Next Article in Journal
Intronic Variants in the MSH2 (rs2303426 and rs10179950) and PMS2 (rs2286681 and rs62456178) Genes Are Not Associated with Colorectal Cancer in Mexican Patients
Next Article in Special Issue
Example of Intrafamilial Clinical Polymorphism in a Family with Osteogenesis Imperfecta
Previous Article in Journal
Canine Multiple System Degeneration Associated with Sequence Variants in SERAC1
Previous Article in Special Issue
Phenotypic Variability in Camurati–Engelmann Disease: A Case Report of a Family with the c.653G>A Pathogenic Variant in the TGFB1 Gene
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Variants of the PTPN11 Gene in Mexican Patients with Noonan Syndrome

by
Paola Montserrat Zepeda-Olmos
1,2,
Eduardo Esparza-García
3,
Kiabeth Robles-Espinoza
1,2,
Juan Ramón González-García
1,
Perla Graciela Rodríguez Gutiérrez
1 and
María Teresa Magaña-Torres
1,*
1
División de Genética, Centro de Investigación Biomédica de Occidente, Instituto Mexicano del Seguro Social, Guadalajara 44360, Jalisco, Mexico
2
Doctorado en Genética Humana, Centro Universitario de Ciencias de la Salud, Universidad de Guadalajara, Sierra Mojada 950, Independencia Oriente, Guadalajara 44340, Jalisco, Mexico
3
Unidad Médica de Alta Especialidad, Hospital de Pediatría del Centro Médico Nacional de Occidente, Instituto Mexicano del Seguro Social, Belisario Domínguez 735, La Perla, Guadalajara 44360, Jalisco, Mexico
*
Author to whom correspondence should be addressed.
Genes 2024, 15(11), 1379; https://doi.org/10.3390/genes15111379
Submission received: 21 September 2024 / Revised: 21 October 2024 / Accepted: 23 October 2024 / Published: 25 October 2024
(This article belongs to the Special Issue Molecular Basis of Rare Genetic Diseases)

Abstract

Background/Objectives: Noonan syndrome (NS) is a genetic multisystem disease characterized by distinctive facial features, short stature, chest deformity, and congenital heart defects. NS is caused by gene variants of the RAS/MAPK pathway, with PTPN11 accounting for about 50% of cases. This study aimed to identify PTPN11 pathogenic variants in Mexican patients with NS to enhance our understanding of the disease in this population. Methods: This study included 91 probands and 60 relatives, all of which were clinically evaluated by a geneticist. Sanger sequencing was used to screen the entire PTPN11 gene. Results: Twenty-one previously reported pathogenic variants were identified in 47.3% of the probands. The most frequently occurring were p.Asn308Asp (16.3%) and p.Met504Val (16.3%). Variants p.Tyr279Cys and p.Thr468Met were found exclusively in patients with lentiginosis. Eighty-three percent of patients carried a variant in one of the three exons (3, 8, or 13) where the greatest genetic diversity was observed. Common clinical findings identified in probands included short stature (82%), cardiac anomalies (70.7%), short neck (68.4%), and pectus excavatum (63.2%), although features represented by only one patient each were also detected. Conclusions: This study confirmed the clinical diagnosis of NS in 43 probands and 11 relatives, and further genetic analysis of the remaining 48 probands is required to identify the causal variant. The genetic and clinical variability observed in our cohort was consistent with reports from other populations, underscoring the importance of comprehensive care for all patients. This research provides the most extensive clinical and molecular characterization of NS in Mexican patients, identifying pathogenic variants of PTPN11.

Graphical Abstract

1. Introduction

Noonan syndrome (NS) is a relatively common genetic multisystem disease, occurring at a rate between 1 in 2500 and 1 in 1000 live births. NS is characterized by distinctive facial features, a short stature, chest deformity, and congenital heart defects [1,2], such as pulmonary valve stenosis, septal defects, and hypertrophic cardiomyopathy. Other features include cryptorchidism, low weight, a developmental delay of varying degrees, and coagulation defects [3,4].
Diagnosing NS can be challenging due to its variable expressivity and similarities with other disorders, such as Costello syndrome, Cardiofaciocutaneous syndrome, and Legius syndrome. These diseases result from gain-of-function variants of genes that encode proteins of the RAS–mitogen-activated protein kinase (RAS-MAPK) pathway, which plays a critical role in regulating cell differentiation, growth, proliferation, and apoptosis [5]. Additionally, variants that reduce PTPN11 activity cause Noonan syndrome with multiple lentigines (NSML), which shares clinical features with NS [6].
Eleven genes are involved in the etiology of NS (PTPN11, SOS1, KRAS, RAF1, NRAS, BRAF, LZTR1, RRAS2, SOS2, RIT1, and MRAS), and all are related to the RAS/MAPK signaling pathway [7]. Pathogenic variants of PTPN11 account for about 50% of cases, followed by SOS1 (~13%) and LZTR1 (~8%). NS is generally inherited in an autosomal dominant pattern, with 60%-80% of patients exhibiting de novo variants. This syndrome has a variable expression, but shows complete penetrance [8].
The PTPN11 gene contains 15 exons that encode protein tyrosine phosphatase non-receptor type 11 (593 amino acids). This protein has two homologous domains (N-SH2 and C-SH2), a protein tyrosine phosphatase domain (PTP), and a C-terminal disorganized domain. In the inactive conformation of PTPN11, the N-SH2 and PTPs interact, resulting in autoinhibition. Upon activation, these domains separate, allowing the PTP to hydrolyze phosphates from target molecules [9,10].
In Mexico, clinical–genetic studies of NS are scarce, even though a complete diagnosis improves the management, surveillance, and outcomes of patients with this condition. Additionally, a segregation analysis is useful for detecting relatives with mild phenotypes, who often remain unacknowledged in terms of having the disease. To date, nine Mexican patients with features consistent with NS have been reported [11,12,13,14], and although the PTPN11 gene was analyzed in six of them, the causal variant was only found in two related patients (p.Gln79Arg) [14]. In this study, we describe the PTPN11 gene pathogenic variants in a cohort of patients with clinical characteristics of NS, aiming to further understand this disease among our population.

