. 2017, 66, 524–530. [Google Scholar] [CrossRef]
- Sun, H.; Mao, M.; Jiang, Z.; Han, Y.; Zhang, S.; Huo, Y. Cloning and expression analysis of interferon regulatory factor 7 in the Pacific cod, Gadus macrocephalus. Fish Shellfish Immunol. 2016, 49, 7–15. [Google Scholar] [CrossRef]
- Zhang, J.; Li, Y.X.; Hu, Y.H. Molecular characterization and expression analysis of eleven interferon regulatory factors in half-smooth tongue sole, Cynoglossus semilaevis. Fish Shellfish Immunol. 2015, 44, 272–282. [Google Scholar] [CrossRef]
- Inkpen, S.M.; Hori, T.S.; Gamperl, A.K.; Nash, G.W.; Rise, M.L. Characterization and expression analyses of five interferon regulatory factor transcripts (irf4a, irf4b, irf7, irf8, irf10) in Atlantic cod (Gadus morhua). Fish Shellfish Immunol. 2015, 44, 365–381. [Google Scholar] [CrossRef]
- Zhang, W.; Li, Z.; Jia, P.; Liu, W.; Yi, M.; Jia, K. Interferon regulatory factor 3 from sea perch (Lateolabrax japonicus) exerts antiviral function against nervous necrosis virus infection. Dev. Comp. Immunol. 2018, 88, 200–205. [Google Scholar] [CrossRef]
- Zhu, K.C.; Zhang, N.; Liu, B.S.; Guo, L.; Guo, H.Y.; Jiang, S.G.; Zhang, D.C. Functional analysis of IRF1 reveals its role in the activation of the typeI IFN pathway in golden pompano, Trachinotus ovatus (linnaeus 1758). Int. J. Mol. Sci. 2020, 21, 2652. [Google Scholar] [CrossRef]
- Hu, G.; Yin, X.; Lou, H.; Xia, J.; Dong, X.; Zhang, J.; Liu, Q. Interferon regulatory factor 3 (IRF-3) in Japanese flounder, Paralichthys olivaceus: Sequencing, limited tissue distribution, inducible expression and induction of fish type I interferon promoter. Dev. Comp. Immunol. 2011, 35, 164–173. [Google Scholar] [CrossRef]
- Huang, B.; Huang, W.S.; Nie, P. Cloning and expression analyses of interferon regulatory factor (IRF) 3 and 7 genes in european eel, Anguilla anguilla with the identification of genes involved in IFN production. Fish Shellfish Immunol. 2014, 37, 239–247. [Google Scholar] [CrossRef]
- Huang, W.S.; Zhu, M.H.; Chen, S.; Wang, Z.X.; Liang, Y.; Huang, B.; Nie, P. Molecular cloning and expression analysis of a fish specific interferon regulatory factor, IRF11, in orange spotted grouper, Epinephelus coioides. Fish Shellfish Immunol. 2017, 60, 368–379. [Google Scholar] [CrossRef]
- Huang, Y.; Huang, X.; Cai, J.; Ouyang, Z.; Wei, S.; Wei, J.; Qin, Q. Identification of orange-spotted grouper (Epinephelus coioides) interferon regulatory factor 3 involved in antiviral immune response against fish RNA virus. Fish Shellfish Immunol. 2015, 42, 345–352. [Google Scholar] [CrossRef]
- Xu, Q.; Jiang, Y.; Wangkahart, E.; Zou, J.; Chang, M.; Yang, D.; Secombes, C.J.; Nie, P.; Wang, T. Sequence and expression analysis of interferon regulatory factor 10 (IRF10) in three diverse teleost fish reveals its role in antiviral defense. PLoS ONE 2016, 11, e0147181. [Google Scholar] [CrossRef]
- Zhu, K.-C.; Liu, B.-S.; Zhang, N.; Guo, H.-Y.; Guo, L.; Jiang, S.-G.; Zhang, D.-C. Interferon regulatory factor 2 plays a positive role in interferon gamma expression in golden pompano, Trachinotus ovatus (linnaeus 1758). Fish Shellfish Immunol. 2020, 96, 107–113. [Google Scholar] [CrossRef]
- Wang, K.; Zhang, S.H.; Wang, D.Q.; Wu, J.M.; Wei, Q.W. Conservation genetics assessment and phylogenetic relationships of critically endangered Hucho bleekeri in China. J. Appl. Ichthyol. 2016, 32, 343–349. [Google Scholar] [CrossRef]
