Next Article in Journal
Combined Transcriptome and Metabolome Analyses Provide New Insights into the Changes in the Flesh Color of Anthocyanins in Strawberry (Fragaria × ananassa (Weston) Duchesne ex Rozier)
Next Article in Special Issue
Genome-Wide Genetic Diversity and Population Structure of Charybdis feriata (Crustacea, Decapoda, and Portunidae) Along the Southeast Coast of China Inferred from Genotyping-by-Sequencing (GBS) Approach
Previous Article in Journal
Genomic Characterization of Lactiplantibacillus plantarum Strains: Potential Probiotics from Ethiopian Traditional Fermented Cottage Cheese
Previous Article in Special Issue
Genomic and Transcriptional Analysis of the Necroptosis Pathway Elements RIPK and MLKL in Sea Cucumber, Holothuria leucospilota
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Development of a Novel Stress and Immune Gene Panel for the Australasian Snapper (Chrysophrys auratus)

by
Kerry L. Bentley-Hewitt
1,*,
Christina K. Flammensbeck
2,3,
Ross N. Crowhurst
4,
Duncan I. Hedderley
1 and
Maren Wellenreuther
2,3
1
The New Zealand Institute for Plant and Food Research Limited, Private Bag 11600, Palmerston North 4442, New Zealand
2
The New Zealand Institute for Plant and Food Research Limited, Nelson Research Centre, Box 5114, Port Nelson, Nelson 7043, New Zealand
3
The School of Biological Sciences, The University of Auckland, Private Bag 92019, Auckland 1142, New Zealand
4
The New Zealand Institute for Plant and Food Research Limited, Private Bag 92169, Auckland 1142, New Zealand
*
Author to whom correspondence should be addressed.
Genes 2024, 15(11), 1390; https://doi.org/10.3390/genes15111390
Submission received: 27 September 2024 / Revised: 25 October 2024 / Accepted: 28 October 2024 / Published: 29 October 2024
(This article belongs to the Special Issue Genetics and Molecular Breeding in Fisheries and Aquaculture)

Abstract

Background: Snapper (Chrysophrys auratus) is a commercially, recreationally and culturally important teleost species in New Zealand and has been selected as a potential new species for aquaculture. Selective breeding to enhance stress tolerance, survival and growth are major breeding targets, yet research into snapper immune and stress responses has been limited. Methods: We explored a set of candidate genes in the fin, head kidney and liver tissues of 50 individuals by exposing 20 fish to increasing temperature (up to 31 °C) and 20 fish to decreasing temperature (down to 7 °C) for up to 37 h. Of these, we analysed 10 temperature-sensitive and 10 temperature-tolerant fish, along with 10 fish kept at 18 °C (acclimation temperature) as a control group. Results: Expression analyses of candidate stress genes in the three tissue types via NanoString Technologies, Inc., Seattle, WA, USA. showed that 20 out of 25 genes significantly changed in each experiment, demonstrating the significant impact of temperature on stress and immune responses. We further document that 10 key gene biomarkers can be used to predict genotypes that are tolerant to extreme temperatures. Conclusions: Taken together, our novel NanoString method can be used to monitor stress in snapper rapidly, and applications of this tool in this and potentially closely related teleost species can provide insights into stress resilience of wild stocks and inform the selection of grow-out locations for aquaculture.

Graphical Abstract

1. Introduction

Stress responses involve the neural, endocrine and immune systems and can be acute (increasing innate responses) or chronic (immune-suppressive and increasing the risk of infection) [1]. Temperature has a significant impact on the stress and immune responses in virtually all animal species [2,3], particularly in ectotherm animals like fishes [1,4]. The majority of teleost species are ectothermic, and immune responses can depend on seasonal changes, such as temperature increases causing enhanced immune responses and temperature decreases suppressing responsiveness to antigens [5]. Innate immunity is of fundamental importance in preventing pathogen entry and consists of physical (e.g., skin and mucus), humoral (e.g., complement proteins) and cellular components (e.g., macrophages) [6]. Research into the immune systems of fish has been limited by reagents for classical immunology studies [7]. However, with the availability of a species transcriptome, gene expression can be used to investigate potential biomarkers that are indicative of an animal’s health status [2,8]. Biomarkers are crucial tools for the assessment of environmental changes [9,10]. Fish show conservation of most immune-related genes with vertebrates, but investigations into functional immunology remain scarce [6].
Antioxidant enzymes are often used in toxicology as sensitive biomarkers, e.g., superoxide dismutase (sod) and catalase (cat), which constitute the first line of defence against reactive oxygen species (ros). Besides antioxidant enzymes, another group of genes involved in the immune response is induced under oxidative stress conditions because of the relationships between an imbalance in antioxidant properties and susceptibility to diseases, which includes the antimicrobial peptide hepcidin (hamp). The great sensitivity to a wide range of stress conditions makes the gene expression of these antioxidant enzymes and immune-related genes suitable for use as biomarkers in teleost fishes [9].
The Australasian snapper, C. auratus, tāmure, (hereafter referred to as snapper) is a species that was selected as a candidate for aquaculture in New Zealand, and a selective breeding program was started in 2016. Snapper is a valuable commercial and recreational fish species located around the coasts of Australia and New Zealand [11,12]. It is a demersal marine finfish species that can reach a total length of 120 cm and weights of around 20 kg [12]; it is closely related to Pagrus/Chrysophrys major (hereafter referred to as red seabream) (Temminck & Schlegel 1843) [13], a major aquaculture species in Japan [14,15,16]. In New Zealand, it mostly inhabits the continental shelf at depths of up to 200 m, but primarily above 70 m in the upper section of the epipelagial zone, on rocky, muddy or sandy seabeds. Predominantly, snapper is distributed around the coast of the North Island and the northern coast of the South Island, with decreasing abundance further south caused by lower water temperatures, which are a relevant parameter for the reproduction cycle [17,18,19]. Snapper has a wide distribution across New Zealand and Australia, inhabiting nearly all inshore environments down to depths of 200 m [12,20]. In New Zealand, snapper is predominantly found in the northern half of the North Island and the northern part of the South Island [12], occasionally occurring in the southern South Island [21], where temperatures can go well below 10 °C. Like many other Sparidae species, they experience a broad range of natural temperatures [19,22,23,24]. For instance, their range extends as far north as Mackay, where sea surface temperatures (SSTs) can reach up to 30 °C [25]. Moreover, experimental work has repeatedly shown that snapper can adjust effectively to both warm and cold temperature treatments, exhibiting minimal mortality even after months of exposure [23,26]. Herein, we aimed to exceed the species’ thermal tolerance limits by exposing snapper to extreme temperatures outside of the seasonal temperature range since climate change may expose snapper to these extremes in the future. Breeding of snapper in New Zealand started around 20 years ago at The New Zealand Institute for Plant and Food Research Limited (Plant & Food Research) in Nelson, but selective breeding using genomic information was only initiated in 2016 with the aim of improving the growth rate and other traits of economic interest [27]. Prior to the selective breeding research program, only a handful of genetic markers were available for this species [28,29]. Our group has been developing diverse resources for snapper to facilitate rapid breeding progress in this species, including a genome, linkage map, transcriptome and genome-wide sequence information on pedigreed snapper [23,27,30,31]. Research into snapper immune and stress responses has been limited so far, yet this is an important trait for the domestication process and the selective breeding of species. Stress and immunity in closely related species, such as red seabream and gilthead seabream (Sparus aurata) [32,33,34,35], have been studied. Both species are already successfully developed for use in commercial aquaculture in Japan and the Mediterranean, respectively. These studies focus on a range of factors that affect stress and immune responses, such as infection, pollution and dietary interventions [36,37,38,39].
In this study, we aim to identify and develop novel biomarkers associated with the thermotolerance of Australasian snapper using NanoString Technologies, Inc. (Seattle, WA, USA). This is the first time such an approach has been applied to this species, making it a novel contribution to the field. By focusing on genes responsive to different temperature settings, we enhance our understanding of the physiological and molecular mechanisms underpinning the snapper’s resilience to thermal stress. This focus on biomarkers facilitates the selection of breeding stock with superior thermal tolerance, contributing to a deeper understanding of the snapper’s adaptive capacity in fluctuating environments. Here, we explore a set of genes identified as potentially being involved in the stress and immune responses of snapper exposed to an extreme temperature challenge as follows: either a heating (up to 31 °C) or cooling treatment (down to 7 °C) for up to 37 h, with temperature-sensitive fish (those that started to show signs of distress) and temperature-tolerant fish (those that survived the temperature extreme) being sampled along with control fish (kept at the acclimation temperature of 18 °C). We (1) first established a list of 97 candidates from the literature and then (2) identified key gene biomarkers in snapper that can be used to predict genotypes that are tolerant to extreme temperature changes in the following tissues: fin, head kidney and liver tissues. We discuss these findings and compare them with other studies to highlight novel results and outline future applications based on the use of the developed gene panel.

2. Materials and Methods

2.1. Experimental Design

All work conducted in this study was approved by the Animal Ethics Committee at the University of Auckland, New Zealand, under ethics approval reference number 002169.
Temperature experiments were conducted at Plant & Food Research’s Finfish facility in Nelson. The F3 study population was derived from a genomically selected core F2 broodstock population consisting of 63 individuals. Breeding took place over five consecutive days at the end of November 2019. Fertilized eggs were collected daily and placed in a 5000-litre self-cleaning tank for initial rearing. The experiment was designed to study acute stress response of juvenile snapper (~4–6 months old) exposed to increasing (heating treatment, up to 31 °C) and decreasing temperatures (cooling treatment, down to 7 °C) for up to 37 h.
In this acute temperature experiment, a total of 600 juvenile snapper were divided into the two main treatment groups as follows: warm and cold. The warm treatment involved three tanks with 100 fish each, where the temperature was initially set at 18 °C and gradually increased to 22 °C over 24 h, followed by an extreme heating protocol raising the temperature by approximately 1 °C per hour for 9 h to reach 31 °C. The cold treatment also involved three tanks with 100 fish each, starting at 18 °C and decreasing to 14 °C over 24 h, followed by extreme cooling at approximately 1 °C per hour for 7 h to reach 7 °C. Temperature, dissolved oxygen and other water quality parameters were monitored twice daily using a handheld YSI meter, with continuous temperature logging in each tank to ensure stable conditions throughout the experiment. Before the start of the experiment, 10 individuals were sampled as the control group, which was kept under the acclimation temperature (18 °C) and did not experience the temperature challenge.
Fish were continuously monitored throughout the experiment. Upon reaching the target temperature, the experiment was concluded as soon as 10 individuals exhibited signs of stress. For heat shock, these signs included agitated swimming and jumping behaviour, while for cold stress, the indicators included loss of equilibrium and sinking to the bottom of the tank. Those individuals were classified as temperature-sensitive and were sampled along with 10 temperature-tolerant individuals that were not in distress at the end of the experiment or showed the least signs of stress. Fish in the cooling treatment showed signs of distress before the 33 h timepoint; therefore, the fish that were last to show signs of distress were the cold-tolerant group. Fish in the heating treatment took longer than 37 h to show any signs of stress; therefore, the most stressed were the heat-sensitive group. For this study, a subset of samples was taken from one cooling and one heating replicate. The head kidney, liver and a fin sample were taken from a total of 50 individuals representing control (n = 10), temperature-sensitive (n = 20, 10 per treatment group) and temperature-tolerant individuals (n = 20, 10 per treatment group) (see Table 1 for phenotypic data on the different sample groups). The experimental design is shown in Figure 1.