2. Materials and Methods

2.1. Study Subjects

A total of 151 individuals were included, comprising 91 probands and 60 related family members. The cases were evaluated by a geneticist, who conducted a comprehensive analysis of the medical history of each patient, encompassing prenatal and perinatal antecedents, psychomotor development, echocardiogram, coagulation studies, and physical examination data. The research protocol was structured in accordance with the Declaration of Helsinki guidelines and received approval from the Research, Ethics, and Safety Committees at our institute.

2.2. Molecular Analysis

2.2.1. DNA Extraction

After obtaining informed consent or assent from the probands and their relatives, a blood sample (2 to 4 mL) was collected for genomic DNA extraction using the DTAB-CTAB (dodecyltrimethylammonium bromide–cetyltrimethylammonium bromide) method [15].

2.2.2. Polymerase Chain Reaction

The genetic study was performed by polymerase chain reaction (PCR), followed by Sanger sequencing. To screen the 15 exons and the promoter of the PTPN11 gene, 14 pairs of primers were designed using the Oligo 6.0 software (Table 1). Various PCR conditions and thermal cycler programs were used to amplify the 14 analyzed fragments, which are described in detail in Table S1. All reactions were carried out at a volume of 10 μL and the amplicons were purified with 0.5 μL of ExoSAP-IT cleanup reagent (Applied Biosystems, Waltham, MA, USA) (the program includes incubation at 37 °C for 15 min then at 80 °C for 15 min) (Cat.78201.1ML).

2.2.3. DNA Sequencing

The purified PCR products were used for the sequencing reaction, which was carried out in a total volume of 10 μL, containing 100 ng of DNA, 0.5 μL of Ready Reaction Big Dye Terminator Kit v.3.1 (Applied Biosystems, Waltham, MA, USA) (Cat.4337455), 1.5 μL of 5X Buffer, and 2.5 pmol of primer. The thermal cycling program used was as follows: initial denaturation of 96 °C for 4 min, followed by 25 cycles at 96 °C for 10 s, at 55 °C for 5 s, and at 60 °C for 2 min. The sequencing reaction products were purified using columns loaded with 50 μg of Sephadex G-50 medium (Cytiva Life Sciences, Uppsala, Sweden). Capillary electrophoresis was performed on a SeqStudio sequencer, and electropherograms were analyzed both manually and using SnackVar software (Version 2.4.3.) [16] with the reference sequence NM_002834.5. Variants were named according to the nomenclature recommended by the Human Genome Variation Society [17].

2.2.4. Statistical Analysis

The frequency at which allele variants occurred was obtained by direct counting. Fisher’s exact test was used for the comparison of qualitative variables. A p-value of less than 0.05 was considered statistically significant.

3. Results

3.1. Clinical Characteristics

Of the 91 probands with a clinical diagnosis of NS (88 children under 18 years of age and 3 adults), 45 were female and 46 were male, with a median age of 8 years (range: 0–46 years). Pathogenic variants of the PTPN11 gene were identified in 47.3% (43/91) of the cases, with a median age of 7 years. Of these, 55.8% (24/43) of them were male (42 children and 1 adult). The distribution of NS clinical features in patients with and without PTPN11 variants is shown in Table 2, Tables S2 and S3 (unfortunately, clinical features were not available in all probands). Characteristics such as a low height for one’s age, heart disease, a short neck, and pectus excavatum were noted in over 60% of patients.
Among all probands, five specific cardiopathies were identified in more than one patient: pulmonary valve stenosis (43.2%), atrial or/and ventricular septal defects (31.3%), hypertrophic cardiomyopathy (20.0%), bicuspid aorta valve (5.0%), and arrhythmia (5.0%). Seven other heart diseases were only detected in one patient each: aortic stenosis, mitral stenosis, partial anomalous pulmonary venous connection, interatrial aneurysm, double-chambered right ventricle, the transposition of the great arteries, and tetralogy of Fallot. Additionally, 25.6% of patients presented two or three of these conditions in concomitance. A comparison between variant-positive and variant-negative PTPN11 patients showed significant differences between two variables. Easy bruising was more frequent in variant-positive patients (23.6% vs. 7.5%; p = 0.03), while pectus excavatum was more common in variant-negative patients (63.2% vs. 83.3%, p = 0.04).
Currently, there is no specific pharmacological treatment for NS. However, patients often use medications to manage their associated medical conditions. In the interrogatory phase, 24.2% of the patients with PTPN11 pathogenic variant expressed having taken cardiac drugs, 12.1% having taken neuro-psychiatric drugs, and 48.5% having received growth hormone therapy. Furthermore, ten patients underwent cardiac surgery and seven underwent orchidopexy.

3.2. Molecular Analysis

We identified heterozygous pathogenic variants in 43 out of 91 probands included in this study. A total of 21 different missense variants were detected, with p.Asn308Asp and p.Met504Val being the two most frequent, together representing 32.6% of cases. Moreover, two other recurrent variants, p.Ala72Ser (7%) and p.Thr468Met (7%), were found in three patients each.
The highest genetic heterogeneity was observed in exon 3, with nine different variants distributed among 14 patients, and the most common one, p.Ala72Ser, was present in 3 of them. Notably, 95.2% of variants affected amino acids situated in N-SH2 and PTPs, whose function is to modulate the activity of PTPN11 (Table 3).

3.3. Segregation Analysis

In order to determine if a genetic variant was inherited or de novo and to provide appropriate genetic counseling, family segregation analysis was performed in 60 individuals related to 28 probands (regrettably, this study could not be completed in 15 cases). The results revealed that 18 patients had a de novo variant, while 10 inherited the variant (7 maternally and two paternally, and in 1 proband the parents were not available and so a brother was tested, who also turned out to have the variant). This analysis allowed us to detect 11 cases with NS (9 parents and 2 siblings), bringing the total number of patients with a clinical and molecular diagnosis of NS to 54 (Table S4).

4. Discussion

We report the findings of 91 unrelated patients who were analyzed for variants of the PTPN11 gene. Heterozygous pathogenic variants were detected in 43 of the 91 probands, representing a detection rate of 47.3%. This aligns with previous reports, which suggest that approximately 50.0% of NS patients have a PTPN11 variant [18]. For the remaining 52.7% of probands, the analysis of other genes is required to identify the causal variant and confirm the clinical diagnosis. In the absence of such findings, differential diagnosis should be considered.
In NS, variable expressivity contributes to the underdiagnosis of cases with mild clinical phenotypes. Through segregation analysis, we identified 11 relatives with NS, 9 of whom were unaware of their condition. These findings highlight the importance of screening both affected and apparently unaffected consanguineous relatives when a pathogenic variant is detected in a proband. This approach increases the rate of detection of NS patients and allows for more accurate follow-up treatment and genetic counseling.
The distribution of variant-positive patients by sex was comparable between males (55.8%) and females (44.2%, p = 0.28), as expected, given the inheritance pattern of the syndrome. Investigations into associations among clinical characteristics in variant-positive and variant-negative patients revealed that two variables reached statistical significance. First, easy bruising was more frequent in variant-positive patients (p = 0.03); this association has been reported previously [19,20], as PTPN11 is a negative regulator of thrombus stability [21]. Some patients may experience coagulation problems even when their evaluation parameters are normal. Therefore, the risk of bleeding must be considered in patients undergoing surgery [22]. The second variable, pectus excavatum, was more common in variant-negative patients (p = 0.04), a finding not reported in other studies.
The most frequent clinical manifestations (>60%) in patients with PTPN11 pathogenic variants were a short stature, heart disease, a short neck, pectus excavatum, and cryptorchidism.
Having a short stature is a clinical feature of NS, with a comparable frequency in Mexican patients to that reported in Chinese (32/39 vs. 37/50; p = 0.36) [23] and Northern European patients (32/39 vs. 39/51; p = 0.52) [23,24]. However, the rate was significantly different from that in Indian patients (32/39 vs. 43/107, p < 0.0001) [18]. Growth hormone treatment has proven to be safe and effective, regardless of the presence of a growth hormone deficiency, although long-term studies are necessary [25]. In this study, 48.5% of patients with the PTPN11 pathogenic variant had received growth hormone, but treatment response analysis could not be performed due to data insufficiencies. On the other hand, psychosocial factors may impact well-being more than height itself, suggesting that treatment should as well [26].
The prevalence of heart disease in our patients correlates with that found in Chinese patients (29/41 vs. 41/50; p = 0.20) [23], but it was lower than that in Turkish patients (29/41 vs. 11/11; p = 0.04) [27], which was potentially due to undiagnosed milder cases. The PTPN11 protein plays a crucial role in semilunar valvulogenesis, influencing mesenchymal transformation, cell proliferation, and subsequent valve remodeling, all of which are mediated by epidermal growth factor signaling [24]. Most studies have observed that pulmonary valve stenosis is more common in patients with NS who carry a PTPN11 variant [28]. We also observed this trend (51.2% vs. 35.0%, p = 0.18), although the difference was not significant. This condition often manifests in early childhood (0–6 years), and six of our patients remain at risk as they are under 6 years of age. Other conditions, such as Mowat–Wilson and Alagille syndromes, should be considered in patients without a PTPTN11 variant [29]. However, the prevalence of this cardiopathy in our study is consistent with that in other populations (Chinese 42.0% and Indian 35.3%) [18,23].
Having a short neck was a common observation in this study, with a similar frequency to that observed in Russian patients (26/38 vs. 66/107; p = 0.45) [30]. This characteristic appears to have no medical complications.
Pectus excavatum is a significant indicator of NS that can lead to cardiological, respiratory, and body image disturbances. Therefore, proper evaluation and surgical correction, if necessary, are recommended [31]. In this study, 63.2% of patients with a PTPN11 variant had pectus excavatum, and none of them underwent either surgical intervention or psychological assessment. Interestingly, its frequency was significantly higher in our cohort compared to Chinese patients (24/38 vs. 16/50, p = 0.005) [23] but was similar to that found in Indian patients (24/38 vs. 57/107 p = 0.29) [18].
Cryptorchidism was observed in 73% (16/22) of our patients, which was similar to the rate in Chinese (17/27, p = 0.46) and Italian patients (n = 5/8, p = 0.58) [23,32] but higher than that in Russian patients (n = 27/63, p = 0.01) [30]. The etiology of cryptorchidism remains unclear, although it is associated with several genetic syndromes [33] and risk factors such as smoking, alcohol consumption, and gestational diabetes [34]. Early corrective surgery reduces the risk of developing cancer [35].
We identified 21 pathogenic variants of the PTPN11 gene in 43 probands; all of these had previously been reported. Notably, 83.7% (36/43) of the patients’ variants were clustered in three exons: 3, 8, and 13. This distribution has been found in other populations, including Chinese (94%) [23], Greek (81.5%) [36], Indian (79.5%) [18], Northern European (83.3%) [24], and South American (86%) [37]. In fact, when considering our entire cohort, screening just these three exons could establish a molecular diagnosis in 39.6% (36/91) of patients, making this an effective strategy with a favorable cost–benefit ratio.
The genetic heterogeneity of NS was evident, with most variants occurring infrequently. We detected two variants, each with a 16.3%. The first, p.Asn308Asp, has been observed in several populations, with ranges varying from 16.3% to 43%. The second, p.Met504Val, is less common, with percentages from 4.2% to 16.3% [23,24,36,38]. We also found that 52.4% of the variants were found only once per proband, which is comparable to findings in Chinese (40%) and Northern European patients (53.2%) [23,24].
Variants that reduce the catalytic activity of PTPN11 are associated with NSML. We detected 9 patients with such variants: 6 probands (2 with p.Tyr279Cys, 3 with p.Thr468Met, and 1 with p.Gln510Glu) and 3 relatives (2 with p.Tyr279Cys and 1 with p.Thr468Met). Six of these patients (three probands and three relatives) exhibited lentigines, while two probands who were less than two years old had not yet shown this characteristic, which typically appears between the ages of four and five [39]. No information was available regarding one patient (Supplementary Table S2).
Causative variants of NS (e.g., p.Asp61Gly, p.Ala72Gly, p.Thr73Ile, p.Tyr279Cys, p.Thr468Met, p. Arg498Trp, p.Ser502Ala, and p.Gly506Pro) have been associated with an increased risk of developing cancer, including myeloproliferative disorders and juvenile myelomonocytic leukemia [40]. Consequently, it is recommended that infants with NS undergo a physical examination and complete blood count every 3–6 months during their first five years of life [41]. In our cohort, 13 patients carried variants linked to cancer; fortunately, none developed malignancies.

5. Conclusions

This research provides the most extensive clinical and molecular characterization of Noonan syndrome in Mexican patients, identifying 21 pathogenic variants of the PTPN11 gene. We confirmed the diagnosis in 43 probands and 11 relatives; however, exome studies are needed for the 48 probands who did not have a variant in PTPN11. Great clinical variability was observed, which highlights the relevance of long-term follow-ups to monitor complications in each patient and ensure comprehensive care from various specialists, including cardiologists, endocrinologists, psychologists, and dermatologists. With clinical and molecular diagnosis, patients will receive accurate genetic counseling. In addition, family segregation analyses will enhance the detection of affected individuals.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/genes15111379/s1. Table S1: PCR conditions and thermal cycler programs used to amplify the 14 analyzed fragments. Table S2: Clinical characteristics of Noonan syndrome patients with and without PTPN11 gene variants. Table S3: Clinical and genetic characteristics of Mexican Patients with Noonan syndrome and PTPN11 variants. Table S4: Segregation analysis of the probands’ relatives.

Author Contributions

Conceptualization—M.T.M.-T. and E.E.-G.; methodology—M.T.M.-T., P.M.Z.-O., K.R.-E. and P.G.R.G.; software—M.T.M.-T. and P.M.Z.-O.; validation—M.T.M.-T. and P.M.Z.-O.; formal analysis—M.T.M.-T. and P.M.Z.-O.; investigation—M.T.M.-T., P.M.Z.-O., K.R.-E. and E.E.-G.; resources—M.T.M.-T., P.M-Z-O., K.R.-E., P.G.R.G. and J.R.G.-G.; data curation—M.T.M.-T., P.M.Z.-O. and E.E.-G.; writing—original draft preparation: M.T.M.-T. and P.M.Z.-O.; writing—review and editing: M.T.M.-T., P.M.Z.-O., K.R.-E., J.R.G.-G. and E.E.-G.; visualization—M.T.M.-T.; supervision—M.T.M.-T. and E.E.-G.; project administration—M.T.M.-T.; funding acquisition—M.T.M.-T. All authors have read and agreed to the published version of the manuscript.

Funding

This research received funding from IMSS (R-2021-785-068).

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki and approved by both the Research and Ethics Committees at our Western Biomedical Research Center-IMSS (CONBIOETICA -09-CEI-009-20160601) (protocol code: R-2021-785-068).

Informed Consent Statement

Informed consent was obtained from all subjects involved in the study.

Data Availability Statement

The original contributions presented in the study are included in the article and Supplementary Materials, further inquiries can be directed to the corresponding author.

Acknowledgments

P.M.Z.-O. and K.R.-E. received a scholarship from Consejo Nacional de Humanidades, Ciencias y Tecnologías, México. Clinicians who contributed by referring patients. The authors thank María de Lourdes Carbajal for her grammatical review of the manuscript.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Tajan, M.; de Rocca Serra, A.; Valet, P.; Edouard, T.; Yart, A. SHP2 Sails from Physiology to Pathology. Eur. J. Med. Genet. 2015, 58, 509–525. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Carcavilla, A.; Suárez-Ortega, L.; Rodríguez Sánchez, A.; Gonzalez-Casado, I.; Ramón-Krauel, M.; Labarta, J.I.; Quinteiro Gonzalez, S.; Riaño Galán, I.; Ezquieta Zubicaray, B.; López-Siguero, J.P. Noonan syndrome: Genetic and clinical update and treatment options. An. Pediatr. 2020, 93, 61.e1–61.e14. [Google Scholar] [CrossRef] [Scilit]
  3. Roberts, A.E.; Allanson, J.E.; Tartaglia, M.; Gelb, B.D. Noonan Syndrome. Lancet 2013, 381, 333–342. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Roberts, A.E. Noonan Syndrome; Adam, M.P., Feldman, J., Mirzaa, G.M., Pagon, R.A., Wallace, S.E., Bean, L.J.H., Gripp, K.W., Amemiya, A., Eds.; University of Washington: Seattle, WA, USA, 2001. [Google Scholar]
  5. Zenker, M. Clinical Overview on RASopathies. Am. J. Med. Genet. Part C Semin. Med. Genet. 2022, 190, 414–424. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Han, J.Y.; Park, J. Paternally Inherited Noonan Syndrome Caused by a PTPN11 Variant May Exhibit Mild Symptoms: A Case Report and Literature Review. Genes 2024, 15, 445. [Google Scholar] [CrossRef] [Scilit]
  7. Rehm, H.L.; Berg, J.S.; Brooks, L.D.; Bustamante, C.D.; Evans, J.P.; Landrum, M.J.; Ledbetter, D.H.; Maglott, D.R.; Martin, C.L.; Nussbaum, R.L.; et al. ClinGen—The Clinical Genome Resource. N. Engl. J. Med. 2015, 372, 2235–2242. [Google Scholar] [CrossRef] [Scilit]
  8. Zenker, M.; Edouard, T.; Blair, J.C.; Cappa, M. Noonan Syndrome: Improving Recognition and Diagnosis. Arch. Dis. Child. 2022, 107, 1073–1078. [Google Scholar] [CrossRef] [Scilit]
  9. Kotani, T.; Murata, Y.; Saito, Y.; Matozaki, T. Tyrosine-Protein Phosphatase Nonreceptor Type 11 (PTPN11). In Encyclopedia of Signaling Molecules; Choi, S., Ed.; Springer International Publishing: Cham, Switzerland, 2018; pp. 5803–5811. ISBN 978-3-319-67199-4. [Google Scholar]
  10. UniProt: The Universal Protein Knowledgebase in 2021. Nucleic Acids Res. 2021, 49, D480–D489. [CrossRef] [Scilit]
  11. Torres-Carmona, M.A.; Arenas-Sordo, M.L.; Saavedra-Ontiveros, D.; Sánchez-Guerrero, M.C. Periodontal disease in Noonan’s syndrome. Bol. Med. Hosp. Infant. Mex. 1991, 48, 271–274. [Google Scholar]
  12. Cardiel Ríos, S.A. Correction of a Severe Class II Malocclusion in a Patient with Noonan Syndrome. Am. J. Orthod. Dentofac. Orthop. 2016, 150, 511–520. [Google Scholar] [CrossRef] [Scilit]
  13. Lloreda-García, J.M.; Martínez-Aedo, M.J.; Tarttaglia, M.; López-Siguero, J.P. Síndrome de Noonan Por Mutación En El Gen PTPN11. An. Pediatr. 2006, 65, 635–636. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. González-Huerta, N.C.; Valdés-Miranda, J.M.; Pérez-Cabrera, A.; Pacheco-Cuellar, G.; González-Huerta, L.M.; Cuevas-Covarrubias, S.A. Noonan Syndrome: Prenatal Diagnosis in a Woman Carrying a PTPN11 Gene Mutation. J. Matern. Neonatal Med. 2010, 23, 688–691. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Gustincich, S.; Manfioletti, G.; Del, G.S.; Schneider, C.; Carninci, P. A Fast Method for High-Quality Genomic DNA Extraction from Whole Human Blood. Biotechniques 1991, 11, 298–300. [Google Scholar] [PubMed]
  16. Kim, Y.; Kim, M.J.; Lee, J.-S.; Lee, J.A.; Song, J.Y.; Im Cho, S.; Park, S.-S.; Seong, M.-W. SnackVar: An Open-Source Software for Sanger Sequencing Analysis Optimized for Clinical Use. J. Mol. Diagn. 2021, 23, 140–148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. den Dunnen, J.T.; Dalgleish, R.; Maglott, D.R.; Hart, R.K.; Greenblatt, M.S.; Mcgowan-Jordan, J.; Roux, A.F.; Smith, T.; Antonarakis, S.E.; Taschner, P.E.M. HGVS Recommendations for the Description of Sequence Variants: 2016 Update. Hum. Mutat. 2016, 37, 564–569. [Google Scholar] [CrossRef] [Scilit]
  18. Athota, J.P.; Bhat, M.; Nampoothiri, S.; Gowrishankar, K.; Narayanachar, S.G.; Puttamallesh, V.; Farooque, M.O.; Shetty, S. Molecular and Clinical Studies in 107 Noonan Syndrome Affected Individuals with PTPN11 Mutations. BMC Med. Genet. 2020, 21, 50. [Google Scholar] [CrossRef] [Scilit]
  19. Shaw, A.C.; Kalidas, K.; Crosby, A.H.; Jeffery, S.; Patton, M.A. The Natural History of Noonan Syndrome: A Long-Term Follow-up Study. Arch. Dis. Child. 2007, 92, 128–132. [Google Scholar] [CrossRef] [Scilit]
  20. Zenker, M.; Buheitel, G.; Rauch, R.; Koenig, R.; Bosse, K.; Kress, W.; Tietze, H.U.; Doerr, H.G.; Hofbeck, M.; Singer, H.; et al. Genotype-Phenotype Correlations in Noonan Syndrome. J. Pediatr. 2004, 144, 368–374. [Google Scholar] [CrossRef] [Scilit]
  21. Fernández, D.I.; Diender, M.; Hermida-Nogueira, L.; Huang, J.; Veiras, S.; Henskens, Y.M.C.; Te Loo, M.W.M.; Heemskerk, J.W.M.; Kuijpers, M.J.E.; García, Á. Role of SHP2 (PTPN11) in Glycoprotein VI-Dependent Thrombus Formation: Improved Platelet Responsiveness by the Allosteric Drug SHP099 in Noonan Syndrome Patients. Thromb. Res. 2023, 228, 105–116. [Google Scholar] [CrossRef] [Scilit]
  22. Hu, M.; Liu, P.; Liu, Y.; Yue, M.; Wang, Y.; Wang, S.; Chen, X.; Zhou, Y.; Zhou, J.; Hu, X.; et al. Platelet Shp2 Negatively Regulates Thrombus Stability under High Shear Stress. J. Thromb. Haemost. 2019, 17, 220–231. [Google Scholar] [CrossRef] [Scilit]
  23. Li, X.; Yao, R.; Tan, X.; Li, N.; Ding, Y.; Li, J.; Chang, G.; Chen, Y.; Ma, L.; Wang, J.; et al. Molecular and Phenotypic Spectrum of Noonan Syndrome in Chinese Patients. Clin. Genet. 2019, 96, 290–299. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Tartaglia, M.; Kalidas, K.; Shaw, A.; Song, X.; Musat, D.L.; van der Burgt, I.; Brunner, H.G.; Bertola, D.R.; Crosby, A.; Ion, A.; et al. PTPN11 Mutations in Noonan Syndrome: Molecular Spectrum, Genotype-Phenotype Correlation, and Phenotypic Heterogeneity. Am. J. Hum. Genet. 2002, 70, 1555–1563. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Sodero, G.; Cipolla, C.; Pane, L.C.; Sessa, L.; Malavolta, E.; Arzilli, F.; Leoni, C.; Zampino, G.; Rigante, D. Efficacy and Safety of Growth Hormone Therapy in Children with Noonan Syndrome. Growth Horm. IGF Res. 2023, 69–70, 101532. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Kamoun, C.; Largent, E.A.; Grimberg, A. Heightism, Growth Hormone Treatment, and Social Functioning: A Holistic Approach to a Persistent Clinical Challenge. Curr. Opin. Pediatr. 2024, 36, 442–448. [Google Scholar] [CrossRef] [Scilit]
  27. Derbent, M.; Oncel, Y.; Tokel, K.; Varan, B.; Haberal, A.; YaziCi, A.C.; Legius, E.; Ozbek, N. Clinical and Hematologic Findings in Noonan Syndrome Patients with PTPN11 Gene Mutations. Am. J. Med. Genet. Part A 2010, 152, 2768–2774. [Google Scholar] [CrossRef] [Scilit]
  28. Sun, L.; Xie, Y.M.; Wang, S.S.; Zhang, Z.W. Cardiovascular Abnormalities and Gene Mutations in Children with Noonan Syndrome. Front. Genet. 2022, 13, 915129. [Google Scholar] [CrossRef] [Scilit]
  29. Weaver, K.N.; Chen, J.; Shikany, A.; White, P.S.; Prada, C.E.; Gelb, B.D.; Cnota, J.F. Prevalence of Genetic Diagnoses in a Cohort with Valvar Pulmonary Stenosis. Circ. Genom. Precis. Med. 2022, 15, E003635. [Google Scholar] [CrossRef] [Scilit]
  30. Orlova, A.; Guseva, D.; Demina, N.; Polyakov, A.; Ryzhkova, O. Spectrum of Mutations in PTPN11 in Russian Cohort. Genes 2024, 15, 345. [Google Scholar] [CrossRef] [Scilit]
  31. Janssen, N.; Daemen, J.H.T.; van Polen, E.J.; Coorens, N.A.; Jansen, Y.J.L.; Franssen, A.J.P.M.; Hulsewé, K.W.E.; Vissers, Y.L.J.; Haecker, F.M.; Milanez de Campos, J.R.; et al. Pectus Excavatum: Consensus and Controversies in Clinical Practice. Ann. Thorac. Surg. 2023, 116, 191–199. [Google Scholar] [CrossRef] [Scilit]
  32. Ferrero, G.B.; Baldassarre, G.; Delmonaco, A.G.; Biamino, E.; Banaudi, E.; Carta, C.; Rossi, C.; Silengo, M.C. Clinical and Molecular Characterization of 40 Patients with Noonan Syndrome. Eur. J. Med. Genet. 2008, 51, 566–572. [Google Scholar] [CrossRef] [Scilit]
  33. Rodprasert, W.; Virtanen, H.E.; Mäkelä, J.A.; Toppari, J. Hypogonadism and Cryptorchidism. Front. Endocrinol. 2020, 10, 906. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Elamo, H.P.; Virtanen, H.E.; Toppari, J. Genetics of Cryptorchidism and Testicular Regression. Best Pract. Res. Clin. Endocrinol. Metab. 2022, 36, 101619. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Lip, S.Z.L.; Murchison, L.E.D.; Cullis, P.S.; Govan, L.; Carachi, R. A Meta-Analysis of the Risk of Boys with Isolated Cryptorchidism Developing Testicular Cancer in Later Life. Arch. Dis. Child. 2013, 98, 20–26. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Papadopoulos, G.; Papadopoulou, A.; Kosma, K.; Papadimitriou, A.; Papaevangelou, V.; Kanaka-Gantenbein, C.; Bountouvi, E.; Kitsiou-Tzeli, S. Molecular and Clinical Profile of Patients Referred as Noonan or Noonan-like Syndrome in Greece: A Cohort of 86 Patients. Eur. J. Pediatr. 2022, 181, 3691–3700. [Google Scholar] [CrossRef] [Scilit]
  37. Bertola, D.R.; Pereira, A.C.; Albano, L.M.J.; De Oliveira, P.S.L.; Kim, C.A.; Krieger, J.E. PTPN11 Gene Analysis in 74 Brazilian Patients with Noonan Syndrome or Noonan-like Phenotype. Genet. Test. 2006, 10, 186–191. [Google Scholar] [CrossRef] [Scilit]
  38. Ouboukss, F.; Adadi, N.; Amasdl, S.; Smaili, W.; Laarabi, F.Z.; Lyahyai, J.; Sefiani, A.; Ratbi, I. High Frequency of Hotspot Mutation in PTPN11 Gene among Moroccan Patients with Noonan Syndrome. J. Appl. Genet. 2024, 65, 303–308. [Google Scholar] [CrossRef] [Scilit]
  39. Gelb, B.D.; Tartaglia, M. Noonan Syndrome with Multiple Lentigines; Adam, M.P., Feldman, J., Mirzaa, G.M., Pagon, R.A., Wallace, S.E., Amemiya, A., Eds.; University of Washington: Seattle, WA, USA, 2007. [Google Scholar]
  40. Kratz, C.P.; Franke, L.; Peters, H.; Kohlschmidt, N.; Kazmierczak, B.; Finckh, U.; Bier, A.; Eichhorn, B.; Blank, C.; Kraus, C.; et al. Cancer Spectrum and Frequency among Children with Noonan, Costello, and Cardio-Facio-Cutaneous Syndromes. Br. J. Cancer 2015, 112, 1392–1397. [Google Scholar] [CrossRef] [Scilit]
  41. Villani, A.; Greer, M.L.C.; Kalish, J.M.; Nakagawara, A.; Nathanson, K.L.; Pajtler, K.W.; Pfister, S.M.; Walsh, M.F.; Wasserman, J.D.; Zelley, K.; et al. Recommendations for Cancer Surveillance in Individuals with RASopathies and Other Rare Genetic Conditions with Increased Cancer Risk. Clin. Cancer Res. 2017, 23, e83–e90. [Google Scholar] [CrossRef] [Scilit]
Table 1. Primers used to amplify the PTPN11 gene exons.
Table 1. Primers used to amplify the PTPN11 gene exons.
ExonPrimer Sequence (5′-3′)Fragment Lenght (bp)
Promoter-1FCTGCACAGTCTCCGGGATC397
Promoter-1RGGCAGGAAATGAATGGGGAC
2FCAGGGAAGGTCTTGATTTG328
2RGCTATCCAAGCATGGTTTTAC
3FGGTAAAATCCGACGTGGAAG394
3RACAGTCACAAGCCTTTGGAG
4FGTGTTTAGGAGAGCTGACTG369
4RAATGGTGTCTGTCTTCTGTC
5FACCCAGCCTATTATCTGTC456
5RCTGTACTCCAGACTGGGTG
6FGGTCCTATGAACCCTCTGTC320
6RCCAAACACAAGAGCAACTTC
7FGAAGTAATGCTGATCCAGGC279
7RCCGATGTGCTAACAAGAGC
8–9FGGGGAGTAACTGATTTGAAC570
8–9RCTAGTCCCTTTTTTCCAGAG
10FCCATGTTGGTGGTTATTAAG364
10RATGGCTACTGAATCAATGAG
11FAGGACCTTTCAGTGGAACC373
11RAAGAGCTAGGAGTGGGTAGG
12FAAAGCCCTATGCTTTTTGC331
12RTCCCATTCAACCTCTCTTC
13FAGACTAAATTAGCATTGTCTCTGAG360
13RCAAACAGTTGTCTATCAGAGCC
14FCCTTGAGAAGGTGAATCCC525
14RGATTACAGGCGTTAGCCAC
15FGCGTTATTTCACTTCTGCC448
15RTACAGGGAGAGGAAAAAGG
PCR conditions and thermal cycler programs are described in detail in Table S1.
Table 2. Clinical characteristics of Noonan syndrome patients with and without PTPN11 gene variants 1.
Table 2. Clinical characteristics of Noonan syndrome patients with and without PTPN11 gene variants 1.
Clinical VariablesVariant-PositiveVariant-Negative
n 2%n 2%
Low height for age32/3982.128/4168.3
Cryptorchidism16/2272.79/2045.0
Heart disease29/4170.726/4065.0
Short neck26/3868.429/4269.0
Pectus excavatum24/3863.235/4283.3 3
Low weight for age22/3956.417/4141.5
Growth hormone treatment16/3348.516/3348.5
Pulmonary valve stenosis21/4151.214/4035.0
Sparse eyebrows16/3842.116/4040.0
Speech delay16/3941.018/3946.2
Microcephaly13/4032.512/4129.3
Global developmental delay13/4032.511/3928.2
Gross motor delay13/4032.513/3933.3
Prolonged PTT (>37.3 seg)10/3132.39/3426.5
Cardiac pharmacological treatment8/3324.211/3333.3
Heart septal defects11/4027.514/4035.0
Easy bruising10/3826.33/407.5 4
Respiratory distress at birth9/4022.512/3831.6
Preterm birth (<37 gw)9/4022.512/3930.8
Cardiomyopathy9/4022.57/4017.5
Deep creases8/3821.16/4015.0
Cognitive delay8/4020.010/3925.6
Intellectual disability (mild to moderate)8/4020.011/4027.5
Learning disabilities8/4020.012/3930.8
Polyhydramnios in prenatal ultrasound7/3818.48/3622.2
Pterigium Colli7/3818.412/4228.6
Fine motor delay7/4017.510/3925.6
Café au lait macules6/3815.84/3710.8
Sparse hair6/3815.84/4010.0
Prolonged prothrombin time (>13.4 seg)4/2714.88/3225.0
Neuro-psychiatric pharmacological treatment4/3312.14/3312.1
Refraction problems5/3813.24/4010.0
Pectus carinatum5/3912.82/405.0
PTT: partial thromboplastin. 1 A complete list of all clinical characteristics can be found in Table S2; here, we only present the most frequently occurring ones (>10%). 2 Unfortunately, not all medical records were complete. p-values of variables with significantly different distribution between both groups: 3 p = 0.04 and 4 p = 0.03.
Table 3. Pathogenic variants of the PTPN11 gene in Mexican patients with Noonan syndrome.
Table 3. Pathogenic variants of the PTPN11 gene in Mexican patients with Noonan syndrome.
ExonAffected
Domain
Reference SNPNucleic
Change
Codon
Alteration
Aminoacid
Change
No. Patients
2N-SH2rs397507501c.124A>GACA>GCAp.Thr42Ala1
3N-SH2rs397507505c.172A>GAAC>GACp.Asn58Asp2
3N-SH2rs397507509c.179G>CGGT>GCTp.Gly60Ala a1
3N-SH2rs121918461c.182A>GGAT>GGTp.Asp61Gly1
3N-SH2rs121918460c.184T>GTAC>GACp.Tyr62Asp a1
3N-SH2rs121918459c.188A>GTAT>TGTp.Tyr63Cys a2
3N-SH2rs397507511c.205G>CGAG>CAGp.Glu69Gln b1
3N-SH2rs121918453c.214G>TGCC>TCCp.Ala72Ser3
3N-SH2rs121918462c.218C<TACT>ATTp.Thr73Ile1
3N-SH2rs121918466c.236A>GCAG>CGGp.Gln79Arg a2
4C-SH2rs397507520c.417G>CGAG>GACp.Glu139Asp1
7PTPrs121918456c.836A>GTAT>TGTp.Tyr279Cys b2
7PTPrs397507529c.844A>GATC>GTCp.Ile282Val1
8PTPrs121918463c.854T>CTTT>TCTp.Phe285Ser1
8PTPrs121918455c.923A>GAAT>AGTp.Asn308Ser2
8PTPrs121918455c.922A>GAAT>GATp.Asn308Asp b7
12PTPrs121918457c.1403C>TACG>ATGp.Thr468Met a3
13PTPrs397507543c.1502G>AAGG>AAGp.Arg501Lys1
13PTPrs397507545c.1507G>AGGG>AGGp.Gly503Arg2
13PTPrs397507547c.1510A>GATG>GTGp.Met504Val7
13PTPrs397507549c.1528C>GCAG>GAGp.Gln510Glu1
Total43
Variants observed through segregation analysis in the studied relatives, where a indicates a variant detected in one patient and b indicates a variant detected in two patients.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zepeda-Olmos, P.M.; Esparza-García, E.; Robles-Espinoza, K.; González-García, J.R.; Rodríguez Gutiérrez, P.G.; Magaña-Torres, M.T. Variants of the PTPN11 Gene in Mexican Patients with Noonan Syndrome. Genes 2024, 15, 1379. https://doi.org/10.3390/genes15111379

AMA Style

Zepeda-Olmos PM, Esparza-García E, Robles-Espinoza K, González-García JR, Rodríguez Gutiérrez PG, Magaña-Torres MT. Variants of the PTPN11 Gene in Mexican Patients with Noonan Syndrome. Genes. 2024; 15(11):1379. https://doi.org/10.3390/genes15111379

Chicago/Turabian Style

Zepeda-Olmos, Paola Montserrat, Eduardo Esparza-García, Kiabeth Robles-Espinoza, Juan Ramón González-García, Perla Graciela Rodríguez Gutiérrez, and María Teresa Magaña-Torres. 2024. "Variants of the PTPN11 Gene in Mexican Patients with Noonan Syndrome" Genes 15, no. 11: 1379. https://doi.org/10.3390/genes15111379

APA Style

Zepeda-Olmos, P. M., Esparza-García, E., Robles-Espinoza, K., González-García, J. R., Rodríguez Gutiérrez, P. G., & Magaña-Torres, M. T. (2024). Variants of the PTPN11 Gene in Mexican Patients with Noonan Syndrome. Genes, 15(11), 1379. https://doi.org/10.3390/genes15111379

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop