Variants of the PTPN11 Gene in Mexican Patients with Noonan Syndrome
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Subjects
2.2. Molecular Analysis
2.2.1. DNA Extraction
2.2.2. Polymerase Chain Reaction
2.2.3. DNA Sequencing
2.2.4. Statistical Analysis
3. Results
3.1. Clinical Characteristics
3.2. Molecular Analysis
3.3. Segregation Analysis
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Tajan, M.; de Rocca Serra, A.; Valet, P.; Edouard, T.; Yart, A. SHP2 Sails from Physiology to Pathology. Eur. J. Med. Genet. 2015, 58, 509–525. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carcavilla, A.; Suárez-Ortega, L.; Rodríguez Sánchez, A.; Gonzalez-Casado, I.; Ramón-Krauel, M.; Labarta, J.I.; Quinteiro Gonzalez, S.; Riaño Galán, I.; Ezquieta Zubicaray, B.; López-Siguero, J.P. Noonan syndrome: Genetic and clinical update and treatment options. An. Pediatr. 2020, 93, 61.e1–61.e14. [Google Scholar] [CrossRef] [Scilit]
- Roberts, A.E.; Allanson, J.E.; Tartaglia, M.; Gelb, B.D. Noonan Syndrome. Lancet 2013, 381, 333–342. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Roberts, A.E. Noonan Syndrome; Adam, M.P., Feldman, J., Mirzaa, G.M., Pagon, R.A., Wallace, S.E., Bean, L.J.H., Gripp, K.W., Amemiya, A., Eds.; University of Washington: Seattle, WA, USA, 2001. [Google Scholar]
- Zenker, M. Clinical Overview on RASopathies. Am. J. Med. Genet. Part C Semin. Med. Genet. 2022, 190, 414–424. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, J.Y.; Park, J. Paternally Inherited Noonan Syndrome Caused by a PTPN11 Variant May Exhibit Mild Symptoms: A Case Report and Literature Review. Genes 2024, 15, 445. [Google Scholar] [CrossRef] [Scilit]
- Rehm, H.L.; Berg, J.S.; Brooks, L.D.; Bustamante, C.D.; Evans, J.P.; Landrum, M.J.; Ledbetter, D.H.; Maglott, D.R.; Martin, C.L.; Nussbaum, R.L.; et al. ClinGen—The Clinical Genome Resource. N. Engl. J. Med. 2015, 372, 2235–2242. [Google Scholar] [CrossRef] [Scilit]
- Zenker, M.; Edouard, T.; Blair, J.C.; Cappa, M. Noonan Syndrome: Improving Recognition and Diagnosis. Arch. Dis. Child. 2022, 107, 1073–1078. [Google Scholar] [CrossRef] [Scilit]
- Kotani, T.; Murata, Y.; Saito, Y.; Matozaki, T. Tyrosine-Protein Phosphatase Nonreceptor Type 11 (PTPN11). In Encyclopedia of Signaling Molecules; Choi, S., Ed.; Springer International Publishing: Cham, Switzerland, 2018; pp. 5803–5811. ISBN 978-3-319-67199-4. [Google Scholar]
- UniProt: The Universal Protein Knowledgebase in 2021. Nucleic Acids Res. 2021, 49, D480–D489. [CrossRef] [Scilit]
- Torres-Carmona, M.A.; Arenas-Sordo, M.L.; Saavedra-Ontiveros, D.; Sánchez-Guerrero, M.C. Periodontal disease in Noonan’s syndrome. Bol. Med. Hosp. Infant. Mex. 1991, 48, 271–274. [Google Scholar]