- Zhang, Y.; Luan, P.; Ren, G.; Hu, G.; Yin, J. Estimating the inbreeding level and genetic relatedness in an isolated population of critically endangered Sichuan taimen (Hucho bleekeri) using genome-wide SNP markers. Ecol. Evol. 2020, 10, 1390–1400. [Google Scholar] [CrossRef]
- Lin, J.; Wu, X.; Liu, Z.; Yang, H.; Chen, Y.; Li, H.; Yu, Y.; Tu, Q.; Chen, Y. Identification, expression and molecular polymorphism of T-cell receptors α and β from the glacial relict Hucho bleekeri. Fish Shellfish Immunol. 2024, 148, 109475. [Google Scholar] [CrossRef]
- Zhang, S.; Wei, Q.; Du, H.; Li, L. The complete mitochondrial genome of the endangered Hucho bleekeri (Salmonidae: huchen). Mitochondrial DNA Part A 2016, 27, 124–125. [Google Scholar] [CrossRef]
- Chen, Y.Y.; Yang, H.C.; Chen, Y.L.; Song, M.J.; Liu, B.; Song, J.G.; Liu, X.; Li, H. Full-length transcriptome sequencing and identification of immune-related genes in the critically endangered Hucho bleekeri. Dev. Comp. Immunol. 2021, 116, 103934. [Google Scholar] [CrossRef]
- Campoverde, C.; Milne, D.J.; Estévez, A.; Duncan, N.; Secombes, C.J.; Andree, K.B. Ontogeny and modulation after pamps stimulation of β-defensin, hepcidin, and piscidin antimicrobial peptides in meagre (Argyrosomus regius). Fish Shellfish Immunol. 2017, 69, 200–210. [Google Scholar] [CrossRef]
- Hu, G.; Yin, X.; Xia, J.; Dong, X.; Zhang, J.; Liu, Q. Molecular cloning and characterization of interferon regulatory factor 7 (IRF-7) in Japanese flounder, Paralichthys olivaceus. Fish Shellfish Immunol. 2010, 29, 963–971. [Google Scholar] [CrossRef]
- Chen, W.; Royer, W.E., Jr. Structural insights into interferon regulatory factor activation. Cell Signal. 2010, 22, 883–887. [Google Scholar] [CrossRef]
- Gan, X.N.; Chen, Z.; Wang, X.Z.; Wang, D.Q.; Chen, X.W. Molecular cloning and characterization of interferon regulatory factor 1 (IRF-1), IRF-2 and IRF-5 in the chondrostean paddlefish Polyodon spathula and their phylogenetic importance in the Osteichthyes. Dev. Comp. Immunol. 2012, 36, 74–84. [Google Scholar]
- Au, W.C.; Moore, P.A.; Lowther, W.; Juang, Y.T.; Pitha, P.M. Identification of a member of the interferon regulatory factor family that binds to the interferon-stimulated response element and activates expression of interferon-induced genes. Proc. Natl. Acad. Sci. USA 1995, 92, 11657–11661. [Google Scholar] [CrossRef]
- Paun, A.; Pitha, P.M. The IRF family, revisited. Biochimie 2007, 89, 744–753. [Google Scholar] [CrossRef]
- Yamamoto, H.; Lamphier, M.S.; Fujita, T.; Taniguchi, T.; Harada, H. The oncogenic transcription factor IRF-2 possesses a transcriptional repression and a latent activation domain. Oncogene 1994, 9, 1423–1428. [Google Scholar]
- Jia, W.Z. Moleculer Cloning, Identification and Characterization of Immune-Relevant Genes in Snakehead Channa argus. Ph.D. Thesis, University of Chinese Academy of Science, Beijing, China, 2007. [Google Scholar]
- Yao, C.-L.; Huang, X.-N.; Fan, Z.; Kong, P.; Wang, Z.-Y. Cloning and expression analysis of interferon regulatory factor (IRF) 3 and 7 in large yellow croaker, Larimichthys crocea. Fish Shellfish Immunol. 2012, 32, 869–878. [Google Scholar] [CrossRef]
- Zhao, X.; Wang, R.; Li, Y.; Xiao, T. Molecular cloning and functional characterization of interferon regulatory factor 7 of the barbel chub, Squaliobarbus curriculus. Fish Shellfish Immunol. 2017, 69, 185–194. [Google Scholar] [CrossRef]