2.2. Gene Target Sequence Design

Candidate genes were selected from a literature review of studies investigating at immune- and stress-related genes, mainly in red and gilthead seabream, and whether they could potentially be identified in the snapper transcriptome. We searched the following databases in April 2020: Web of Science core, current content connect™, CABI, FSTA, MEDLINE, Russian Science Citation Index, SciElO Citation Index (collectively Web of Science all) and Google Scholar (limited to first 5 pages over the previous 2 years). We used the keywords “Pagrus auratus” OR “C. auratus” OR “Pagrus major” OR “S. aurata” OR “Tamure sparus”) AND immun* refined to review papers, “P. auratus” OR “C. auratus” AND immun* AND (gene* OR “T cell” OR “pentraxin” OR “cytokines” OR “TNF” OR “IFN” OR “CXC” OR “iNOS” OR “COX”) and “P. major “ OR “S. aurata” OR “T. Sparus” AND (immun* OR cytokines) AND TITLE: gene* for Web of Science all searches. For Google Scholar searches, we used “P. major” OR “S. aurata” OR “T. sparus”) AND (immun* OR cytokines) AND TITLE: gene*. A summary of our search strategy is in Supplementary Materials Table S1.
A list of 97 putative candidate gene sequences was identified within the NCBI Gilthead seabream (S. aurata) annotation release 100 (www.ncbi.nlm.nih.gov/genome/annotation_euk/Sparus_aurata/100/) URL assessed on 22 August 2019, and the coding sequences (CDS) for these were downloaded from NCBI. The 97 gilthead seabream CDS sequences were then aligned to the whole-genome assembly of snapper [32] using gmap (“--cross-species --format=gff3_gene --ordered --tolerant --gff3-fasta-annotation = 1 --min-trimmed-coverage = 0.85 --min-identity = 0.85”). The general feature format/general transfer format (GFF/GTF) utility gffread (https://github.com/gpertea/gffread) (version 0.12.1) was then used to extract the CDS and predicted peptide sequences from the snapper whole-genome sequence using the command line options “-i 50000 --merge -K -D --adj-stop”. This extraction yielded 73 CDS sequences, of which 71 CDS sequences, with a minimum length of 150 bases, were assessed for completeness.
The 71 sequences were used to design probes for a PlexSet assay by NanoString Technologies, Inc., and from these, a final set of 48 targets was selected. In several cases, the same gene annotation was given with a different isoform, e.g., the following five mucin 18-like isoforms: X, X2, X3, X4, and X5. In these instances, NanoString managed to design primers to bind to all isoforms, resulting in a list of 60 genes. Three sequences were deemed to be either truncated at their 5 prime terminus, truncated at their 3 prime terminus or a fragment truncated at the 5 prime and 3 prime ends relative to the original snapper query sequence; these were removed. Finally, the list was reduced to 48 genes by selecting those thought more likely to be modified by the temperature treatments, based on information in the current literature. Genes with “-like” in their name were discussed as if they were the gene. Annotation for the snapper and gilthead seabream genome is still limited, so the results must be interpreted with some caution.
In summary, candidate genes were selected from a literature review of studies investigating immune- and stress-related genes, mainly in red and gilthead seabream, and whether they could potentially be identified in the snapper transcriptome. The final set of gene targets and their potential link to fish stress and immune responses are summarized in Table 2.

2.3. RNA Extraction

Snap-frozen fin, head kidney and liver tissue samples (approximately 15–25 mg) were placed on ice and homogenized in 600 µL RA1 lysis buffer with 6 µL β-mercaptoethanol (NucleoSpin RNA, Mini kit, cat. no. 740955.50, MACHEREY-NAGEL GmbH & Co. KG, Düren, Germany). The samples were then filtrated using a NucleoSpin® Filter and centrifuged at 11,000× g for 1 min at room temperature. An equal volume of 70% molecular-grade ethanol was added to the filtrate and transferred to a NucleoSpin® Mini column (NucleoSpin RNA, Mini kit, cat. no. 740955.50, MACHEREY-NAGEL GmbH & Co. KG, Germany). RNA was extracted as per the manufacturer’s protocol into 60 µL of tris-ethylenediaminetetraacetic acid buffer for gene expression of 48 genes (Table 3) by the Counter Analysis System (NanoString Technologies, Inc.). RNA quantity was assessed by a Qubit™ RNA BR (Broad-Range) Assay Kit as per the manufacturer’s instructions (Invitrogen™, cat. no. Q10211, Waltham, MA, USA) and a Qubit® 2.0 Fluorometer (Invitrogen™, USA).

2.4. Gene Expression Analysis—NanoString Counter Analysis System

RNA samples (64 ng fin, 21 ng head kidney and 45 ng liver) were analysed using nCounter Plexset reagents (NanoString, Seattle, WA, USA) following the manufacturer’s instructions. Target sequences were designed by NanoString Technologies, Inc. and ordered from Integrated DNA Technologies, Inc., Coralville, IA, USA (Table 3). Briefly, multiplexed probes are designed with two sequence-specific probes for each gene of interest. The capture probe is coupled to biotin as an affinity tag. The second probe, the reporter probe, is coupled to a colour-coded tag. Each target molecule of interest is identified by the unique colour code generated by the ordered fluorescent tags on the reporter probe. The level of expression is measured by counting the number of codes for each mRNA using digital imaging. This allows the analysis of multiple genes from the same sample (multiplexing) using a customized set of probes with distinct bar codes called a CodeSet [67]. The samples were prepared as previously described in Bentley-Hewitt et al. (2016) [68]. Initially, the samples were spiked with six different internal control probes at concentrations ranging from 128 fM to 0.125 fM in 4-fold dilution steps. Eight positive controls were used to determine the linearity of the assays and were used for normalization. Eight negative probes were used to control for the carryover of reporter probes, as no RNA target was included for these probes. A calibration sample containing a pool of each snapper tissue was run in eight lanes of the assay. To pass the assay calibration, at least 50 counts of each gene had to be present in each of the eight lanes. The RNA samples were incubated for 22 h at 65 °C in a hybridization buffer containing the CodeSet, which consisted of reporter and capture probes and, together with the target RNA, formed a tripartite complex. After hybridization, the complex was bound by its biotin-labelled capture probe on a streptavidin-coated glass slide and was stretched within an electric field. The hybridized samples were processed using the robotic Prep Station (High Sensitivity Protocol, 3 h per 12-sample cartridge), and data acquisition was performed by using the GEN2 Digital Analyzer, with the “Max” Field of View setting (555 images per sample; 5 h scan per cartridge). Raw counts were normalized using the positive controls, and target genes were normalized to the following internal reference genes: 40S ribosomal protein S18 (rps18), 60S ribosomal protein L8 (rpl8) and elongation factor 1-α (ef1a), using nSolver™ 4.0 analysis software (NanoString Technologies, Inc.).

2.5. Statistical Analysis

Analysis of variance (ANOVA) of the logs of gene expression counts was used to summarize the data from the fins, head kidney and liver. Fish was fitted as a random effect, and treatment, tissue type and their interaction as fixed effects. Fisher’s least significant differences were also calculated between the log-transformed expressions for different genes to compare treatments. To adjust for multiple testing, the significance level was set to 0.00033 (=0.05/(6*25)). The analyses were carried out using Genstat 20th edition (VSN International, Hemel Hempstead, UK).

3. Results

3.1. Gene Expression

The expression of genes varied considerably, and to avoid overloading the NanoString cartridges, the concentration of RNA added was low, with our previous study using 800 and 1450 ng of organ tissue [69]. This resulted in many genes on the panel having low counts, which could not be calibrated by the assay’s nSolver™ 2.0 software, as each gene requires 50 counts in the eight lanes containing the calibration sample. These genes had to be removed from the analysis, leaving 25 target genes and three reference genes. One of the reference genes gapdh was removed because of its variability in the samples, and it was treated as a target gene. The final target genes were normalized to three reference genes that were stable and passed calibration.

3.2. Short-Term Gene Expression Experiment

Mean gene counts are shown in Table 4 for snapper exposed to heating (up to 31 °C) and cooling temperature (down to 7 °C) for up to 37 h, along with fish kept at the acclimation temperature (18 °C), including fish that were temperature-sensitive (those that started to show signs of distress) and temperature-tolerant (those that survived the temperature extreme). The mean counts ranged from 0 to 130,275.
There were 20 significant changes in genes when comparing heating- and cooling-treated fish to the control group and when comparing temperature-tolerant snapper to temperature-sensitive snapper for each treatment.
The temperature effects on gene expression varied across tissue types and the stressor type (e.g., heating versus cooling). In general, there were only differences in gene expression between tolerant and sensitive snapper with the heating treatment. For example, gsr, hsp70, igf2 and ptgs2 were expressed at significantly different levels when comparing heat-sensitive with heat-tolerant fish in at least one tissue type. In contrast, the expression did not differ between cold-sensitive and cold-tolerant fish in any tissue (Figure 2, Figure 3 and Figure 4 and Table 4). The most consistent gene expressed across tissues was cry1-like. This gene resulted in a significantly lower expression with heating treatments than the control group and significantly higher expression with cooling treatments than the control group.

3.3. Genes Affecting Tolerance to Temperature Extremes

An additional statistical analysis (ANOVA) was conducted to determine which genes had a higher tolerance to temperature extremes, taking into account all tissue types. More genes appeared to influence tolerance to extreme heating conditions. These genes were muc18-like (p = 0.025), cry1-like (p = 0.013), gsr (p ≤ 0.001), hsp70 (p = 0.005), igf2 (p = 0.035), ucp2-like (p = 0.011), prdx1 (p = 0.041), ptgs2 (p ≤ 0.001) and sod (p = 0.027), whilst only gsr (p = 0.046), hsp70 (p = 0.007) and hsp90 (p = 0.007) appeared to influence tolerance to cold temperature extremes.