- Cardiel Ríos, S.A. Correction of a Severe Class II Malocclusion in a Patient with Noonan Syndrome. Am. J. Orthod. Dentofac. Orthop. 2016, 150, 511–520. [Google Scholar] [CrossRef] [Scilit]
- Lloreda-García, J.M.; Martínez-Aedo, M.J.; Tarttaglia, M.; López-Siguero, J.P. Síndrome de Noonan Por Mutación En El Gen PTPN11. An. Pediatr. 2006, 65, 635–636. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- González-Huerta, N.C.; Valdés-Miranda, J.M.; Pérez-Cabrera, A.; Pacheco-Cuellar, G.; González-Huerta, L.M.; Cuevas-Covarrubias, S.A. Noonan Syndrome: Prenatal Diagnosis in a Woman Carrying a PTPN11 Gene Mutation. J. Matern. Neonatal Med. 2010, 23, 688–691. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gustincich, S.; Manfioletti, G.; Del, G.S.; Schneider, C.; Carninci, P. A Fast Method for High-Quality Genomic DNA Extraction from Whole Human Blood. Biotechniques 1991, 11, 298–300. [Google Scholar] [PubMed]
- Kim, Y.; Kim, M.J.; Lee, J.-S.; Lee, J.A.; Song, J.Y.; Im Cho, S.; Park, S.-S.; Seong, M.-W. SnackVar: An Open-Source Software for Sanger Sequencing Analysis Optimized for Clinical Use. J. Mol. Diagn. 2021, 23, 140–148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- den Dunnen, J.T.; Dalgleish, R.; Maglott, D.R.; Hart, R.K.; Greenblatt, M.S.; Mcgowan-Jordan, J.; Roux, A.F.; Smith, T.; Antonarakis, S.E.; Taschner, P.E.M. HGVS Recommendations for the Description of Sequence Variants: 2016 Update. Hum. Mutat. 2016, 37, 564–569. [Google Scholar] [CrossRef] [Scilit]
- Athota, J.P.; Bhat, M.; Nampoothiri, S.; Gowrishankar, K.; Narayanachar, S.G.; Puttamallesh, V.; Farooque, M.O.; Shetty, S. Molecular and Clinical Studies in 107 Noonan Syndrome Affected Individuals with PTPN11 Mutations. BMC Med. Genet. 2020, 21, 50. [Google Scholar] [CrossRef] [Scilit]
- Shaw, A.C.; Kalidas, K.; Crosby, A.H.; Jeffery, S.; Patton, M.A. The Natural History of Noonan Syndrome: A Long-Term Follow-up Study. Arch. Dis. Child. 2007, 92, 128–132. [Google Scholar] [CrossRef] [Scilit]
- Zenker, M.; Buheitel, G.; Rauch, R.; Koenig, R.; Bosse, K.; Kress, W.; Tietze, H.U.; Doerr, H.G.; Hofbeck, M.; Singer, H.; et al. Genotype-Phenotype Correlations in Noonan Syndrome. J. Pediatr. 2004, 144, 368–374. [Google Scholar] [CrossRef] [Scilit]
- Fernández, D.I.; Diender, M.; Hermida-Nogueira, L.; Huang, J.; Veiras, S.; Henskens, Y.M.C.; Te Loo, M.W.M.; Heemskerk, J.W.M.; Kuijpers, M.J.E.; García, Á. Role of SHP2 (PTPN11) in Glycoprotein VI-Dependent Thrombus Formation: Improved Platelet Responsiveness by the Allosteric Drug SHP099 in Noonan Syndrome Patients. Thromb. Res. 2023, 228, 105–116. [Google Scholar] [CrossRef] [Scilit]
- Hu, M.; Liu, P.; Liu, Y.; Yue, M.; Wang, Y.; Wang, S.; Chen, X.; Zhou, Y.; Zhou, J.; Hu, X.; et al. Platelet Shp2 Negatively Regulates Thrombus Stability under High Shear Stress. J. Thromb. Haemost. 2019, 17, 220–231. [Google Scholar] [CrossRef] [Scilit]
- Li, X.; Yao, R.; Tan, X.; Li, N.; Ding, Y.; Li, J.; Chang, G.; Chen, Y.; Ma, L.; Wang, J.; et al. Molecular and Phenotypic Spectrum of Noonan Syndrome in Chinese Patients. Clin. Genet. 2019, 96, 290–299. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tartaglia, M.; Kalidas, K.; Shaw, A.; Song, X.; Musat, D.L.; van der Burgt, I.; Brunner, H.G.; Bertola, D.R.; Crosby, A.; Ion, A.; et al. PTPN11 Mutations in Noonan Syndrome: Molecular Spectrum, Genotype-Phenotype Correlation, and Phenotypic Heterogeneity. Am. J. Hum. Genet. 2002, 70, 1555–1563. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sodero, G.; Cipolla, C.; Pane, L.C.; Sessa, L.; Malavolta, E.; Arzilli, F.; Leoni, C.; Zampino, G.; Rigante, D. Efficacy and Safety of Growth Hormone Therapy in Children with Noonan Syndrome. Growth Horm. IGF Res. 2023, 69–70, 101532. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kamoun, C.; Largent, E.A.; Grimberg, A. Heightism, Growth Hormone Treatment, and Social Functioning: A Holistic Approach to a Persistent Clinical Challenge. Curr. Opin. Pediatr. 2024, 36, 442–448. [Google Scholar] [CrossRef] [Scilit]
- Derbent, M.; Oncel, Y.; Tokel, K.; Varan, B.; Haberal, A.; YaziCi, A.C.; Legius, E.; Ozbek, N. Clinical and Hematologic Findings in Noonan Syndrome Patients with PTPN11 Gene Mutations. Am. J. Med. Genet. Part A 2010, 152, 2768–2774. [Google Scholar] [CrossRef] [Scilit]
- Sun, L.; Xie, Y.M.; Wang, S.S.; Zhang, Z.W. Cardiovascular Abnormalities and Gene Mutations in Children with Noonan Syndrome. Front. Genet. 2022, 13, 915129. [Google Scholar] [CrossRef] [Scilit]
- Weaver, K.N.; Chen, J.; Shikany, A.; White, P.S.; Prada, C.E.; Gelb, B.D.; Cnota, J.F. Prevalence of Genetic Diagnoses in a Cohort with Valvar Pulmonary Stenosis. Circ. Genom. Precis. Med. 2022, 15, E003635. [Google Scholar] [CrossRef] [Scilit]
- Orlova, A.; Guseva, D.; Demina, N.; Polyakov, A.; Ryzhkova, O. Spectrum of Mutations in PTPN11 in Russian Cohort. Genes 2024, 15, 345. [Google Scholar] [CrossRef] [Scilit]
- Janssen, N.; Daemen, J.H.T.; van Polen, E.J.; Coorens, N.A.; Jansen, Y.J.L.; Franssen, A.J.P.M.; Hulsewé, K.W.E.; Vissers, Y.L.J.; Haecker, F.M.; Milanez de Campos, J.R.; et al. Pectus Excavatum: Consensus and Controversies in Clinical Practice. Ann. Thorac. Surg. 2023, 116, 191–199. [Google Scholar] [CrossRef] [Scilit]
- Ferrero, G.B.; Baldassarre, G.; Delmonaco, A.G.; Biamino, E.; Banaudi, E.; Carta, C.; Rossi, C.; Silengo, M.C. Clinical and Molecular Characterization of 40 Patients with Noonan Syndrome. Eur. J. Med. Genet. 2008, 51, 566–572. [Google Scholar] [CrossRef] [Scilit]
- Rodprasert, W.; Virtanen, H.E.; Mäkelä, J.A.; Toppari, J. Hypogonadism and Cryptorchidism. Front. Endocrinol. 2020, 10, 906. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Elamo, H.P.; Virtanen, H.E.; Toppari, J. Genetics of Cryptorchidism and Testicular Regression. Best Pract. Res. Clin. Endocrinol. Metab. 2022, 36, 101619. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lip, S.Z.L.; Murchison, L.E.D.; Cullis, P.S.; Govan, L.; Carachi, R. A Meta-Analysis of the Risk of Boys with Isolated Cryptorchidism Developing Testicular Cancer in Later Life. Arch. Dis. Child. 2013, 98, 20–26. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Papadopoulos, G.; Papadopoulou, A.; Kosma, K.; Papadimitriou, A.; Papaevangelou, V.; Kanaka-Gantenbein, C.; Bountouvi, E.; Kitsiou-Tzeli, S. Molecular and Clinical Profile of Patients Referred as Noonan or Noonan-like Syndrome in Greece: A Cohort of 86 Patients. Eur. J. Pediatr. 2022, 181, 3691–3700. [Google Scholar] [CrossRef] [Scilit]
- Bertola, D.R.; Pereira, A.C.; Albano, L.M.J.; De Oliveira, P.S.L.; Kim, C.A.; Krieger, J.E. PTPN11 Gene Analysis in 74 Brazilian Patients with Noonan Syndrome or Noonan-like Phenotype. Genet. Test. 2006, 10, 186–191. [Google Scholar] [CrossRef] [Scilit]
- Ouboukss, F.; Adadi, N.; Amasdl, S.; Smaili, W.; Laarabi, F.Z.; Lyahyai, J.; Sefiani, A.; Ratbi, I. High Frequency of Hotspot Mutation in PTPN11 Gene among Moroccan Patients with Noonan Syndrome. J. Appl. Genet. 2024, 65, 303–308. [Google Scholar] [CrossRef] [Scilit]
- Gelb, B.D.; Tartaglia, M. Noonan Syndrome with Multiple Lentigines; Adam, M.P., Feldman, J., Mirzaa, G.M., Pagon, R.A., Wallace, S.E., Amemiya, A., Eds.; University of Washington: Seattle, WA, USA, 2007. [Google Scholar]
- Kratz, C.P.; Franke, L.; Peters, H.; Kohlschmidt, N.; Kazmierczak, B.; Finckh, U.; Bier, A.; Eichhorn, B.; Blank, C.; Kraus, C.; et al. Cancer Spectrum and Frequency among Children with Noonan, Costello, and Cardio-Facio-Cutaneous Syndromes. Br. J. Cancer 2015, 112, 1392–1397. [Google Scholar] [CrossRef] [Scilit]
- Villani, A.; Greer, M.L.C.; Kalish, J.M.; Nakagawara, A.; Nathanson, K.L.; Pajtler, K.W.; Pfister, S.M.; Walsh, M.F.; Wasserman, J.D.; Zelley, K.; et al. Recommendations for Cancer Surveillance in Individuals with RASopathies and Other Rare Genetic Conditions with Increased Cancer Risk. Clin. Cancer Res. 2017, 23, e83–e90. [Google Scholar] [CrossRef] [Scilit]
| Exon | Primer Sequence (5′-3′) | Fragment Lenght (bp) |
|---|---|---|
| Promoter-1F | CTGCACAGTCTCCGGGATC | 397 |
| Promoter-1R | GGCAGGAAATGAATGGGGAC | |
| 2F | CAGGGAAGGTCTTGATTTG | 328 |
| 2R | GCTATCCAAGCATGGTTTTAC | |
| 3F | GGTAAAATCCGACGTGGAAG | 394 |
| 3R | ACAGTCACAAGCCTTTGGAG | |
| 4F | GTGTTTAGGAGAGCTGACTG | 369 |
| 4R | AATGGTGTCTGTCTTCTGTC | |
| 5F | ACCCAGCCTATTATCTGTC | 456 |
| 5R | CTGTACTCCAGACTGGGTG | |
| 6F | GGTCCTATGAACCCTCTGTC | 320 |
| 6R | CCAAACACAAGAGCAACTTC | |
| 7F | GAAGTAATGCTGATCCAGGC | 279 |
| 7R | CCGATGTGCTAACAAGAGC | |
| 8–9F | GGGGAGTAACTGATTTGAAC | 570 |
| 8–9R | CTAGTCCCTTTTTTCCAGAG | |
| 10F | CCATGTTGGTGGTTATTAAG | 364 |
| 10R | ATGGCTACTGAATCAATGAG | |
| 11F | AGGACCTTTCAGTGGAACC | 373 |
| 11R | AAGAGCTAGGAGTGGGTAGG | |
| 12F | AAAGCCCTATGCTTTTTGC | 331 |
| 12R | TCCCATTCAACCTCTCTTC | |
| 13F | AGACTAAATTAGCATTGTCTCTGAG | 360 |
| 13R | CAAACAGTTGTCTATCAGAGCC | |
| 14F | CCTTGAGAAGGTGAATCCC | 525 |
| 14R | GATTACAGGCGTTAGCCAC | |
| 15F | GCGTTATTTCACTTCTGCC | 448 |
| 15R | TACAGGGAGAGGAAAAAGG |
| Clinical Variables | Variant-Positive | Variant-Negative | ||
|---|---|---|---|---|
| n 2 | % | n 2 | % | |
| Low height for age | 32/39 | 82.1 | 28/41 | 68.3 |
| Cryptorchidism | 16/22 | 72.7 | 9/20 | 45.0 |
| Heart disease | 29/41 | 70.7 | 26/40 | 65.0 |
| Short neck | 26/38 | 68.4 | 29/42 | 69.0 |
| Pectus excavatum | 24/38 | 63.2 | 35/42 | 83.3 3 |
| Low weight for age | 22/39 | 56.4 | 17/41 | 41.5 |
| Growth hormone treatment | 16/33 | 48.5 | 16/33 | 48.5 |
| Pulmonary valve stenosis | 21/41 | 51.2 | 14/40 | 35.0 |
| Sparse eyebrows | 16/38 | 42.1 | 16/40 | 40.0 |
| Speech delay | 16/39 | 41.0 | 18/39 | 46.2 |
| Microcephaly | 13/40 | 32.5 | 12/41 | 29.3 |
| Global developmental delay | 13/40 | 32.5 | 11/39 | 28.2 |
| Gross motor delay | 13/40 | 32.5 | 13/39 | 33.3 |
| Prolonged PTT (>37.3 seg) | 10/31 | 32.3 | 9/34 | 26.5 |
| Cardiac pharmacological treatment | 8/33 | 24.2 | 11/33 | 33.3 |
| Heart septal defects | 11/40 | 27.5 | 14/40 | 35.0 |
| Easy bruising | 10/38 | 26.3 | 3/40 | 7.5 4 |
| Respiratory distress at birth | 9/40 | 22.5 | 12/38 | 31.6 |
| Preterm birth (<37 gw) | 9/40 | 22.5 | 12/39 | 30.8 |
| Cardiomyopathy | 9/40 | 22.5 | 7/40 | 17.5 |
| Deep creases | 8/38 | 21.1 | 6/40 | 15.0 |
| Cognitive delay | 8/40 | 20.0 | 10/39 | 25.6 |
| Intellectual disability (mild to moderate) | 8/40 | 20.0 | 11/40 | 27.5 |
| Learning disabilities | 8/40 | 20.0 | 12/39 | 30.8 |
| Polyhydramnios in prenatal ultrasound | 7/38 | 18.4 | 8/36 | 22.2 |
| Pterigium Colli | 7/38 | 18.4 | 12/42 | 28.6 |
| Fine motor delay | 7/40 | 17.5 | 10/39 | 25.6 |
| Café au lait macules | 6/38 | 15.8 | 4/37 | 10.8 |
| Sparse hair | 6/38 | 15.8 | 4/40 | 10.0 |
| Prolonged prothrombin time (>13.4 seg) | 4/27 | 14.8 | 8/32 | 25.0 |
| Neuro-psychiatric pharmacological treatment | 4/33 | 12.1 | 4/33 | 12.1 |
| Refraction problems | 5/38 | 13.2 | 4/40 | 10.0 |
| Pectus carinatum | 5/39 | 12.8 | 2/40 | 5.0 |
| Exon | Affected Domain | Reference SNP | Nucleic Change | Codon Alteration | Aminoacid Change | No. Patients |
|---|---|---|---|---|---|---|
| 2 | N-SH2 | rs397507501 | c.124A>G | ACA>GCA | p.Thr42Ala | 1 |
| 3 | N-SH2 | rs397507505 | c.172A>G | AAC>GAC | p.Asn58Asp | 2 |
| 3 | N-SH2 | rs397507509 | c.179G>C | GGT>GCT | p.Gly60Ala a | 1 |
| 3 | N-SH2 | rs121918461 | c.182A>G | GAT>GGT | p.Asp61Gly | 1 |
| 3 | N-SH2 | rs121918460 | c.184T>G | TAC>GAC | p.Tyr62Asp a | 1 |
| 3 | N-SH2 | rs121918459 | c.188A>G | TAT>TGT | p.Tyr63Cys a | 2 |
| 3 | N-SH2 | rs397507511 | c.205G>C | GAG>CAG | p.Glu69Gln b | 1 |
| 3 | N-SH2 | rs121918453 | c.214G>T | GCC>TCC | p.Ala72Ser | 3 |
| 3 | N-SH2 | rs121918462 | c.218C<T | ACT>ATT | p.Thr73Ile | 1 |
| 3 | N-SH2 | rs121918466 | c.236A>G | CAG>CGG | p.Gln79Arg a | 2 |
| 4 | C-SH2 | rs397507520 | c.417G>C | GAG>GAC | p.Glu139Asp | 1 |
| 7 | PTP | rs121918456 | c.836A>G | TAT>TGT | p.Tyr279Cys b | 2 |
| 7 | PTP | rs397507529 | c.844A>G | ATC>GTC | p.Ile282Val | 1 |
| 8 | PTP | rs121918463 | c.854T>C | TTT>TCT | p.Phe285Ser | 1 |
| 8 | PTP | rs121918455 | c.923A>G | AAT>AGT | p.Asn308Ser | 2 |
| 8 | PTP | rs121918455 | c.922A>G | AAT>GAT | p.Asn308Asp b | 7 |
| 12 | PTP | rs121918457 | c.1403C>T | ACG>ATG | p.Thr468Met a | 3 |
| 13 | PTP | rs397507543 | c.1502G>A | AGG>AAG | p.Arg501Lys | 1 |
| 13 | PTP | rs397507545 | c.1507G>A | GGG>AGG | p.Gly503Arg | 2 |
| 13 | PTP | rs397507547 | c.1510A>G | ATG>GTG | p.Met504Val | 7 |
| 13 | PTP | rs397507549 | c.1528C>G | CAG>GAG | p.Gln510Glu | 1 |
| Total | 43 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zepeda-Olmos, P.M.; Esparza-García, E.; Robles-Espinoza, K.; González-García, J.R.; Rodríguez Gutiérrez, P.G.; Magaña-Torres, M.T. Variants of the PTPN11 Gene in Mexican Patients with Noonan Syndrome. Genes 2024, 15, 1379. https://doi.org/10.3390/genes15111379
Zepeda-Olmos PM, Esparza-García E, Robles-Espinoza K, González-García JR, Rodríguez Gutiérrez PG, Magaña-Torres MT. Variants of the PTPN11 Gene in Mexican Patients with Noonan Syndrome. Genes. 2024; 15(11):1379. https://doi.org/10.3390/genes15111379
Chicago/Turabian StyleZepeda-Olmos, Paola Montserrat, Eduardo Esparza-García, Kiabeth Robles-Espinoza, Juan Ramón González-García, Perla Graciela Rodríguez Gutiérrez, and María Teresa Magaña-Torres. 2024. "Variants of the PTPN11 Gene in Mexican Patients with Noonan Syndrome" Genes 15, no. 11: 1379. https://doi.org/10.3390/genes15111379
APA StyleZepeda-Olmos, P. M., Esparza-García, E., Robles-Espinoza, K., González-García, J. R., Rodríguez Gutiérrez, P. G., & Magaña-Torres, M. T. (2024). Variants of the PTPN11 Gene in Mexican Patients with Noonan Syndrome. Genes, 15(11), 1379. https://doi.org/10.3390/genes15111379