- Zhan, F.B.; Liu, H.; Lai, R.F.; Jakovlić, I.; Wang, W.M. Expression and functional characterization of interferon regulatory factors (irf2, irf7 and irf9) in the blunt snout bream (Megalobrama amblycephala). Dev. Comp. Immunol. 2017, 67, 239–248. [Google Scholar] [CrossRef]
- Bergan, V.; Kileng, Ø.; Sun, B.; Robertsen, B. Regulation and function of interferon regulatory factors of Atlantic salmon. Mol. Immunol. 2010, 47, 2005–2014. [Google Scholar] [CrossRef]
- Muhlethaler-Mottet, A.; Di Berardino, W.; Otten, L.A.; Mach, B. Activation of the MHC class II transactivator CIITA by interferon-γ requires cooperative interaction between Stat1 and USF-1. Immunity 1998, 8, 157. [Google Scholar] [CrossRef]
- Harton, J.A.; Ting, J.P. Class II transactivator: Mastering the art of major histocompatibility complex expression. Mol. Cell. Biol. 2000, 20, 6185–6194. [Google Scholar] [CrossRef]
- Steimle, V.; Siegrist, C.A.; Mottet, A.; Lisowska-Grospierre, B.; Mach, B. Regulation of MHC class II expression by interferon-γ mediated by the transactivator gene CIITA. Science 1994, 265, 106–109. [Google Scholar] [CrossRef]
- Chen, Y.; Wu, X.; Yang, H.; Liu, Z.; Chen, Y.; Wei, Q.; Lin, J.; Yu, Y.; Tu, Q.Y.; Li, H. Characterization, expression, and polymorphism of MHC II α and MHC II β in Sichuan taimen (Hucho bleekeri). Comp. Biochem. Phys. A 2024, 299, 111767. [Google Scholar] [CrossRef] [PubMed]
- Hou, J.; Chen, S.N.; Gan, Z.; Li, N.; Huang, L.; Huo, H.J.; Yang, Y.; Lu, Y.; Yin, Z.; Nie, P. In primitive zebrafish, MHC class II expression is regulated by IFN-γ, IRF1, and two forms of CIITA. J. Immunol. 2020, 204, 2401–2415. [Google Scholar] [CrossRef]
- Xiang, Z.; Dong, C.; Qi, L.; Chen, W.; Huang, L.; Li, Z.; Xia, Q.; Liu, D.; Huang, M.; Weng, S. Characteristics of the interferon regulatory factor pairs zfIRF5/7 and their stimulation expression by ISKNV Infection in zebrafish (Danio rerio). Dev. Comp. Immunol. 2010, 34, 1263–1273. [Google Scholar] [CrossRef]
- Zhang, Y.B.; Hu, C.Y.; Zhang, J.; Huang, G.P.; Wei, L.H.; Zhang, Q.Y.; Gui, J.F. Molecular cloning and characterization of crucian carp (Carassius auratus I.) Interferon regulatory factor 7. Fish Shellfish Immunol. 2003, 15, 453–466. [Google Scholar] [CrossRef]
- Holland, J.W.; Bird, S.; Williamson, B.; Woudstra, C.; Secombes, C.J. Molecular characterization of IRF3 and IRF7 in rainbow trout, Oncorhynchus mykiss: Functional analysis and transcriptional modulation. Mol. Immunol. 2009, 46, 269–285. [Google Scholar] [CrossRef]
- Mao, F.; Lin, Y.; Zhou, Y.; He, Z.; Li, J.; Zhang, Y.; Yu, Z. Structural and functional analysis of interferon regulatory factors (IRFs) reveals a novel regulatory model in an invertebrate. Crassostrea gigas. Dev. Comp. Immunol. 2018, 89, 14–22. [Google Scholar] [CrossRef]
- Zhao, G.-N.; Jiang, D.-S.; Li, H. Interferon regulatory factors: At the crossroads of immunity, metabolism, and disease. Biochim. Biophys. Acta. 2015, 1852, 365–378. [Google Scholar] [CrossRef]
- Zhang, X.J.; Jiang, D.S.; Li, H. The interferon regulatory factors as novel potential targets in the treatment of cardiovascular diseases. Br. J. Pharmacol. 2015, 172, 5457–5476. [Google Scholar] [CrossRef]
- Zhang, X.J.; Zhang, P.; Li, H. Interferon regulatory factor signalings in cardiometabolic diseases. Hypertension 2015, 66, 222–247. [Google Scholar] [CrossRef]
- Fink, K.; Grandvaux, N. STAT2 and IRF9: Beyond ISGF3. Jak-stat 2013, 2, e27521. [Google Scholar] [CrossRef] [PubMed]
- Hobart, M.; Ramassar, V.; Goes, N.; Urmson, J.; Halloran, P.F. IFN regulatory factor-1 plays a central role in the regulation of the expression of class I and II MHC genes in vivo. J. Immunol. 1997, 158, 4260–4269. [Google Scholar] [CrossRef] [PubMed]
- Hu, G.; Chen, X.; Gong, Q.; Liu, Q.; Zhang, S.; Dong, X. Structural and expression studies of interferon regulatory factor 8 in Japanese flounder, Paralichthys olivaceus. Fish Shellfish Immunol. 2013, 35, 1016–1024. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.J. Molecular Characterization and Function of IRF1, IRF2 and IRF11 in the Large Yellow Croaker (Larimichthys crocea). Master’s Thesis, Fujian Agriculture and Forestry University, Fuzhou, China, 2020. [Google Scholar]
- Zhang, L.; Pagano, J.S. Structure and function of IRF-7. J. Interferon. Cytokine. Res. 2002, 22, 95–101. [Google Scholar] [CrossRef]
- Honda, K.; Taniguchi, T. IRFs: Master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. Nat. Rev. Immunol. 2006, 6, 644–658. [Google Scholar] [CrossRef]
Gene Name | Primer Name | Sequence (5′-3′) | Annealing Temperature | Application | Size of PCR Product (bp) |
---|---|---|---|---|---|
IRF1 | IRF1-F | GCAGCTAGCTGAACCATGC | 52 | Cloning | 984 |
IRF1-R | GGTTCTGTACAGGGTCTGAG | ||||
IRF4 | IRF4-F | GGGTTTCGAGTTTCAGCGAG | 52 | Cloning | 1472 |
IRF4-R | TCAGTCCTGCAGGGTGTTG | ||||
IRF5 | IRF5-F | TTCTCCTCCCTGCGTGTTG | 52 | Cloning | 1609 |
IRF5-R | TCACGGTCCGTTTGTGGC | ||||
IRF7 | IRF7-F | GACGTGTCTCAACATTCAAGATGC | 52 | Cloning | 1203 |
IRF7-R | TCTAGAAGTACTGCCCCATGG | ||||
IRF9 | IRF9-F | ATGGCATCTGGGAGAATTCGCT | 52 | Cloning | 1363 |
IRF9-R | AGACTCGGGACATAGCCAGT | ||||
IRF1 | IRF1-qF | CATCAGTGGATTGGTGTGGGTGG | 58 | Real-time PCR | 162 |
IRF1-qR | GGGTCTGGTTTAGTCTCGCCTTG | ||||
IRF4 | IRF4-qF | GCGAGGCTGGATGAAGGAC | 58 | Real-time PCR | 167 |
IRF4-qR | GGGCGTCAGTAGGGCTGTA | ||||
IRF5 | IRF5-qF | AAGATGGGCTCCCTGACGGTGA | 58 | Real-time PCR | 155 |
IRF5-qR | CGCTGCTTCTCGTTCTGGATGTCG | ||||
IRF7 | IRF7-qF | CTGCTCAACCTGCCTGCTG | 58 | Real-time PCR | 84 |
IRF7-qR | GGTCTTTCGCATCTCGCTCC | ||||
IRF9 | IRF9-qF | GCCACATTCAACCACGACG | 58 | Real-time PCR | 157 |
IRF9-qR | CTCCTCTCCGAAACACAAGGT | ||||
EF1α | EF1α-qF | TGGAGACAGCAAGAACGACC | 62.6 | Real-time PCR | 126 |
EF1α-qR | ATGTGAGCGGTGTGGCAAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, Y.; Yang, H.; Wu, X.; Liu, Z.; Chen, Y.; Wei, Q.; Lin, J.; Yu, Y.; Tu, Q.; Li, H. Interferon Regulatory Factors (IRF1, IRF4, IRF5, IRF7 and IRF9) in Sichuan taimen (Hucho bleekeri): Identification and Functional Characterization. Genes 2024, 15, 1418. https://doi.org/10.3390/genes15111418
Chen Y, Yang H, Wu X, Liu Z, Chen Y, Wei Q, Lin J, Yu Y, Tu Q, Li H. Interferon Regulatory Factors (IRF1, IRF4, IRF5, IRF7 and IRF9) in Sichuan taimen (Hucho bleekeri): Identification and Functional Characterization. Genes. 2024; 15(11):1418. https://doi.org/10.3390/genes15111418
Chicago/Turabian StyleChen, Yeyu, Huanchao Yang, Xiaoyun Wu, Zhao Liu, Yanling Chen, Qinyao Wei, Jue Lin, Yi Yu, Quanyu Tu, and Hua Li. 2024. "Interferon Regulatory Factors (IRF1, IRF4, IRF5, IRF7 and IRF9) in Sichuan taimen (Hucho bleekeri): Identification and Functional Characterization" Genes 15, no. 11: 1418. https://doi.org/10.3390/genes15111418
APA StyleChen, Y., Yang, H., Wu, X., Liu, Z., Chen, Y., Wei, Q., Lin, J., Yu, Y., Tu, Q., & Li, H. (2024). Interferon Regulatory Factors (IRF1, IRF4, IRF5, IRF7 and IRF9) in Sichuan taimen (Hucho bleekeri): Identification and Functional Characterization. Genes, 15(11), 1418. https://doi.org/10.3390/genes15111418