4. Discussion

Here, we developed a set of 25 candidate stress genes for snapper fin, liver and head kidney tissues to detect signs of stress rapidly (Aim 1). We explored these candidate genes relative to three reference genes to determine if potential stress and immune genes were linked to the tolerance of fish to extreme temperature changes (Aim 2).
Our literature search revealed that stress responses affect numerous genes and are dependent on the stressor and the species of fish (summarized in Table 2). For example, overcrowding stress in gilthead seabream modulated the expression of actb (decreased expression), c3 (increase expression) and prdx1 (decreased expression) in skin tissue [41], whereas post-sediment exposure in gilthead seabream, the expression of gsr and il1b decreased in liver and skin tissue, hamp in head kidney and csfr1 in both skin and head kidney [9]. Our previous research showed that actb, cry1, gpx2, hsp70, hsp90, ucp2 and soc3 expression in snapper white muscle tissue correlated with temperature changes when exposed to high and low temperatures [23]. Another study exposing grass carp to high and low temperatures showed increases in antioxidant enzyme (gst, gpx1 and gsr) expression in the liver at high temperatures but not low temperatures [49]. In summary, research into stress response genes was limited in snapper; however, some studies investigated stress responses in phylogenetically close fish species, although the stressors varied among research studies.
When analysing the tissues from the temperature experiment, we found that nine genes influenced tolerance to extreme heating conditions compared with just three to extreme cooling conditions. muc18-like was expressed significantly higher in heat-tolerant fish fin compared with heat-sensitive fish, presumably because this gene leads to the upregulation of mucin production (a first-line defence response against pathogens), suggesting that heat-tolerant snapper have heightened immune defences. cry1-like was shown to significantly affect survival at extreme heating conditions. This is in line with previous work on this species, where cry1 was shown to be modulated in response to high and low temperatures [23]. gsr expression increased in the liver and head kidney of heat-tolerant snapper compared with heat-sensitive snapper. This gene produces an antioxidant enzyme that aids in the first line of defence against reactive oxygen species (ROS) [43], indicating that heat-tolerant fish are more adapted to deal with ROS stress, which may aid survival in temperature extremes. Conversely, a down-regulation of gsr was observed in the liver of cold-tolerant snapper, showing that increases in this gene may not always aid survival and could be dependent on the type of stress applied (e.g., heating versus cooling). hsp90 mean expression was often lower in the tolerant snapper at both temperature extremes, with the exception being in the head kidney of heat-tolerant snapper. Previous research has shown that this gene increases at temperature extremes in the white muscle tissue of snapper and supposedly increases protection from oxidative stress [23]; therefore, it is unclear why we observed a decrease in tolerant fish, unless these fish did not experience as much oxidative stress via other mechanisms. igf2 was down-regulated in the liver of heat-tolerant fish compared with heat-sensitive fish, but it is not clear if this may aid survival. Additionally, ucp2-like decreased in the fins of heat-tolerant fish. This gene is involved in the maintenance of oxidative processes inside cells [37]. This may indicate that heat-tolerant snapper are not as exposed to oxidative stress, which may aid their survival. However, prdx1 increased in the head kidney of heat-tolerant snapper; this gene plays a role in the maintenance of oxidative and anti-oxidative processes in cells [37]. ptgs2 plays a key role in inflammation in fish [61]. It increased in the liver of heat-tolerant fish, which may suggest a higher expression of this gene aids survival at hotter temperature extremes. Lastly, sod decreased in the liver of heat-tolerant fish, which, owing to its role in the first line of defence against ROS, supports the theory that heat-tolerant snapper experience less ROS stress. In summary, there appear to be some genes that offer a survival advantage to extreme heat (e.g., ptgs2, prdx1 and muc18-like); however, in general, it may be that these fish are better adapted to avoid oxidative-related stress than their sensitive counterparts. The general down-regulation of genes involved in stress protection in cold-tolerant snapper may also be indicative of the same lack of oxidative stress.
One limitation of this study is that annotations for the snapper and gilthead seabream genomes are still limited, so the results must be interpreted with some caution. Work is currently underway to use an improved genome assembly for snapper [70] to add improved gene annotations, and this may support future efforts to develop an improved panel. Also, genes with -like in their name have been discussed as if they were the gene. Additionally, this study used captive fish, which may differ from wild fish, and this could mean that stress responses were limited or exacerbated [71,72]. Identifying genetic traits that increase tolerance to temperature changes carries significant applied value as this knowledge can be used to selectively breed snapper for these traits to improve resilience to temperature fluctuations and ultimately to make this a more commercially viable aquaculture species. This is urgently needed in New Zealand because of the increasing impacts of climate change on the aquaculture sector [73,74,75].
To summarize, overall, we present a key set of 25 stress- and immune-related genes in various tissues, along with three reference genes, to explore their changes when snappers were exposed to increasing and decreasing temperatures. Twenty of the twenty-five genes did change significantly, demonstrating the significant impact of water temperature on stress and immune responses. We document 10 key gene biomarkers that could be used to predict genotypes that are more tolerant to extreme temperature changes. We recommend that future work should focus on improving the annotation of the snapper genome and ensuring that the genes identified here confer to protein production changes in snapper tissues. In addition, more studies on a wider range of snapper from various locations around New Zealand, plus individuals from other species, are needed to determine if the genes identified could serve as a general tool for monitoring fish health under thermal stress conditions. Taken together, our novel NanoString tool can be used to monitor stress in snapper rapidly and can possibly be transferred to closely related teleost fishes. Applications of this tool could be used to provide insights into the stress resilience of wild populations and help with the selection of grow-out locations for aquaculture.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/genes15111390/s1: Table S1. Search strategies and results.

Author Contributions

K.L.B.-H. designed this research, collated a list of snapper gene targets from the literature on similar fish species, extracted RNA, prepared the samples for gene expression analysis, analysed samples for relative gene expression counts, collated all the data, prepared the figures and wrote this manuscript. C.K.F. contributed to the design of this study, prepared and submitted the animal ethics publication and conducted the animal trial, including tissue collection and sample preparation for gene expression analysis. R.N.C. identified gene targets in the snapper transcriptome. D.I.H. completed the statistical analysis of the data. M.W. obtained funding, supervised C.K.F. and conceived the initial idea for this study, contributed to the design of this study and contributed to this manuscript with her expertise in snapper biology. All authors have read and agreed to the published version of the manuscript.

Funding

New Zealand Ministry of Business, Innovation and Employment (MBIE) contestable Research Funding for project titled “Accelerated breeding for enhanced seafood production P/532008/01” (C11X1603).

Institutional Review Board Statement

All procedures performed in studies involving animals were in accordance with the ethical standards of the institution at which the studies were conducted and were approved by the Animal Ethics Committee of the University of Auckland (reference 002169).

Data Availability Statement

The data generated and analysed in this study are available upon request from the corresponding author. Access to these data is contingent upon obtaining appropriate consent from the guardians (kaitiaki) of snapper, the Māori indigenous people of New Zealand, to honour their role as stewards of this taonga (treasured species). Potential requestors must provide a detailed explanation of their intended research purpose, including the potential outcomes and benefits of their work. Additionally, requestors are expected to outline any benefit-sharing arrangements before data access can be requested. This ensures that the use and reuse of the data respects the cultural values and guardianship of Māori over natural resources.

Acknowledgments

We gratefully thank MBIE for contestable research funding for the project titled “Accelerated breeding for enhanced seafood production” (C11X1603), who funded this research. Also, Warren Fantham, Liam Hegarty and Morgan Puklowski are acknowledged for the rearing of the experimental fish and maintaining temperature conditions throughout the experiment. We further thank Dafni Anastasiadi, David Ashton, Erin Bell, Benie Chambers, Sharon Ford, Igor Ruza, Belinda Timms, Therese Wells and Matt Wylie for their assistance in sampling fish. We would like to acknowledge Marcus Davy and Roy Storey for their work in developing a genome blast server to aid in primer design, Tony Corbett for designing the graphical abstracts, Simon Deroles and Dafni Anastasiadi for reviewing this manuscript, Nayer Ngmetua for help with RNA extractions and Axel Heiser and Neville Haack for their NanoString expertise.

Conflicts of Interest

[The PFR Author’s] are employees and a student of The New Zealand Institute for Plant and Food Research Limited (“Plant & Food Research”) and are directly involved in the Enhancing production of New Zealand’s seafood sector using accelerated breeding techniques research programme which is primarily funded through the New Zealand Government’s Ministry of Business, Innovation and Employment (MBIE) Endeavour Fund. PFR authors: Kerry Louise Bentley-Hewitt, Christina Katrin Flammensbeck (student), Ross Crowhurst, Duncan Ian Hedderley, Maren Wellenreuther.

References

  1. Tort, L. Stress and immune modulation in fish. Dev. Comp. Immunol. 2011, 35, 1366–1375. [Google Scholar] [CrossRef] [PubMed]
  2. De Nadal, E.; Ammerer, G.; Posas, F. Controlling gene expression in response to stress. Nat. Rev. Genet. 2011, 12, 833–845. [Google Scholar] [CrossRef] [PubMed]
  3. Helmuth, B.; Harley, C.; Halpin, P.; O’Donnell, M.; Hofmann, G.; Blanchette, C. Climate change and latitudinal patterns of intertidal thermal stress. Science 2002, 298, 1015–1017. [Google Scholar] [CrossRef]
  4. Perry, A.L.; Low, P.J.; Ellis, J.R.; Reynolds, J.D. Climate change and distribution shifts in marine fishes. Science 2005, 308, 1912. [Google Scholar] [CrossRef]
  5. Szwejser, E.; Verburg-van Kemenade, B.M.L.; Maciuszek, M.; Chadzinska, M. Estrogen-dependent seasonal adaptations in the immune response of fish. Horm. Behav. 2017, 88, 15–24. [Google Scholar] [CrossRef]
  6. Kordon, A.O.; Karsi, A.; Pinchuk, L. Innate immune responses in fish: Antigen presenting cells and professional phagocytes. Turk. J. Fish. Aquat. Sci. 2018, 18, 1123–1139. [Google Scholar] [CrossRef]
  7. Salinas, I.; Magadan, S. Omics in fish mucosal immunity. Dev. Comp. Immunol. 2017, 75, 99–108. [Google Scholar] [CrossRef] [PubMed]
  8. Anastasiadi, D.; Díaz, N.; Piferrer, F. Small ocean temperature increases elicit stage-dependent changes in DNA methylation and gene expression in a fish, the European sea bass. Sci. Rep. 2017, 7, 12401. [Google Scholar] [CrossRef]
  9. Ben Hamed, S.; Guardiola, F.; Cuesta, A.; Martinez, S.; Jose Martinez-Sanchez, M.; Perez-Sirvent, C.; Angeles Esteban, M. Head kidney, liver and skin histopathology and gene expression in gilthead seabream (Sparus aurata L.) exposed to highly polluted marine sediments from portman bay (spain). Chemosphere 2017, 174, 563–571. [Google Scholar] [CrossRef]
  10. Anastasiadi, D.; Beemelmanns, A. Development of epigenetic biomarkers in aquatic organisms. In Epigenetics in Aquaculture; John Wiley & Sons Ltd.: Hoboken, NJ, USA, 2022. [Google Scholar]
  11. Papa, Y.; Oosting, T.; Valenza-Troubat, N.; Wellenreuther, M.; Ritchie, P.A. Genetic stock structure of New Zealand fish and the use of genomics in fisheries management: An overview and outlook. N. Z. J. Zool. 2021, 48, 1–31. [Google Scholar] [CrossRef]
  12. Parsons, D.; Sim-Smith, C.; Cryer, M.; Francis, M.; Hartill, B.; Jones, E.; Le Port, A.; Lowe, M.; McKenzie, J.; Morrison, M. Snapper (Chrysophrys auratus): A review of life history and key vulnerabilities in New Zealand. N. Z. J. Mar. Fresh. 2014, 48, 256–283. [Google Scholar] [CrossRef]
  13. Tabata, K.; Taniguchi, N. Differences between Pagrus major and Pagrus auratus through mainly mtDNA control region analysis. Fish. Sci. 2000, 66, 9–18. [Google Scholar] [CrossRef]
  14. Murata, O.; Harada, T.; Miyashita, S.; Izumi, K.-I.; Maeda, S.; Kato, K.; Kumai, H. Selective breeding for growth in red sea bream. Fish. Sci. 1996, 62, 845–849. [Google Scholar] [CrossRef]
  15. Kato, K. Breeding studies on red sea bream Pagrus major: Mass selection to genome editing. Fish. Sci. 2023, 89, 103–119. [Google Scholar] [CrossRef]
  16. Foscarini, R. A review: Intensive farming procedure for red sea bream (Pagrus major) in Japan. Aquaculture 1988, 72, 191–246. [Google Scholar] [CrossRef]
  17. Crossland, J. The biology of the New Zealand snapper. Occassional Publ.-Fish. Res. Div. 1981, 23, 1–16. [Google Scholar]
  18. Ayling, T.; Cox, G.C. Collins Guide to the Sea Fishes of New Zealand; Collins: Auckland, New Zealand, 1987; p. 343. [Google Scholar]
  19. Francis, M.P. Coastal Fishes of New Zealand. An Identification Guide, 3rd ed.; Reed Books: Auckland, New Zealand, 2001; Volume 3. [Google Scholar]
  20. Leach, F. Fishing in Pre-European New Zealand. N. Z. J. Archaeol. Spec. Publ. 2007, 15, 469–471. [Google Scholar]
  21. Graham, D. A Treasury of New Zealand Fish; AH AW Reed: Wellingt, New Zealand, 1953. [Google Scholar]
  22. Francis, M.P. Geographic distribution of marine reef fishes in the New Zealand region. N. Z. J. Mar. Fresh. 1996, 30, 30–55. [Google Scholar] [CrossRef]
  23. Wellenreuther, M.; Le Luyer, J.; Cook, D.; Ritchie, P.A.; Bernatchez, L. Domestication and temperature modulate gene expression signatures and growth in the Australasian snapper Chrysophrys auratus. G3 Genes Genomes Genet. 2019, 9, 105–116. [Google Scholar] [CrossRef]
  24. Moran, D.; Schleyken, J.; Flammensbeck, C.; Fantham, W.; Ashton, D.; Wellenreuther, M. Enhanced survival and growth in the selectively bred Chrysophrys auratus (Australasian snapper, tāmure). Aquaculture 2023, 563, 738970. [Google Scholar] [CrossRef]
  25. Ferrell, D. Assessment of the Fishery for Snapper (Pagrus auratus) in Queensland and New South Wales; Final Report, FRDC Project 93/074. Available online: https://www.frdc.com.au/sites/default/files/products/1993-074-DLD.pdf (accessed on 30 July 2019).
  26. Bowering, L.R.; McArley, T.J.; Devaux, J.B.; Hickey, A.J.; Herbert, N.A. Metabolic resilience of the Australasian snapper (Chrysophrys auratus) to marine heatwaves and hypoxia. Front. Physiol. 2023, 14, 1215442. [Google Scholar] [CrossRef] [PubMed]
  27. Ashton, D.T.; Hilario, E.; Jaksons, P.; Ritchie, P.A.; Wellenreuther, M. Genetic diversity and heritability of economically important traits in captive Australasian snapper (Chrysophrys auratus). Aquaculture 2019, 505, 190–198. [Google Scholar] [CrossRef]
  28. Smith, P.J.; Francis, R.I.C.C. Relationship between Esterase Gene-Frequencies and Length in Juvenile Snapper Chrysophrys-Auratus Forster. Anim. Blood Groups Biochem. Genet. 1983, 14, 151–158. [Google Scholar] [CrossRef]
  29. Smith, P.J.; Francis, R.I.C.C.; Paul, L.J. Genetic-Variation and Population-Structure in the New-Zealand Snapper. N. Z. J. Mar. Fresh. 1978, 12, 343–350. [Google Scholar] [CrossRef]
  30. Ashton, D.T.; Ritchie, P.A.; Wellenreuther, M. High-Density Linkage Map and QTLs for Growth in Snapper (Chrysophrys auratus). G3-Genes Genom Genet. 2019, 9, 1027–1035. [Google Scholar] [CrossRef] [PubMed]
  31. Catanach, A.; Crowhurst, R.; Deng, C.; David, C.; Bernatchez, L.; Wellenreuther, M. The genomic pool of standing structural variation outnumbers single nucleotide polymorphism by threefold in the marine teleost Chrysophrys auratus. Mol. Ecol. 2019, 28, 1210–1223. [Google Scholar] [CrossRef] [PubMed]
  32. Georgakopoulou, E.; Katharios, P.; Divanach, P.; Koumoundouros, G. Effect of temperature on the development of skeletal deformities in Gilthead seabream (Sparus aurata Linnaeus, 1758). Aquaculture 2010, 308, 13–19. [Google Scholar] [CrossRef]
  33. Bevelander, G.S.; Guerreiro, P.M.; Spanings, T.; Flik, G. Differential expression of PTHrP and its receptor in pituitary gland and gills in estradiol-treated gilthead sea bream (Sparus auratus, L.). Gen. Comp. Endocrinol. 2011, 173, 199–204. [Google Scholar] [CrossRef]
  34. Mininni, A.N.; Milan, M.; Ferraresso, S.; Petochi, T.; Di Marco, P.; Marino, G.; Livi, S.; Romualdi, C.; Bargelloni, L.; Patarnello, T. Liver transcriptome analysis in gilthead sea bream upon exposure to low temperature. BMC Genom. 2014, 15, 765. [Google Scholar] [CrossRef]
  35. Fielder, D.S.; Bardsley, W.J.; Allan, G.L.; Pankhurst, P.M. The effects of salinity and temperature on growth and survival of Australian snapper, Pagrus auratus larvae. Aquaculture 2005, 250, 201–214. [Google Scholar] [CrossRef]
  36. Piazzon, M.C.; Mladineo, I.; Naya-Català, F.; Dirks, R.P.; Jong-Raadsen, S.; Vrbatović, A.; Hrabar, J.; Pérez-Sánchez, J.; Sitjà-Bobadilla, A. Acting locally-affecting globally: RNA sequencing of gilthead sea bream with a mild Sparicotyle chrysophrii infection reveals effects on apoptosis, immune and hypoxia related genes. BMC Genom. 2019, 20, 200. [Google Scholar] [CrossRef] [PubMed]
  37. Espinosa, C.; Cuesta, A.; Angeles Esteban, M. Effects of dietary polyvinylchloride microparticles on general health, immune status and expression of several genes related to stress in gilthead seabream (Sparus aurata L.). Fish Shellfish Immunol. 2017, 68, 251–259. [Google Scholar] [CrossRef] [PubMed]
  38. Dawood, M.A.O.; Koshio, S.; Ishikawa, M.; Yokoyama, S. Effects of heat killed Lactobacillus plantarum (LP20) supplemental diets on growth performance, stress resistance and immune response of red sea bream, Pagrus major. Aquaculture 2015, 442, 29–36. [Google Scholar] [CrossRef]
  39. Estruch, G.; Carmen Collado, M.; Monge-Ortiz, R.; Tomas-Vidal, A.; Jover-Cerda, M.; Penaranda, D.S.; Perez Martinez, G.; Martinez-Llorens, S. Long-term feeding with high plant protein based diets in gilthead seabream (Sparus aurata, L.) leads to changes in the inflammatory and immune related gene expression at intestinal level. BMC Vet. Res. 2018, 14, 302. [Google Scholar] [CrossRef]
  40. Brinchmann, M.F. Immune relevant molecules identified in the skin mucus of fish using-omics technologies. Mol. Biosyst. 2016, 12, 2056–2063. [Google Scholar] [CrossRef]
  41. Cordero, H.; Morcillo, P.; Cuesta, A.; Brinchmann, M.F.; Esteban, M.A. Differential proteome profile of skin mucus of gilthead seabream (Sparus aurata) after probiotic intake and/or overcrowding stress. J. Proteom. 2016, 132, 41–50. [Google Scholar] [CrossRef]
  42. Reyes-Becerril, M.; Guardiola, F.; Rojas, M.; Ascencio-Valle, F.; Angeles Esteban, M. Dietary administration of microalgae navicula sp affects immune status and gene expression of gilthead seabream (Sparus aurata). Fish Shellfish Immunol. 2013, 35, 883–889. [Google Scholar] [CrossRef]
  43. Kammer, A.R.; Orczewska, J.I.; Brien, K.M. Oxidative stress is transient and tissue specific during cold acclimation of threespine stickleback. J. Exp. Biol. 2011, 214, 1248. [Google Scholar] [CrossRef] [PubMed]
  44. Perez-Sanchez, J.; Estensoro, I.; Redondo, M.J.; Calduch-Giner, J.A.; Kaushik, S.; Sitja-Bobadilla, A. Mucins as diagnostic and prognostic biomarkers in a fish-parasite model: Transcriptional and functional analysis. PLoS ONE 2013, 8, e65457. [Google Scholar] [CrossRef]
  45. Janeway, C.A., Jr.; Travers, P.; Walport, M.; Shlomchik, M.J. The complement system and innate immunity. In Immunobiology: The Immune System in Health and Disease; Garland Science: New York, NY, USA, 2001; Volume 5. [Google Scholar]
  46. Mansour, A.T.; Espinosa, C.; García-Beltrán, J.M.; Miao, L.; Francisco, D.C.C.; Alsaqufi, A.S.; Esteban, M.Á. Dietary supplementation of drumstick tree, Moringa oleifera, improves mucosal immune response in skin and gills of seabream, Sparus aurata, and attenuates the effect of hydrogen peroxide exposure. Fish Physiol. Biochem. 2020, 46, 981–996. [Google Scholar] [CrossRef]
  47. Li, C.; Wang, R.; Su, B.; Luo, Y.; Terhune, J.; Beck, B.; Peatman, E. Evasion of mucosal defenses during Aeromonas hydrophila infection of channel catfish (Ictalurus punctatus) skin. Dev. Comp. Immunol. 2013, 39, 447–455. [Google Scholar] [CrossRef] [PubMed]
  48. Turkmen, S.; Hernandez-Cruz, C.M.; Zamorano, M.J.; Fernandez-Palacios, H.; Montero, D.; Afonso, J.M.; Izquierdo, M. Long-chain pufa profiles in parental diets induce long-term effects on growth, fatty acid profiles, expression of fatty acid desaturase 2 and selected immune system-related genes in the offspring of gilthead seabream. Br. J. Nutr. 2019, 122, 25–38. [Google Scholar] [CrossRef] [PubMed]
  49. Li, Z.H.; Li, P.; Wu, Y.H. Regulation of glutathione-dependent antioxidant defense system of grass carp Ctenopharyngodon idellaunder the combined stress of mercury and temperature. Environ. Sci. Pollut. Res. 2021, 28, 1689–1696. [Google Scholar] [CrossRef]
  50. Kokou, F.; Adamidou, S.; Karacostas, L.; Sarropoulou, E. Sample size matters in dietary gene expression studies-a case study in the gilthead sea bream (Sparus aurata L.). Aquac. Rep. 2016, 3, 82–87. [Google Scholar] [CrossRef][Green Version]
  51. Rehberger, K.; Werner, I.; Hitzfeld, B.; Segner, H.; Baumann, L. 20 years of fish immunotoxicology—What we know and where we are. Crit. Rev. Toxicol. 2017, 47, 509–535. [Google Scholar] [CrossRef] [PubMed]
  52. Douxfils, J.; Mandiki, S.N.; Marotte, G.; Wang, N.; Silvestre, F.; Milla, S.; Henrotte, E.; Vandecan, M.; Rougeot, C.; Mélard, C.; et al. Does domestication process affect stress response in juvenile Eurasian perch Perca fluviatilis? Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2011, 159, 92–99. [Google Scholar] [CrossRef]
  53. Montserrat, N.; Capilla, E.; Navarro, I.; Gutiérrez, J. Metabolic Effects of Insulin and IGFs on Gilthead Sea Bream (Sparus aurata) Muscle Cells. Front. Endocrinol. 2012, 3, 55. [Google Scholar] [CrossRef]
  54. Jin, J.W.; Kim, Y.C.; Hong, S.; Kim, M.S.; Jeong, J.B.; Jeong, H.D. Cloning and expression analysis of innate immune genes from red sea bream to assess different susceptibility to megalocytivirus infection. J. Fish Dis. 2017, 40, 583–595. [Google Scholar] [CrossRef]
  55. Grasso, V.; Padilla, D.; Bravo, J.; Roman, L.; Rosario, I.; Acosta, B.; Vega, B.; El Aamri, F.; Escuela, O.; Ramos-Vivas, J.; et al. Immunization of sea bream (Sparus aurata) juveniles against photobacterium damselae subsp piscicida by short bath: Effect on some pro-inflammatory molecules and the mx gene expression. Fish Shellfish Immunol. 2015, 46, 292–296. [Google Scholar] [CrossRef]
  56. Chen, Z.; Ceballos-Francisco, D.; Guardiola, F.A.; Esteban, M.Á. Influence of skin wounds on the intestinal inflammatory response and barrier function: Protective role of dietary Shewanella putrefaciens SpPdp11 administration to gilthead seabream (Sparus aurata L.). Fish Shellfish Immunol. 2020, 99, 414–423. [Google Scholar] [CrossRef]
  57. Abdel-Latif, M.; Sakran, T.; Badawi, Y.K.; Abdel-Hady, D.S. Influence of Moringa oleifera extract, vitamin C, and sodium bicarbonate on heat stress-induced HSP70 expression and cellular immune response in rabbits. Cell Stress Chaperones 2018, 23, 975–984. [Google Scholar] [CrossRef] [PubMed]
  58. Perez-Cordon, G.; Estensoro, I.; Benedito-Palos, L.; Alvar Calduch-Giner, J.; Sitja-Bobadilla, A.; Perez-Sanchez, J. Interleukin gene expression is strongly modulated at the local level in a fish-parasite model. Fish Shellfish Immunol. 2014, 37, 201–208. [Google Scholar] [CrossRef] [PubMed]
  59. Wang, T.; Kono, T.; Monte, M.M.; Kuse, H.; Costa, M.M.; Korenaga, H.; Maehr, T.; Husain, M.; Sakai, M.; Secombes, C.J. Identification of IL-34 in teleost fish: Differential expression of rainbow trout IL-34, MCSF1 and MCSF2, ligands of the MCSF receptor. Mol. Immunol. 2013, 53, 398–409. [Google Scholar] [CrossRef] [PubMed]
  60. Cordero, H.; Cuesta, A.; Meseguer, J.; Esteban, M.A. Characterization of the gilthead seabream (Sparus aurata L.) immune response under a natural lymphocystis disease virus outbreak. J. Fish Dis. 2016, 39, 1467–1476. [Google Scholar] [CrossRef] [PubMed]
  61. Wang, T.; Yan, J.; Xu, W.; Ai, Q.; Mai, K. Characterization of Cyclooxygenase-2 and its induction pathways in response to high lipid diet-induced inflammation in Larmichthys crocea. Sci. Rep. 2016, 6, 19921. [Google Scholar] [CrossRef][Green Version]
  62. Stafford, J.L.; Belosevic, M. Transferrin and the innate immune response of fish: Identification of a novel mechanism of macrophage activation. Dev. Comp. Immunol. 2003, 27, 539–554. [Google Scholar] [CrossRef]
  63. Pellizzari, C.; Krasnov, A.; Afanasyev, S.; Vitulo, N.; Franch, R.; Pegolo, S.; Patarnello, T.; Bargelloni, L. High mortality of juvenile gilthead sea bream (Sparus aurata) from photobacteriosis is associated with alternative macrophage activation and anti-inflammatory response: Results of gene expression profiling of early responses in the head kidney. Fish Shellfish Immunol. 2013, 34, 1269–1278. [Google Scholar] [CrossRef]
  64. Picchietti, S.; Guerra, L.; Selleri, L.; Buonocore, F.; Abelli, L.; Scapigliati, G.; Mazzini, M.; Fausto, A.M. Compartmentalisation of T cells expressing CD8alpha and TCRbeta in developing thymus of sea bass Dicentrarchus labrax (L.). Dev. Comp. Immunol. 2008, 32, 92–99. [Google Scholar] [CrossRef]
  65. Picchietti, S.; Fausto, A.M.; Randelli, E.; Carnevali, O.; Taddei, A.R.; Buonocore, F.; Scapigliati, G.; Abelli, L. Early treatment with Lactobacillus delbrueckii strain induces an increase in intestinal T-cells and granulocytes and modulates immune-related genes of larval Dicentrarchus labrax (L.). Fish Shellfish Immunol. 2009, 26, 368–376. [Google Scholar] [CrossRef]
  66. Palti, Y. Toll-like receptors in bony fish: From genomics to function. Dev. Comp. Immunol. 2011, 35, 1263–1272. [Google Scholar] [CrossRef]
  67. Heiser, A.; LeBlanc, S.J.; McDougall, S. Pegbovigrastim treatment affects gene expression in neutrophils of pasture-fed, periparturient cows. J. Dairy Sci. 2018, 101, 8194–8207. [Google Scholar] [CrossRef] [PubMed]
  68. Bentley-Hewitt, K.L.; Hedderley, D.I.; Monro, J.; Martell, S.; Smith, H.; Mishra, S. Comparison of quantitative real-time polymerase chain reaction with NanoString(R) methodology using adipose and liver tissues from rats fed seaweed. New Biotechnol. 2016, 33, 380–386. [Google Scholar] [CrossRef]
  69. Bentley-Hewitt, K.L.; Perrott, M.; Butts, C.A.; Hedderley, D.I.; Stoklosinski, H.M.; Parkar, S.G. Influence of kiwifruit on gastric and duodenal inflammation-related gene expression in aspirin-induced gastric mucosal damage in rats. Sci. Rep. 2020, 10, 13055. [Google Scholar] [CrossRef]
  70. Blommaert, J.; Sandoval-Castillo, J.; Beheregaray, L.; Wellenreuther, M. Peering into the gaps: Long-read sequencing illuminates structural variants and genomic evolution in the Australasian snapper. Genomics 2024, 116, 110929. [Google Scholar] [CrossRef] [PubMed]
  71. Teletchea, F.; Fontaine, P. Levels of domestication in fish: Implications for the sustainable future of aquaculture. Fish Fish. 2014, 15, 181–195. [Google Scholar] [CrossRef]
  72. Mignon-Grasteau, S.; Boissy, A.; Bouix, J.; Faure, J.-M.; Fisher, A.D.; Hinch, G.N.; Jensen, P.; Le Neindre, P.; Mormède, P.; Prunet, P. Genetics of adaptation and domestication in livestock. Livest. Prod. Sci. 2005, 93, 3–14. [Google Scholar] [CrossRef]
  73. Chiswell, S.M.; Sutton, P.J. Relationships between long-term ocean warming, marine heat waves and primary production in the New Zealand region. N. Z. J. Mar. Fresh. 2020, 54, 614–635. [Google Scholar] [CrossRef]
  74. Law, C.S.; Rickard, G.J.; Mikaloff-Fletcher, S.E.; Pinkerton, M.H.; Behrens, E.; Chiswell, S.M.; Currie, K. Climate change projections for the surface ocean around New Zealand. N. Z. J. Mar. Fresh. 2018, 52, 309–335. [Google Scholar] [CrossRef]
  75. Ministry for the Enviroment. Climate Change Impacts in New Zealand. Available online: https://environment.govt.nz/publications/climate-change-impacts-on-new-zealand/ (accessed on 14 January 2021).
Figure 1. Schematic overview of the experimental design.
Figure 1. Schematic overview of the experimental design.
Genes 15 01390 g001
Figure 2. Mean gene counts (n = 10) from fin tissue are shown with standard errors for heat-sensitive, heat-tolerant, cold-sensitive, cold-tolerant and control fish. A significant difference (p < 0.00033) is indicated by * for differences compared with the relevant control, whilst ^ indicates a difference between the heat-sensitive and heat-tolerant groups.
Figure 2. Mean gene counts (n = 10) from fin tissue are shown with standard errors for heat-sensitive, heat-tolerant, cold-sensitive, cold-tolerant and control fish. A significant difference (p < 0.00033) is indicated by * for differences compared with the relevant control, whilst ^ indicates a difference between the heat-sensitive and heat-tolerant groups.
Genes 15 01390 g002
Figure 3. Mean gene counts (n = 10) from liver tissue are shown with standard errors for heat-sensitive, heat-tolerant, cold-sensitive, cold-tolerant and control fish. A significant difference (p < 0.00033) is indicated by * for differences compared with the relevant control, whilst ^ indicates a difference between the heat-sensitive and heat-tolerant groups.
Figure 3. Mean gene counts (n = 10) from liver tissue are shown with standard errors for heat-sensitive, heat-tolerant, cold-sensitive, cold-tolerant and control fish. A significant difference (p < 0.00033) is indicated by * for differences compared with the relevant control, whilst ^ indicates a difference between the heat-sensitive and heat-tolerant groups.
Genes 15 01390 g003
Figure 4. Mean gene counts (n = 10) from head kidney tissue are shown with standard errors for heat-sensitive, heat-tolerant, cold-sensitive, cold-tolerant and control fish. A significant difference (p < 0.00033) is indicated by * for differences compared with the relevant control.
Figure 4. Mean gene counts (n = 10) from head kidney tissue are shown with standard errors for heat-sensitive, heat-tolerant, cold-sensitive, cold-tolerant and control fish. A significant difference (p < 0.00033) is indicated by * for differences compared with the relevant control.
Genes 15 01390 g004
Table 1. Length (mm, mean ± SE) and weight (g, mean ± SE) measurements of 50 juvenile snapper exposed to temperature challenge and sampled for gene expression analysis.
Table 1. Length (mm, mean ± SE) and weight (g, mean ± SE) measurements of 50 juvenile snapper exposed to temperature challenge and sampled for gene expression analysis.
Treatment GroupSample Size (n)Fork Length [mm]Weight [g]
Control10111.7 ± 329.8 ± 3
Cooling: Temperature-sensitive10107.1 ± 426.2 ± 3
Cooling: Temperature-tolerant10116.0 ± 433.7 ± 4
Heating: Temperature-sensitive10108.1 ± 325.1 ± 2
Heating: Temperature-tolerant10113.6 ± 330.9 ± 2
Table 2. Genes and their potential function and/or relation to fish stress and immune responses.
Table 2. Genes and their potential function and/or relation to fish stress and immune responses.
GeneFunction/Role in Stress or Immune Responses
Actin cytoplasmic 1 (actb)ACTB is important for phagocytosis [40] and is decreased in gilthead seabream skin owing to over-crowding stress [41]. actb is correlated with temperature changes in white muscle tissue of snapper exposed to high and low temperatures [23].
Alkaline phosphatase tissue-nonspecific isozyme isoform X1 (alpl)Involved in intestinal defence [42]. A plant-based diet decreased alkaline phosphatase in gilthead sea bream, which may reflect decreased innate immunity and be a reason for higher mortality [39].
Catalase isoform X2 (cat)An antioxidant enzyme used in toxicology as sensitive biomarkers and constitutes the first line of defence against reactive oxygen species (ROS) [43].
Cell surface glycoprotein MUC18-like isoform X (muc18)muc18 is the predominant mucin in the skin, gills and stomach in gilthead sea bream [44].
Complement C3-like A (c3-like)Central component of complement is cleaved into C3b, the main effector molecule of the complement system, and C3a, a peptide mediator of inflammation [45]. Moringa leaf increased c3 gene expression in gilthead sea bream post-hydrogen peroxide exposure [46]. c3 increased in the skin of gilthead seabream after overcrowding stress [41].
Complement component C6 (c6)Terminal complement protein, forms membrane attack complex and lysis certain pathogens and cells [45]. c6 decreased after Aeromonas hydrophila infection in catfish skin [47].
Complement component C8 α chain (c8a)Terminal complement protein, forms membrane attack complex and lysis certain pathogens and cells [45].
Cryptochrome-1-like (cry1-like)Circadian gene modulated by high and low temperatures in snapper [23].
Glyceraldehyde-3-phosphate dehydrogenase (gapdh)Involved in the breakdown of glucose for energy.
Glucocorticoid receptor-like (gcr-like)Regulates the stress response and binds heat shock proteins, such as HSP70 [48].
Glutathione S-transferase A (gsta)The glutathione-related antioxidant system is important for intercellular defence. gst increased in the liver at temperatures above 30 °C when grass carp were exposed for 28 days, but not with cold temperatures down to 15 °C [49].
Glutathione peroxidase 2 (gpx2)gpx2 is correlated with temperature changes in white muscle tissue of snapper exposed to high and low temperatures [23]. The glutathione-related antioxidant system is important for intercellular defence. gpx1 increased in the liver at temperatures below 20 °C when grass carp were exposed for 28 days, whilst temperatures of 25 °C and above did not change its expression [49].
Glutathione reductase mitochondrial isoform X2 (gsr)An antioxidant enzyme used in toxicology as a sensitive biomarker and constitutes the first line of defence against ROS [43]. gsr in the liver and skin tissue of gilthead seabream decreased post-sediment exposure [9]. The glutathione-related antioxidant system is important for intercellular defence. gsr increased in the liver at temperatures below 20 °C when grass carp were exposed for 28 days, whilst temperatures of 25 °C and above did not change its expression [49].
Heat shock cognate 70 kDa protein (hsp70)Involved in cytoprotection, cell survival and immune response. It is inducible throughout inflammation and represents an effort to avoid apoptosis [50]. hsp 90 and 70 increased at temperature extremes in snapper white muscle and offered protection from oxidative stress and apoptosis [23]. They facilitate a stress response by increasing binding of the steroid receptor [48].
Heat shock protein HSP 90-β isoform X2 (hsp90ab1)Involved in cytoprotection, cell survival and immune response. It is inducible throughout inflammation and represents an effort to avoid apoptosis [50]. hsp 90 and 70 increased at temperature extremes in snapper white muscle and offered protection from oxidative stress and apoptosis [23]. They facilitate a stress response by increasing binding of the steroid receptor [48]. Polyvinyl chloride microparticles decreased hsp90 in the liver of gilthead sea bream [37]. hsp90 increased after A. hydrophila infection in catfish skin [47].
Hepcidin (hamp)An antimicrobial peptide [51]. hamp in gilthead seabream head kidney decreased post-sediment exposure [9].
Insulin-like growth factor I isoform X1 (igf1)IGF1 stimulates natural killer cell function and macrophage production of ROS and cytokines [1]. IGF-1-can indicate higher growth [52].
Insulin-like growth factor II (igf2)IGF2 potentially stimulates muscle growth more than IGF1 [53].
Interferon-induced GTP-binding protein Mx-like B (mx-like)Viral-induced gene in red seabream [54].
Interleukin-1 β-like (il1b-like)Stimulates proliferation and activation of macrophages and T cells and initiates an acute phase response [5]. The stress response is activated by TNFalpha, IL1B, IL-6 and IL-12 [1]. It activates target cells by binding IL1 receptors on cell surfaces and triggers inflammation to cope with infection [55]. Hydrogen peroxide increased il1b and tnf-α (pro-inflammatory cytokines) in gilthead seabream [46]. Intestinal il1b increased post-skin wounds in gilthead seabream [56]. il1b in gilthead seabream liver and skin decreased post-sediment exposure [9]. il1b decreased after A. hydrophila infection in catfish skin [47].
Interleukin-6 isoform X1 (il6)The stress response is activated by IL6 [1].
Interleukin-10 (il-10)In mammals stress hormones inhibit T helper lymphocyte type 1 (Th1) responses and cause a shift to T helper lymphocyte type 2 (Th2), including increases in IL10, and cold shock in mammals increases IL10 [1]. Heat stress decreased IL-10 in the liver of rabbits [57].
Interleukin-12 subunit β-like (il12b)Induced in macrophages after bacterial and viral infections and is suggested to increase the cytolytic properties of T cells against viral-infected cells [5]. Secreted by antigen-presenting cells after the activation of pathogen and damage-associated molecular patterns. Induces natural killer cell interferon-γ production [58].
Interleukin-17D (il17d)A pro-inflammatory cytokine [51]. il17a increased after A. hydrophila infection in catfish skin [47].
Interleukin-34 isoform X1 A (il34)il-34 expression is induced by lipopolysaccharide, poly(I:C), il1b, interferon-γ, phytohaemagglutinin and parasitic infection in rainbow trout [59].
Macrophage colony-stimulating factor 1 receptor (csf1r)Intestinal csf1r increased post-skin wound in gilthead seabream [56]. csf1r in gilthead seabream head kidney decreased post-sediment exposure [9]. Infection with lymphocystis in gilthead seabream decreased csf1r expression in the skin and head kidney [60].
Mitochondrial uncoupling protein 2-like (ucp2-like)The mitochondria are the first responder to various stressors. UCP is involved in the maintenance of oxidative and anti-oxidative processes inside cells and polyvinyl chloride microparticles increased ucp1 in the liver of gilthead seabream [39]. ucp2 correlated with temperature changes in white muscle tissue of snapper exposed to high and low temperatures [23].
Mucin-2-like isoform X1 (muc2-like)Intestinal muc2 increased post-skin wound in gilthead seabream [56].
Nuclear factor NF-kappa-B p100 subunit isoform X1 (nfkb2)NFKB2 is a subunit of the NF-kappa-B transcription complex (NFKB), which plays a crucial role in biological processes such as inflammation, immunity, differentiation, cell growth, tumorigenesis and apoptosis.
Nuclear factor erythroid 2-related factor 2 (nrf2)Involved in antioxidant regulation.
Peroxiredoxin-1 (pdrx1)PRDX is involved in the maintenance of oxidative and anti-oxidative processes inside cells [37]. pdrx1 correlated with temperature changes in white muscle tissue of snapper exposed to high and low temperatures [23]. pdrx1 decreased in gilthead seabream skin post-overcrowding stress [41].
Peroxiredoxin-1-like (pdrx1-like)PRDX is involved in the maintenance of oxidative and anti-oxidative processes inside cells [37]. pdrx1 correlated with temperature changes in the white muscle tissue of snapper exposed to high and low temperatures [23].
Peroxiredoxin-5 mitochondrial (pdrx5)PRDX is involved in the maintenance of oxidative and anti-oxidative processes inside cells. pdrx5 decreased in the head kidney of gilthead seabream fed polyvinylchloride microparticles [37].
Prostaglandin G/H synthase 2 (ptgs2)Is a prostaglandin synthesis enzyme that plays a key role in inflammation in fish [61].
Serotransferrin-like (tf-like)Serotransferrin forms part of fish innate immunity and serves as an antimicrobial agent [62].
Stromal cell-derived factor 1 (cxcl12)Recruits IL10-producing lymphocytes and macrophages [63]. cxcl12b increased after A. hydrophila infection in catfish [47].
Superoxide dismutase [Cu-Zn] (sod1)An antioxidant enzyme used in toxicology as a sensitive biomarker, which constitutes the first line of defence against ROS [43]. sod increased after A. hydrophila infection in catfish skin [47].
Suppressor of cytokine signalling 3 (soc3)Negative feedback to inhibit pro-inflammatory cytokine signalling [63]. soc3 correlated with temperature changes in the white muscle tissue of snapper exposed to high and low temperatures [23].
T-cell surface glycoprotein CD8 α chain-like isoform X3 (cd8a-like)A seabass developmental study investigated genes (tcrb, cd8-α and cd4) indicative of T cell function and found that cd8-α was detected at 40–50 days post-hatching and continued to increase until 92 days post-hatching [64,65].
Thioredoxin-dependent peroxide reductase mitochondrial (prdx3)PRDX is involved in the maintenance of oxidative and anti-oxidative processes inside cells [37].
Toll-like receptor 2 isoform X1 (tlr2)Innate immune receptors that detect infections in mammals. TLR2 detects lipopeptides in fish [66].
Toll-like receptor 3 (tlr3)Innate immune receptors that detect infections. TLR3 has been shown to respond to double-stranded RNA (dsRNA) in mammals [66].
Toll-like receptor 5 (tlr5)Innate immune receptors that detect infections in mammals [66]. Recognizes bacterial flagellin. tlr5a decreased after A. hydrophila infection in catfish [47].
Transforming growth factor β-1 proprotein-like isoform X1 (tgfb1-like)In mammals, stress hormones inhibit Th1 responses and cause a shift to Th2, including increases in TGFB, and cold shock in mammals increases TGFB [1]. Mediates resistance to infection by controlling pathogen replication and cell proliferation. Regulates inducible nitric oxide synthase and therefore nitric oxide production [5]. tgfb-like increased after A. hydrophila infection in catfish [47].
Table 3. Gene targets analysed by NanoString Technologies, Inc.
Table 3. Gene targets analysed by NanoString Technologies, Inc.
Gene NameGenBank Accession NumberTarget RegionTarget SequenceHUGO Gene
Reference genes
Elongation factor 1-α (ef1a)Ch_aur001.11152–1251CAAGAAGCTTGAGGATGCTCCCAAGTTCGTCAAGTCTGGTGATGCCGCCATTGTCAAACTGCACCCACAGAAGCCCATGGTTGTGGAGCCCTTCTCCAGCLOC115578802
60S ribosomal protein L8 (rpl8)Ch_aur022.1634–733GGTGGTGGTAACCATCAGCATATTGGCAAACCCTCAACAATCAGAAGGGACGCACCTGCTGGTCGCAAGGTCGGTCTCATTGCTGCCCGTCGTACAGGCArpl8
40S ribosomal protein S18 (rsp18)Ch_aur036.1184–283GAGGTTGAGCGTGTGGTGACCATCATGCAGAATCCTCGCCAGTACAAAATCCCAGACTGGTTCCTCAACAGGCAGAAGGACGTCAAGGACGGCAAATACALOC115577508
Target genes
Actin cytoplasmic 1 (actb)Ch_aur069.1736–835CAGGTCATCACCATCGGCAATGAGAGGTTCCGTTGCCCAGAGGCCCTCTTCCAGCCTTCCTTCCTCGGTATGGAGTCCTGCGGAATCCACGAGACCACCTactb
Catalase isoform X2 (cat)Ch_aur025.1641–740GCTACGGCTCTCACACCTTCAAACTGGTCAATGCCAATGGTGAGCGTTTCTACTGCAAGTTCCACTACAAGACTGATCAAGGAATAAAGAATCTGACAGTcat
Cell surface glycoprotein MUC18-like isoform X (muc18-like)Ch_aur003.1412–511ACTTACTTTGTTCCTGGAGGAACCAGGATGACTGAGACCAACCGTATTAACATCACTGTATACTACCCCTCCACCGCTGTAAGTGTTTGGGTGGAGTCACLOC115570482
Complement C3-like A (c3-like)Ch_aur061.12871–2970TCTGATTCTCAATGCACAGCAACCTGACGGCATGTTTAAAGAAGTTGGAACGGTCTCCCACGGGGAGATGATTGGCGATGTGCGCGGCGCAGATTCAGATLOC115582848
Complement component C8 α chain (c8a)Ch_aur047.1568–667TGGAGGAAATTCAGCTATGACTCATTCTGTGAGAACCTGCACTACAATGAAGATGAGAAGAACTACAGGAAACCTTACAACTACCACACCTACCGTTTTGc8a
Cryptochrome-1-like (cry1-like)Ch_aur034.11655–1754ACCAACAAACCAGCATCGGAACACACCAGCAAGGTTATCCAGGTACCAGTGCCGGTGTGATGTGTTACACTCAAGGCACACCACAGCAGATTCCTGGTTCLOC115595869
Glutathione reductase mitochondrial isoform X2 (gsr)Ch_aur019.1236–335TCAATGTTGGCTGTGTCCCTAAGAAGGTTATGTGGAATGCTGCAAGTCACGCCGAGTATCTCCATGATCACAATGATTATGGCTTCGACGTTGGAAATGTgsr
Glutathione S-transferase A (gsta)Ch_aur021.1284–383AACTGGCAATGATGTACCAGCGCATGTTTGAGGGTCTCTCACTCAACCAGAAAATGGCGGATGTCATCTACTACAACTGGAAGGTCCCAGAGGGAGAGAGLOC115579480
Glyceraldehyde-3-phosphate dehydrogenase (gapdh)Ch_aur068.1303–402CTTGAAGGGTGGTGCCAAGAGAGTCATCATCTCTGCACCCAGCGCCGACGCTCCCATGTTTGTCATGGGTGTCAACCATGAGAAGTACGACCATTCCCTCgapdh
Heat shock cognate 70 kDa protein (hsp70)Ch_aur056.11605–1704GGTGTCTGCTAAGAATGGCCTGGAGTCGTATGCTTTCAACATGAAGTCTACTGTGGAGGATGAAAAACTTGCTGGCAAAATCAGTGATGACGACAAGCAGLOC115594641
heat shock protein HSP 90-β isoform X2 (hsp90ab1)Ch_aur007.1514–613GGAGCTGACATCTCCATGATTGGTCAGTTTGGTGTGGGTTTCTACTCTGCCTACCTTGTTGCTGAGAAGGTGGTCGTCATCACCAAACACAACGATGATGhsp90ab1
Hepcidin (hamp)Ch_aur008.1101–200AGGAGGCAGGGAGCAATGACACTCCAGTTGCGGCACATCAAGAAATGTCAATGGAATCGTGGATGATGCCGAGTCGCGTCAGGGAGAAGCGTCAGAGCCAhamp
Insulin-like growth factor I isoform X1 (igf1)Ch_aur033.1188–287GAGAGAGAGGCTTTTATTTCAGTAAACCTGGCTATGGCCCCAATGCACGGCGGTCACGTGGCATTGTGGACGAGTGCTGCTTCCAAAGCTGTGAGCTGCGigf1
Insulin-like growth factor II (igf2)Ch_aur050.1161–260CGCTGTGTGGGGGAGAGCTGGTGGATGCGCTGCAGTTTGTCTGCGAAGACAGAGGCTTCTATTTCAGTAGGCCAACCAGCAGGGGAAACAACCGGCGCCCigf2
Mitochondrial uncoupling protein 2-like (ucp2-like) Ch_aur038.1539–638TCACTAGAAATGCGCTTGTCAACTGCACAGAACTGGTTACATACGACCTGATCAAGGAGGCCATCCTCAAACACAACCTGTTGTCAGACAACCTGCCCTGLOC115579854
Nuclear factor erythroid 2-related factor 2 (nrf2) Ch_aur065.11360–1459CAGAGGGCTAAGGCCCTCAAAATCCCTTTCACTGTAGACATGATTATCAATCTGCCTGTCGACGATTTCAATGAGCTGATGTCAAAGCACCGACTGAATGnfe2l2
Peroxiredoxin-1 (prdx1)Ch_aur042.1162–261CGAGATCATAGCTTTCAGTGACGCTGCTGACGATTTCAGGAAGATCGGCTGTGAGGTCATCGCCGCCTCTGTTGACTCACACTTCTCCCATTTCGCATGGLOC115573364
Peroxiredoxin-1-like (prdx-like)Ch_aur013.1374–473CATACAGGGGGCTGTTTGTGATTGACGACAAGGGCATCTTGAGGCAGATCACCATCAATGACTTGCCTGTGGGTCGCTCTGTGGATGAGACTCTGCGCCTLOC115587998
Peroxiredoxin-5 mitochondrial (prdx5)Ch_aur057.1152–251TGTCTATGGATCAGCTCTTCAAGGGGAAGAAGGGAGTCCTCTTTGCTGTACCTGGAGCCTTCACACCTGGATGTTCCAAGACTCACCTCCCAGGTTTTGTprdx5
Prostaglandin G/H synthase 2 (ptgs2)Ch_aur071.11187–1286TCGTCTTCAACACGTCTGTAGTGACTGAGCACGGCATCAGCAACCTTGTGGAGTCGTTTTCCAAGCAGATCGCTGGACGGGTTGCCGGTGGCCGAAATGTptgs2
Serotransferrin-like (tf-like)Ch_aur005.1582–681CGAGCCTTATTATGACTACGGTGGAGCCTTCCAATGTCTGGCAGACGACGCTGGTGATGTGGCCTTTGTGAAGCATCTCACTGTACCTGAGTCTGAAAAGLOC115572354
Superoxide dismutase [Cu-Zn] (sod1)Ch_aur059.1100–199GGAGAAATCTCGGGACTTACTCCTGGTGAGCATGGTTTCCATGTCCATGCATTTGGAGACAATACAAATGGGTGCATCAGTGCAGGCCCTCACTTCAATCsod1
Suppressor of cytokine signalling 3 (socs3)Ch_aur039.1291–390GCGCATCCAGTGTGACTCAAGCTCTTTTTTCCTGCAGACGGACCCTAAAAACGTTCAGTCTGTTCCTCACTTTGACTGCGTCCTCAAGCTGGTGCATTACsocs3
Thioredoxin-dependent peroxide reductase mitochondrial (prdx3)Ch_aur006.1290–389CCTTTGTGTGTCCAACAGAGATCATCTCATTCAGCGACAAGGCCAGTGAGTTCCACGACGTTAACTGTGAGGTGGTGGGTGTGTCGGTGGACTCTCACTTprdx3
Transforming growth factor β-1 proprotein-like isoform X1 (tgfb1-like)Ch_aur024.1300–399CAGTGCCATCAATTTTGAGGTCTCCGGGATCTCGAATAGTAGGGGAGACACACAAGGGTTTCAACAGGTGTCGCAGCAATACCCGTACATCCTGACCATGLOC115575711
Genes that did not pass calibration
Alkaline phosphatase tissue-nonspecific isozyme isoform X1 (alpl)Ch_aur035.1661–760GGCTGCAAGGATATCGCCAGACAACTCTTTGAAAATATTCCCAACATTGATGTGATTATGGGTGGAGGAAGGAAGTATATGTTCCCTAAAAACAAGTCGGalpl
Complement component C6 (c6)Ch_aur018.12413–2512CTCTGTATCCTGAACGTAGACCTCGGCGTCACCGTGCCGATGTCCCTCTGCTCCTTCCACGTCGGGCTTTGCCACAATGATCCGCTCTTCTATGTCAGCGc6
Glucocorticoid receptor-like (gcr-like)Ch_aur049.1669–768GGACGTTGGCTCAGAGAGGGACATGAAGTCTGCTGTGGTTGAAAGCATTAACGGCAGTGGGGCAGTCTTTGTTGCTCTTAATGGCAGTAATATGACAAGTLOC115568693
Glutathione peroxidase 2 (gpx2)Ch_aur064.1103–202TGTGGCCTCGCTCTGAGGCACCACCACCCGGGACTACAGCGAGCTCAACCAGCTGCAGAGCAAGTACCCGCATCGGCTGGTGGTCCTGGGTTTTCCCTGTgpx2
Hypoxanthine-guanine phosphoribosyltransferase (hprt1)Ch_aur031.1253–352CTGAACAGGAACAGTGACCGCTCCATCCCAATGACAGTGGACTTCATCCGCCTCAAGAGCTACTGTAACGACCAGTCGACAGGTGAAATCAAAGTGATTGhprt1
Interferon-induced GTP-binding protein Mx-like B (mx-like)Ch_aur051.1982–1081CCATCTGATGCAGCTGAGAGAGTCGTCTTCCTCATTGATAAAGTGACAGCTTTCACTCAGGATGCCATCAGTCTGACCACAGGAGAAGAACTCAATTGTGLOC115583120
Interleukin-1 β-like (il1b-like)Ch_aur029.1412–511CCTACACCCAGTGCTGAGGCCGTAACTGTGACTCTGTGCATCAAGGACACAAATCTTTACCTGTCTTGTCACAAGGAAGGTGACGAGCCAACCTTGCATCLOC115581181
Interleukin-6 isoform X1 (il6)Ch_aur045.1127–226GTGATGCTGGCCGCTCTGCTTCAGTGTGCTCCCGGGGCTCCGATTGATGGCGCGCTCACTGACAATCCAGCAGGTGACACCTCAGGTGAAGAGTGGGAGALOC115579128
Interleukin-10-like (il10-like)Ch_aur062.1528–627AGGTCTATACAAGGCCATGGGAGAGCTGGATCTGCTGTTCAACTACATTGAGACATATCTGGCTTCCAAACGGCACGGAACACATGTGGCCTCCGCTTGALOC115582730
Interleukin-12 subunit β-like (il12b-like)Ch_aur032.1388–487GCACCTAACTATTCAGGCTCCTTCAAATGCACCTGGGCTAAAGCAGAGCACAGATCCAACGCCGCCGTGCTCCTGGTGAAGGCCGAACGTCATTTGGAGALOC115593944
Interleukin-17D (il17d)Ch_aur010.1415–514CGCAGCACTCCGGTCTACGCTCCGTCTGTCATCCTGAGGAGAACCGGCTCCTGCCTCGGCGGCCGACACTCATACACAGAGATCTACGTCTCCATCGCGGil17d
Interleukin-34 isoform X1 A (il34)Ch_aur009.1142–241CGGTACATGAGGCACAACTTCCCCATCAAGTACACCATCAGGGTTCATCACAACGAAGTCTTTAAACTGTCAAACATCAGCAGACTGAGGTTACAGGTGGil34
Macrophage colony-stimulating factor 1 receptor (csf1r)Ch_aur060.12343–2442CAAAAATTGTATTCACAGAGACATCGCTGCAAGGAATGTCCTGTTGACTGATCACAGAGTGGCCAAGATTTGTGACTTTGGTCTGGCACGTGACATCATGcsf1r
Mucin-2-like isoform X1 (muc2-like)Ch_aur020.11740–1839CTGTTCCCTCAGTGTGGAAAATGAGAATTACGCCAAACACTGGTGTGCCTTGCTGCTAAGTCCAGACAGCTCCTTTGCACAGTGCCGTTCAGCGGTGGATLOC115586438
Nuclear factor NF-kappa-B p100 subunit isoform X1 (nfkb2)Ch_aur030.1717–816GGAGGCGTTCGGAGACTTTTCACCAACCGACGTTCACAAACAGTACGCCATTGTGTTCAAAACGCCGCCCTATCACAGCGCAGAGATCGAGCGGCCCGTCnfkb2
Stromal cell-derived factor 1 (cxcl12)Ch_aur016.1197–296AGAACAACAGGGAAGTTTGCATCAACCCGGAGACCAAGTGGCTGCAGCAGTACTTAAAGAACGCCATTAACAAGGTGAAGAAAAACCGAAGACGCAATAAcxcl12
T-cell surface glycoprotein CD8 α chain-like isoform X3 (cd8a-like)Ch_aur017.1151–250TGGTTTCGAGTGCTGGACAAATCTGGCATGGAATTCATTGGGTCTTTCAGCAATACTGGCGTGAAAAAACCAAATACAAAGCCTCCAACTTCCATCTTCALOC115583354
Toll-like receptor 2 isoform X1 (tlr2)Ch_aur048.1602–701CGAGGTATGAGTCCGGTACTCTGGCATACGTTTGGCCGTTGGGTCGTGTCACTTTGAGCCTCCACAGTCCATTTTTAACAAATGAGGCCTTAGCCTCAGCLOC115590525
Toll-like receptor 3 (tlr3)Ch_aur014.1799–898AGCCAAGCTGATGGCAGCTTTCAGCCGTACAGCGCGGTGCTGCAGACCACTGAATCACTCAAAGTACTTCAGCTGCAATTCATGAAGGTGTTGATAGAAALOC115590587
Toll-like receptor 5 (tlr5)Ch_aur053.11203–1302CTTCCCTGCGTCTCTACCCAGATTAGATTATCTCCTGTTGAACGACAACAAGTTGACCTCCTCGTCAGTATACAGTCTCACACGGTTTGCCGATAATGCCLOC115574263
Table 4. Mean gene counts for snapper tissues with standard errors (SEs).
Table 4. Mean gene counts for snapper tissues with standard errors (SEs).
TreatmentTissueStatisticHeat-Sensitive Heat-Tolerant Cold-SensitiveCold-TolerantControl
Actin cytoplasmic 1 (actb)Fin clipMean6464.66658.27090.16947.88314.7
SE170.6153.6488.1323.8370.8
LiverMean5317.45746.25364.26354.16790.7
SE418.9622.1347.9286.7302.0
Head KidneyMean23,691.5 *26,749.1 *15,841.815,277.817,274.3
SE1157.21392.0748.0941.8776.9
Catalase isoform X2 (cat)Fin clipMean105.7 *126.2 *52.053.043.1
SE7.96.93.54.83.2
LiverMean1613.91540.71920.41898.82303.1
SE190.1287.494.8127.9101.0
Head KidneyMean198.7 *172.9 *334.6285.2407.1
SE13.013.970.415.134.7
Cell surface glycoprotein MUC18-like isoform X (muc18-like)Fin clipMean87.6123.3100.7104.6123.3
SE5.53.57.76.88.2
LiverMean140.5 *174.7184.8166.3 *269.3
SE11.814.022.413.08.8
Head KidneyMean138.3 *135.2 *251.9179.4208.5
SE20.017.627.015.114.3
Complement C3-like A (c3-like)Fin clipMean25.3 *32.8 *9.112.427.7
SE2.35.53.44.025.7
LiverMean31,279.639,289.630,140.931,197.228,874.7
SE3841.95094.62518.03730.31613.4
Head KidneyMean0.00.02.80.00.0
SE0.00.03.00.00.0
Complement component C8 α chain (c8a)Fin clipMean0.01.40.00.03.1
SE0.01.50.00.03.3
LiverMean4625.55178.93922.73692.03908.2
SE333.1567.4329.8288.1142.5
Head KidneyMean0.00.01.60.00.0
SE0.00.01.70.00.0
Cryptochrome-1-like (cry1-like)Fin clipMean140.6 *112.5 *552.8 *541.0 *309.1
SE11.65.730.233.616.0
LiverMean58.7 *45.9 *314.1 *332.2 *155.3
SE6.84.922.726.413.4
Head KidneyMean127.7 *113.7 *341.3 *339.4 *212.9
SE19.16.135.19.421.5
Glutathione reductase mitochondrial isoform X2 (gsr)Fin clipMean145.6135.1151.2144.0141.3
SE13.215.59.36.711.1
LiverMean42.5 *62.2 *^96.578.697.8
SE3.23.55.65.39.1
Head KidneyMean208.4268.1339.3315.4276.8
SE22.224.728.426.89.6
Glutathione S-transferase A (gsta)Fin clipMean183.1234.4177.8223.9298.8
SE17.128.18.422.036.5
LiverMean333.7 *203.4 *91.2 *94.9 *981.8
SE49.140.013.913.4305.0
Head KidneyMean319.0307.9744.8726.1358.6
SE61.745.5218.598.750.6
Glyceraldehyde-3-phosphate dehydrogenase (gapdh)Fin clipMean5.323.78.15.619.1
SE2.310.63.13.115.1
LiverMean11,358.511,485.213,960.015,706.615,223.7
SE1038.71409.8992.8808.6540.0
Head KidneyMean373.6412.71838.8970.9549.2
SE118.4115.1725.8169.6197.0
Heat shock cognate 70 kDa protein (hsp70)Fin clipMean20,124.5 *14,665.3 ^15,513.6 *14,063.712,488.3
SE1141.4663.3644.0713.2534.4
LiverMean15,171.0 *14,161.8 *8634.48257.58362.4
SE475.5567.4473.0216.2201.2
Head KidneyMean19,372.6 *21,023.6 *13,975.512,060.912,838.8
SE796.3421.5702.9398.4251.7
heat shock protein HSP 90-β isoform X2 (hsp90ab1)Fin clipMean16,357.6 *13,753.0 *10,585.88975.58616.6
SE829.6637.8533.4304.0268.4
LiverMean12,613.2 *13,524.0 *7554.17181.37100.6
SE488.0479.3289.5190.9184.9
Head KidneyMean14,686.9 *16,384.4 *8300.07199.77412.1
SE881.8333.4795.8218.1127.8
Hepcidin (hamp)Fin clipMean12.312.74.83.73.7
SE5.14.72.72.73.9
LiverMean11,855.07135.33733.84769.39498.1
SE3459.11325.11030.91463.41690.7
Head KidneyMean170.0 *147.2 *15.50.08.8
SE47.823.88.20.03.6
Insulin-like growth factor I isoform X1 (igf1)Fin clipMean7.7 *16.620.622.272.1
SE3.63.94.52.07.0
LiverMean221.3 *226.0 *1091.4957.71841.0
SE37.961.7105.158.896.8
Head KidneyMean0.0 *0.0 *8.4 *11.4 *31.2
SE0.00.03.75.47.6
Insulin-like growth factor II (igf2)Fin clipMean69.793.570.094.787.1
SE9.610.15.07.23.7
LiverMean285.7 *213.1 *^154.7 *228.9 *1310.8
SE60.985.618.333.3222.5
Head KidneyMean34.034.343.733.846.3
SE5.05.77.63.36.5
Mitochondrial uncoupling protein 2-like (ucp2-like) Fin clipMean8.02.90.02.33.5
SE2.32.00.01.63.7
LiverMean1161.51011.24767.26309.51333.0
SE255.4313.2749.8444.2128.6
Head KidneyMean4.00.029.622.58.0
SE2.20.016.06.34.0
Nuclear factor erythroid 2-related factor 2 (nrf2) Fin clipMean124.3 *116.6 *53.560.571.1
SE15.17.45.83.27.1
LiverMean330.4228.5333.7316.1262.9
SE48.323.129.819.827.1
Head KidneyMean307.3322.9245.9309.4338.5
SE11.016.010.414.819.6
Peroxiredoxin-1 (prdx1)Fin clipMean273.2 *402.9 *172.4188.6159.3
SE16.648.614.414.315.4
LiverMean688.3 *624.2 *750.7 *777.2 *1450.7
SE62.557.172.774.0256.2
Head KidneyMean576.3740.2 *551.4549.1371.3
SE59.145.242.769.123.6
Peroxiredoxin-1-like (prdx-like)Fin clipMean327.3316.5323.9308.3336.4
SE13.211.730.625.322.1
LiverMean444.0 *380.5 *577.7659.9752.5
SE55.568.139.139.443.1
Head KidneyMean939.21310.6876.1 *816.1 *1503.5
SE63.0127.482.982.6158.0
Peroxiredoxin-5 mitochondrial (prdx5)Fin clipMean242.6315.5569.0517.8383.6
SE12.061.839.721.815.7
LiverMean16.1 *12.8 *96.392.696.8
SE2.63.87.47.15.8
Head KidneyMean72.056.7146.4 128.6121.4
SE15.15.716.513.310.4
Prostaglandin G/H synthase 2 (ptgs2)Fin clipMean346.8171.4165.4125.1166.5
SE70.149.435.612.221.0
LiverMean22.7 *79.2 *^6.40.01.2
SE9.07.34.80.01.3
Head KidneyMean1.97.11.21.40.0
SE2.02.51.31.50.0
Serotransferrin-like (tf-like)Fin clipMean53.768.732.736.656.1
SE5.612.43.48.833.0
LiverMean80,683.682,194.861,926.156,895.081,079.4
SE6054.39636.55109.77651.34822.1
Head KidneyMean1.80.00.01.20.0
SE1.90.00.01.30.0
Superoxide dismutase [Cu-Zn] (sod1)Fin clipMean389.1313.2471.0383.6342.3
SE34.817.430.824.813.3
LiverMean426.6 *311.2 *710.3 *746.8 *1177.7
SE49.445.233.735.766.8
Head KidneyMean332.5 *361.0475.6411.1521.9
SE18.516.335.423.531.2
Suppressor of cytokine signalling 3 (socs3)Fin clipMean281.2243.7209.8190.7466.9
SE38.839.833.115.658.3
LiverMean738.1 *690.1 *38.665.848.5
SE319.6291.25.111.813.2
Head KidneyMean1126.11231.6204.7147.5167.2
SE394.1291.644.913.416.8
Thioredoxin-dependent peroxide reductase mitochondrial (prdx3)Fin clipMean189.9 *173.7 *198.6 *232.3 *103.2
SE21.420.319.818.26.9
LiverMean195.6 *202.8 *299.1276.5400.7
SE14.321.018.612.432.5
Head KidneyMean163.0209.0202.3186.0220.0
SE11.913.49.613.411.9
Transforming growth factor β-1 proprotein-like isoform X1 (tgfb1-like)Fin clipMean321.0300.7361.6371.9331.3
SE22.057.516.718.925.0
LiverMean41.332.436.832.748.4
SE5.82.86.22.54.7
Head KidneyMean249.0269.2228.5185.9190.0
SE14.913.58.613.511.0
* Mean gene counts (n = 10) are shown with standard errors for heat-sensitive, heat-tolerant, cold-sensitive, cold-tolerant and ambient (control) fish. A significant difference using Fisher’s least significant difference test (p = 0.00033 = 0.05/(6*25)) is indicated by * for differences compared with the control, whilst ^ indicates a difference between the heat-sensitive and heat-tolerant groups.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Bentley-Hewitt, K.L.; Flammensbeck, C.K.; Crowhurst, R.N.; Hedderley, D.I.; Wellenreuther, M. Development of a Novel Stress and Immune Gene Panel for the Australasian Snapper (Chrysophrys auratus). Genes 2024, 15, 1390. https://doi.org/10.3390/genes15111390

AMA Style

Bentley-Hewitt KL, Flammensbeck CK, Crowhurst RN, Hedderley DI, Wellenreuther M. Development of a Novel Stress and Immune Gene Panel for the Australasian Snapper (Chrysophrys auratus). Genes. 2024; 15(11):1390. https://doi.org/10.3390/genes15111390

Chicago/Turabian Style

Bentley-Hewitt, Kerry L., Christina K. Flammensbeck, Ross N. Crowhurst, Duncan I. Hedderley, and Maren Wellenreuther. 2024. "Development of a Novel Stress and Immune Gene Panel for the Australasian Snapper (Chrysophrys auratus)" Genes 15, no. 11: 1390. https://doi.org/10.3390/genes15111390

APA Style

Bentley-Hewitt, K. L., Flammensbeck, C. K., Crowhurst, R. N., Hedderley, D. I., & Wellenreuther, M. (2024). Development of a Novel Stress and Immune Gene Panel for the Australasian Snapper (Chrysophrys auratus). Genes, 15(11), 1390. https://doi.org/10.3390/genes15111390

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop