Genomic Analysis of the Giant Red Shrimp (Aristaeomorpha foliacea) Using Next-Generation Sequencing: Set of Tools for Population Studies
Abstract
1. Introduction
2. Materials and Methods
2.1. DNA Extraction and Next-Generation Sequencing
2.2. Microsatellite Loci Screening
2.3. Verification of Candidate Microsatellite Loci
2.4. Data Analysis for Polymorphic Microsatellite Loci Validation
3. Results and Discussion
3.1. NGS De Novo Assembly and Putative Microsatellite Loci Detection
3.2. Verification of Candidate Microsatellite Loci
3.3. Validation and Characterization of Polymorphic Microsatellite Loci
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- De Grave, S.; Fransen, C.H.J.M. Carideorum catalogus: The recent species of the Dendrobranchiate, Stenopodidean, Procarididean and Caridean Shrimps (Crustacea: Decapoda). Zool. Meded. 2011, 85, 195–588. [Google Scholar]
 - Fransen, C.H.J.M. Shrimps and Prawns. In The Living Marine Resources of the Eastern Central Atlantic. Vol. 1: Introduction, Crustaceans, Chitons and Cephalopods. FAO Species Identification Guide for Fishery Purposes, 1st ed.; Carpenter, K.E., De Angelis, N., Eds.; FAO: Rome, Italy, 2014; pp. 37–196. [Google Scholar]
 - D’Onghia, G.; Maiorano, P.; Matarrese, A.; Tursi, A. Distribution, biology, and population dynamics of Aristaeomorpha foliacea (Risso, 1827) (Decapoda, Natantia, Aristeidae) in the north-western Ionian Sea (Mediterranean Sea). Crustaceana 1998, 71, 518–544. [Google Scholar] [CrossRef]
 - Capezzuto, F.; Carlucci, R.; Maiorano, P.; Sion, L.; Battista, D.; Giove, A.; Indennidate, A.; Tursi, A.; D’Onghia, G. The bathyal benthopelagic fauna in the north-western Ionian Sea: Structure, patterns and interactions. Chem. Ecol. 2010, 26, 199–217. [Google Scholar] [CrossRef]
 - Politou, C.Y.; Kapiris, K.; Maiorano, P.; Capezzuto, F.; Dokos, J. Deep-sea Mediterranean biology: The case of Aristaeomorpha foliacea (Risso, 1827) (Crustacea: Decapoda: Aristeidae). Sci. Mar. 2004, 68, 129–139. [Google Scholar] [CrossRef]
 - Sardà, F.; Calafat, A.; Flexas, M.; Tselepides, A.; Canals, M.; Espino, M.; Tursi, A. An introduction to Mediterranean deep-sea biology. Sci. Mar. 2004, 68, 7–38. [Google Scholar] [CrossRef]
 - Dall, W. Australian species of Aristeidae and Benthesicymideae (Penaeoidea: Decapoda). Mem. Queensl. Mus. 2001, 46, 409–441. [Google Scholar]
 - Holthuis, L.B. Shrimps and prawns of the world. An annotated catalogue of species of interest to fisheries. FAO species catalogue, Vol 1. FAO Fish. Synop. 1980, 125, 1–271. [Google Scholar]
 - Cau, A.; Carbonell, A.; Follesa, M.C.; Mannini, A.; Norrito, G.; Orsi-Relini, L.; Politou, C.-Y.; Ragonese, S.; Rinelli, P. MEDITS-based information on the deep-water red shrimps Aristaeomorpha foliacea and Aristeus antennatus (Crustacea: Decapoda: Aristeidae). Sci. Mar. 2002, 66, 103–124. [Google Scholar] [CrossRef][Green Version]
 - Company, J.B.; Maiorano, P.; Tselepides, A.; Politou, C.-Y.; Plaity, W.; Rotllant, G.; Sardà, F. Deep-sea decapod crustaceans in the western and central Mediterranean Sea: Preliminary aspects of species distribution, biomass and population structure. Sci. Mar. 2004, 68, 73–86. [Google Scholar] [CrossRef]
 - Food and Agriculture Organization (FAO). Report of the FAO Workshop on Deep-Sea Fisheries and Vulnerable Marine Ecosystems of the Mediterranean, Rome, Italy, 18–20 July 2016; FAO Fisheries and Aquaculture Report No. 1183; FAO: Rome, Italy, 2016; pp. I–VI, 1–25. [Google Scholar]
 - Food and Agriculture Organization (FAO); General Fisheries Commission for the Mediterranean. Report of the Twenty-Fourth Session of the Scientific Advisory Committee on Fisheries, FAO Headquarters, Rome, Italy, 20–23 June 2023; FAO Fisheries and Aquaculture Report, No. 1421; FAO: Rome, Italy, 2023; pp. I–VII, 1–159. [Google Scholar]
 - Wadley, V. Biology and fishery of Aristaeomorpha foliacea on the north-west slope of Australia. In Life Cycles and Fisheries of the Deepwater Red Shrimps Aristaeomorpha foliacea and Aristeus antennatus, Proceedings of the International Workshop Held in the Istituto di Tecnologia della Pesca e del Pescato (NTR ITPP), Mazara, Italy, 28–30 April 1994; Bianchini, B.L., Ragonese, S., Eds.; Special Publication 3; ITTP Special Publications: Mazara del Vallo, Italy, 1994; Volume 3, pp. 63–64. [Google Scholar]
 - Sobrino, I.; Dias, N.; Muñoz, I.; Salmerón, F.; Varela, D. Distribution patterns and biological characteristics of Aristeus antennatus (Risso, 1816) and Aristeus virilis (Bate, 1881) in Mozambique Waters of the Western Indian Ocean. West Indian Ocean J. Mar. Sci. 2009, 8, 49–59. [Google Scholar] [CrossRef]
 - Dallagnolo, R.; Alvarez Perez, J.A.; Pezzuto, P.R.; Wahrlich, R. The deep-sea shrimp fishery off Brazil (Decapoda: Aristeidae): Development and present status. Lat. Am. J. Aquat Res. 2009, 37, 327–346. [Google Scholar] [CrossRef]
 - Gracia, A.; Vázquez-Bader, A.R.; Lozano-Alvarez, E.; Briones-Fourzán, P. Deep-water shrimp (Crustacea: Penaeoidea) off the Yucatan peninsula (southern Gulf of Mexico): A potential fishing resource? J. Shellfish Res. 2010, 29, 37–43. [Google Scholar] [CrossRef]
 - Paramo, J.; Saint-Paul, U. Deep-sea shrimps Aristaeomorpha foliacea and Pleoticus robustus (Crustacea: Penaeoidea) in the Colombian Caribbean Sea as a new potential fishing resource. J. Mar. Biol. Assoc. 2012, 92, 811–818. [Google Scholar] [CrossRef]
 - Food and Agriculture Organization (FAO); General Fisheries Commission for the Mediterranean. Report of the Ninth Session of the Scientific Advisory Committee, Rome, 24–27 October 2006; FAO Fisheries Report No. 814; FAO: Rome, Italy, 2006; pp. I–VI, 1–106. [Google Scholar]
 - Regulation (EU) 2019/1022 of the European Parliament and of the Council of 20 June 2019 Establishing a Multiannual Plan for the Fisheries Exploiting Demersal Stocks in the Western Mediterranean Sea and Amending Regulation (EU) No 508/2014. Available online: https://eur-lex.europa.eu/legal-content/EN/TXT/HTML/?uri=CELEX:32019R1022 (accessed on 3 September 2024).
 - Food and Agriculture Organization (FAO); General Fisheries Commission for the Mediterranean; Scientific Advisory Committee on Fisheries (SAC). Report of the Working Group on Stock Assessment of Demersal Species (WGSAD) Session on the Assessment of Deep-Water Red Shrimp, Online, 8–11 February 2022 Report; FAO: Rome, Italy, 2022; pp. 1–20. [Google Scholar]
 - Food and Agriculture Organization (FAO); General Fisheries Commission for the Mediterranean. Report of the Twenty-Third Session of the Scientific Advisory Committee on Fisheries, FAO Headquarters, Rome, Italy, 21–24 June 2022; FAO Fisheries and Aquaculture Report No. 1395; FAO: Rome, Italy, 2022; pp. I–VII, 1–151. [Google Scholar]
 - Council Regulation (EU) 2023/195 of 30 January 2023 Fixing for 2023 the Fishing Opportunities for Certain Stocks and Groups of Fish Stocks Applicable in the Mediterranean and Black Seas. Available online: https://eur-lex.europa.eu/legal-content/EN/TXT/?uri=CELEX%3A32023R0195 (accessed on 3 September 2024).
 - Deval, M.C.; Yılmaz, S.; Kapiris, K. Spatio Temporal Variations in Decapod Crustacean Assemblages of Bathyal Ground in the Antalya Bay (Eastern Mediterranean). Turk. J. Fish Aquat. Sc. 2017, 17, 967–979. [Google Scholar] [CrossRef]
 - Masnadi, F.; Criscoli, A.; Lanteri, L.; Mannini, A.; Osio, G.C.; Sartor, P.; Sbrana, M.; Ligas, A. Effects of environmental and anthropogenic drivers on the spatial distribution of deep-sea shrimps in the Ligurian and Tyrrhenian Seas (NW Mediterranean). Hydrobiologia 2018, 816, 165–178. [Google Scholar] [CrossRef]
 - Deval, M.C. Population Dynamics and Biological Patterns of Commercial Crustacean Species in the Antalya Bay, Eastern Mediterranean Sea: III. The Giant Red Shrimp Aristaeomorpha foliacea Risso, 1827. Turk. J. Fish Aquat. Sc. 2019, 20, 311–323. [Google Scholar] [CrossRef]
 - Guijarro, B.; Bitetto, I.; D’Onghia, G.; Follesa, M.C.; Kapiris, K.; Mannini, A.; Marković, O.; Micallef, R.; Ragonese, S.; Skarvelis, K.; et al. Spatial and temporal patterns in the Mediterranean populations of Aristaeomorpha foliacea and Aristeus antennatus (Crustacea: Decapoda: Aristeidae) based on the MEDITS surveys. Sci. Mar. 2019, 83, 57–70. [Google Scholar] [CrossRef]
 - Cartes, J.E.; Fanelli, E.; Kapiris, K.; Bayhan, Y.K.; Ligas, A.; López-Pérez, C.; Murenu, M.; Papiol, V.; Rumolo, P.; Scarcella, G. Spatial variability in the trophic ecology and biology of the deep-sea shrimp Aristaeomorpha foliacea in the Mediterranean Sea. Deep-Sea Res. I Oceanogr. Res. Pap. 2014, 87, 1–13. [Google Scholar] [CrossRef]
 - Kapiris, K.; Thessalou-Legaki, M. Comparative fecundity and oocyte size of Aristaeomorpha foliacea and Aristeus antennatus in the greek Ionian Sea (E Mediterranean (Decapoda: Aristeidae). Acta Zool. 2006, 87, 239–245. [Google Scholar] [CrossRef]
 - Kapiris, K.; Thessalou-Legaki, M. Comparative reproduction aspects of the deep-water shrimps Aristaeomorpha foliacea and Aristeus antennatus (Decapoda, Aristeidae) in the Greek Ionian Sea (Eastern Mediterranean). Int. J. Zool. 2009, 2009, 979512. [Google Scholar] [CrossRef]
 - Politou, C.Y.; Kavadas, S.; Mytilineou, C.; Tursi, A.; Carlucci, R.; Lembo, G. Fisheries Resources in the Deep Waters of the Eastern Mediterranean (Greek Ionian Sea). J. Northwest Atl. Fish Sci. 2003, 31, 35–46. [Google Scholar] [CrossRef]
 - Ragonese, S.; Zagra, M.; Di Stefano, L.; Bianchini, M.L. Effect of codend mesh size on the performance of the deep-water bottom trawl used in the red shrimp fishery in the Strait of Sicily (Mediterranean Sea). Hydrobiologia 2001, 449, 279–291. [Google Scholar] [CrossRef]
 - Food and Agriculture Organization (FAO). Report of the Expert Consultation on Utilization and Conservation of Aquatic Genetic Resources, Grottaferrata, Italy, 9–13 November 1992; FAO Fisheries Report No. 491; FAO: Rome, Italy, 1993; pp. I–V, 1–58. [Google Scholar]
 - Frankham, R. Genetics and conservation biology. C. R. Biol. 2003, 326, 22–29. [Google Scholar] [CrossRef] [PubMed]
 - Fernández, M.V.; Maltagliati, F.; Pannacciulli, F.G.; Roldán, M. Analysis of genetic variability in Aristaeomorpha foliacea (Crustacea, Aristeidae) using DNA-ISSR (Inter Simple Sequence Repeats) markers. Comptes Rendus Biol. 2011, 334, 705–712. [Google Scholar] [CrossRef]
 - Fernández, M.V.; Heras, S.; Maltagliati, F.; Roldán, M.I. Deep genetic divergence in giant red shrimp Aristaeomorpha foliacea (Risso, 1827) across a wide distributional range. J. Sea. Res. 2013, 76, 146–153. [Google Scholar] [CrossRef]
 - Fernández, M.V.; Heras, S.; Viñas, J.; Maltagliati, F.; Roldán, M.I. Multilocus comparative phylogeography of two Aristeid shrimps of high commercial interest (Aristeus antennatus and Aristaeomorpha foliacea) reveals different responses to past environmental changes. PLoS ONE 2013, 8, e59033. [Google Scholar] [CrossRef]
 - Abdul-Muneer, P.M. Application of microsatellite markers in conservation genetics and fisheries management: Recent advances in population structure analysis and conservation strategies. Genet. Res. Int. 2014, 2014, 691759. [Google Scholar] [CrossRef]
 - Joshi, D.; Ram, R.N.; Lohani, P. Microsatellite markers and their application in fisheries. Int. J. Adv. Agric. Sci. Technol. 2017, 4, 67–104. [Google Scholar]
 - Tripathy, S.K. Broad Spectrum Utilities of Microsatellite in Fish and Fisheries. J. Biotechnol. Res. 2018, 4, 29–45. [Google Scholar]
 - Wenne, R. Microsatellites as Molecular Markers with Applications in Exploitation and Conservation of Aquatic Animal Populations. Genes 2023, 14, 808. [Google Scholar] [CrossRef]
 - Benzie, J.A. Population genetic structure in penaeid prawns. Aquac. Res. 2000, 31, 95–119. [Google Scholar] [CrossRef]
 - Ball, A.O.; Chapman, R.W. Population genetic analysis of white shrimp, Litopenaeus setiferus, using microsatellite genetic markers. Mol. Ecol. 2003, 12, 2319–2330. [Google Scholar] [CrossRef] [PubMed]
 - Waqairatu, S.S.; Dierens, L.; Cowley, J.A.; Dixon, T.J.; Johnson, K.N.; Barnes, A.C.; Li, Y. Genetic analysis of Black Tiger shrimp (Penaeus monodon) across its natural distribution range reveals more recent colonization of Fiji and other South Pacific islands. Ecol. Evol. 2012, 2, 2057–2071. [Google Scholar] [CrossRef]
 - Shokoohmand, M.; Zolgharnein, H.; Mashjoor, S.; Laloi, F.; Foroughmand, A.M.; Savari, A. Analysis of Genetic Diversity of White Shrimp (Metapenaeus affinis) from the Northwest of the Persian Gulf Using Microsatellite Markers. Turk. J. Fish Aquat. Sci. 2018, 18, 385–394. [Google Scholar] [CrossRef]
 - Heras, S.; Planella, L.; García-Marín, J.L.; Vera, M.; Roldán, M.I. Genetic structure and population connectivity of the blue and red shrimp Aristeus antennatus. Sci. Rep. 2019, 9, 13531. [Google Scholar] [CrossRef]
 - Tamadoni Jahromi, S.; Othman, A.; Rosazlina, R.; Pourmozaffar, S.; Gozari, M. Population genetics of Penaeus semisulcatus from Persian Gulf and Oman Sea using newly developed DNA microsatellite markers. Iran. J. Fish Sci. 2021, 20, 157–178. [Google Scholar] [CrossRef]
 - Wong, L.L.; Chun, L.C.; Deris, Z.M.; Zainudin, A.A.; Ikhwanuddin, M.; Iehata, S.; Rahman, M.M.; Asaduzzaman, M. Genetic diversity and population structure of wild and domesticated black tiger shrimp (Penaeus monodon) broodstocks in the Indo-Pacific regions using consolidated mtDNA and microsatellite markers. Gene Rep. 2021, 23, 101047. [Google Scholar] [CrossRef]
 - Cannas, R.; Marcias, S.; Sacco, F.; Cau, A.; Deiana, A.M. First isolation and characterization of genomic SSR markers for the giant red shrimp Aristaeomorpha foliacea. Genet. Mol. Res. 2012, 11, 2745–2748. [Google Scholar] [CrossRef]
 - Zane, L.; Bargelloni, L.; Patarnello, T. Strategies for microsatellite isolation: A review. Mol. Ecol. 2002, 11, 1–16. [Google Scholar] [CrossRef]
 - Marcias, S.; Sacco, F.; Cau, A.; Cannas, R. Microsatellite markers for population genetic studies of the giant red shrimp Aristaeomorpha foliacea (Crustacea, Decapoda). Rapp. Comm. Int. Mer Médit. 2010, 39, 386. [Google Scholar]
 - Fernandez-Silva, I.; Toonen, R.J. Optimizing selection of microsatellite loci from 454 pyrosequencing via post-sequencing bioinformatic analyses. Methods Mol. Biol. 2013, 1006, 101–120. [Google Scholar] [CrossRef] [PubMed]
 - Schoebel, C.N.; Brodbeck, S.; Buehler, D.; Cornejo, C.; Gajurel, J.; Hartikainen, H.; Keller, D.; Leys, M.; Ricanova, S.; Segelbacher, G.; et al. Lessons learned from microsatellite development for nonmodel organisms using 454 pyrosequencing. J. Evol. Biol. 2013, 26, 600–611. [Google Scholar] [CrossRef] [PubMed]
 - Heras, S.; Planella, L.; Caldarazzo, I.; Vera, M.; García-Marín, J.L.; Roldán, M.I. Development and characterization of novel microsatellite markers by Next Generation Sequencing for the blue and red shrimp Aristeus antennatus. PeerJ 2016, 4, e2200. [Google Scholar] [CrossRef] [PubMed]
 - Zeng, D.; Chen, X.; Xie, D.; Zhao, Y.; Yang, C.; Li, Y.; Ma, N.; Peng, M.; Yang, Q.; Liao, Z.; et al. Transcriptome analysis of pacific white shrimp (Litopenaeus vanammei) hepatopancreas in response to Taura Syndrome Virus (TSV) experimental infection. PLoS ONE 2013, 8, e57515. [Google Scholar] [CrossRef]
 - He, Y.; Li, Z.; Liu, P.; Wang, Q.; Li, J. Transcriptic analysis of Huanghai No. 1 strain of Chinese shrimp Fenneropenaeus chinensis using 454 pyrosequencing. Fish. Sci. 2016, 82, 327–336. [Google Scholar] [CrossRef]
 - Perez-Enriquez, R.; Medina-Espinoza, J.A.; Max-Aguilar, A.; Saucedo-Barrón, C.J. Genetic tracing of farmed shrimp (Decapoda: Penaeidae) in wild populations from a main aquaculture region in Mexico. Rev. Biol. Trop. 2018, 66, 381–393. [Google Scholar] [CrossRef]
 - Dao, H.T.; Todd, E.V.; Jerry, D.R. Characterization of polymorphic microsatellite loci for the spiny lobster Panulirus spp. and their utility to be applied to other Panulirus lobsters. Conserv. Genet. Res. 2013, 5, 43–46. [Google Scholar] [CrossRef]
 - Dambach, J.; Raupach, M.J.; Mayer, C.; Schwarzer, J.; Leese, F. Isolation and characterization of nine polymorphic microsatellite markers for the deep-sea shrimp Nematocarcinus lanceopes (Crustacea: Decapoda: Caridea). BMC Res. Notes 2013, 6, 75. [Google Scholar] [CrossRef]
 - Miller, A.D.; Van Rooyen, A.; Sweeney, O.F.; Whiterod, N.S.; Weeks, A.R. The development of 10 novel polymorphic microsatellite markers through next generation sequencing and a preliminary population genetic analysis for the endangered Glenelg spiny crayfish, Eustacus bispinosus. Mol. Biol. Rep. 2013, 40, 4415–4419. [Google Scholar] [CrossRef]
 - Kennington, J.W.; Guildea, C.; Lukehurst, S.S.; Hitchen, Y.; Gardner, M.G.; Duffy, R.; Dias, P.J.; Ledger, J.M.; Snow, M. Isolation and characterization of 13 polymorphic microsatellite loci for the smooth Cherax cainii and hairy marron C. tenuimanus (Decapoda: Parastacidae). Conserv. Genet. Resour. 2014, 6, 337–339. [Google Scholar] [CrossRef]
 - Ma, H.; Ma, C.; Li, S.; Jiang, W.; Li, X.; Liu, Y.; Ma, L. Transcriptome analysis of the mud crab (Scylla paramamosain) by 454 deep sequencing: Assembly, annotation, and marker discovery. PLoS ONE 2014, 9, e102668. [Google Scholar] [CrossRef] [PubMed]
 - Loughnan, S.R.; Beheregaray, L.B.; Robinson, N.A. Microsatellite marker development based on next-generation sequencing for the smooth marron (Cherax cainii, Austin) and cross-species amplification in other Cherax species. BMC Res. Notes 2015, 8, 370. [Google Scholar] [CrossRef][Green Version]
 - Delghandi, M.; Afzal, H.; Al Hinai, M.S.; Al-Breiki, R.D.; Jerry, D.R.; Dao, H.T. Novel Polymorphic Microsatellite Markers for Panulirus ornatus and their Cross-species Primer Amplification in Panulirus homarus. Anim. Biotechnol. 2016, 27, 310–314. [Google Scholar] [CrossRef]
 - Díaz-Cabrera, E.; Meerhoff, E.; Rojas-Hernandez, N.; Vega-Retter, C.; Veliz, D. Development and characterization of the first 16 microsatellites loci for Panulirus pascuensis (Decapoda: Palinuridae) from Easter Island using Next Generation Sequencing. Rev. Biol. Mar. Oceanogr. 2017, 52, 395–398. [Google Scholar] [CrossRef]
 - Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd ed.; Cold Spring Harbor Laboratory Press: New York, NY, USA, 1989. [Google Scholar]
 - Benson, G. Tandem repeats finder: A program to analyze DNA sequences. Nucleic Acids Res. 1999, 27, 573–580. [Google Scholar] [CrossRef] [PubMed]
 - Untergrasser, A.; Cutcutache, I.; Koressaar, T.; Ye, J.; Faircloth, B.C.; Remm, M.; Rozen, S.G. Primer3—New capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar] [CrossRef]
 - Schuelke, M. An economic method for the fluorescent labeling of PCR fragments. Nat. Biotechnol. 2000, 18, 233–234. [Google Scholar] [CrossRef]
 - Kearse, M.; Moir, R.; Wilson, A.; Stones-Havas, S.; Cheung, M.; Sturrock, S.; Buxton, S.; Cooper, A.; Markowitz, S.; Duran, C.; et al. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 2012, 28, 1647–1649. [Google Scholar] [CrossRef] [PubMed]
 - Rousset, F. Genepop’007: A complete reimplementation of the Genepop software for Windows and Linux. Mol. Ecol. Resour. 2008, 8, 103–106. [Google Scholar] [CrossRef]
 - Van Oosterhout, C.; Hutchison, W.F.; Shipley, P.; Wills, D.P.M. Micro-Checker: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar] [CrossRef]
 - Kalinowski, S.T.; Taper, M.L.; Marshall, T.C. Revising how the computer program CERVUS accommodates genotyping error increases success in paternity assignment. Mol. Ecol. 2007, 16, 1099–1106. [Google Scholar] [CrossRef] [PubMed]
 - Leese, F.; Brand, P.; Rozenberg, A.; Mayer, C.; Agrawal, S.; Dambach, J.; Dietz, L.; Doemel, J.S.; Goodall-Copstake, W.P.; Held, C.; et al. Exploring Pandora’s Box: Potential and pitfalls of low coverage genome surveys for evolutionary biology. PLoS ONE 2012, 7, e49202. [Google Scholar] [CrossRef] [PubMed][Green Version]
 - Espinosa López, G.; Jager, M.; García-Machado, E.; Borrell Pichs, Y.; Corona Rodríguez, N.; Robainas Barcia, A.; Deutsch, J. Microsatellites from the white shrimp Litopenaeus schmitti (Crustacea, Decapoda). Biotecnol. Apl. 2001, 18, 232–234. [Google Scholar]
 - Robainas, A.; Espinosa, G.; García-Machado, E. Characterization of the Pink shrimp Farfantenaeus notialis (Crustacea, Decapoda) microsatellite DNA. Rev. Investig. Mar. 2003, 24, 161–164. [Google Scholar]
 - Yuan, J.; Zhang, X.; Li, F.; Xiang, J. Genome Sequencing and Assembly Strategies and a Comparative Analysis of the Genomic Characteristics in Penaeid Shrimp Species. Front. Genet. 2021, 12, 658619. [Google Scholar] [CrossRef]
 - Chiang, T.Y.; Tzeng, T.D.; Lin, H.D.; Cho, C.J.; Lin, F.J. Isolation and characterization of polymorphic microsatellite loci from Metapenaeopsis barbata using PCR-Based Isolation of Microsatellite Arrays (PIMA). Int. J. Mol. Sci. 2012, 13, 2763–2768. [Google Scholar] [CrossRef]
 - Pérez, F.; Ortiz, J.; Zhinaula, M.; Gonzabay, C.; Calderón, J.; Volckaert, F.A. Development of EST-SSR markers by data mining in three species of shrimp: Litopenaeus vannamei, Litopenaeus stylirostris, and Trachypenaeus birdy. Mar. Biotechnol. 2005, 7, 554–569. [Google Scholar] [CrossRef]
 
| Locus | Repeat Motif | Primer Sequences 5′–3′ | Ta (°C) 1 | NA 1 | Allele Size Range (bp) | 
|---|---|---|---|---|---|
| Af1a | (TA)12 | F: GCATTCACAGCAGGAGCATA R: ACGGACATCGTCGTCATACA  | 60 | 2 | 177, 179 | 
| Af1b | (TAG)7 | F: CCTGCATGAATGACGACAAC R: CCACGCAGGATTAGATCCAC  | 50 | 3 | 254–260 | 
| Af1c | (ATA)7 | F: GGGAATCCCTGTTGGTTTCT R: CCTTCCTCGGTGACGTTAAA  | 60 | 2 | 204, 207 | 
| Af1d | (TGAC)12 | F: GAAGGCCCGGGTAAGTTTGA R: AGCCAGTTAGCAGGAGCAAG  | 60 | 5 | 370–390 | 
| Af1e | (TA)11 | F: GCCGTATATCGGCCTGTACT R: CCTCCTCCTTCTTCTTCTTGG  | 50 | 3 | 245–255 | 
| Af22a | (CTA)6 + (TGC)8 | F: GGAGGTTTTATCCACCAGACG R: CCCAGAGAGTTCGAAAACCTT  | 60 | 6 | 266–281 | 
| Af22b | (CTC)6 + (TAA)6 | F: TGAGCTGGGCATCTCTCTCT R: TGTTGTAGTAGCCGCCCTCT  | 60 | 5 | 161–176 | 
| Af22c | (TAC)5 | F: AAATTCTCCCCCTCCTTTCC R: GGGTTTGCCTCGGAATAAAT  | 60 | 2 | 268, 271 | 
| Af22d | (AG)9 | F: CGGAGACTACTCCAGCCTTG R: GTCGCGCATCGGTCTAGATA  | 60 | 5 | 244–252 | 
| Af40a | (TCCC)5 | F: CCGTTCTTTCCCTCCCATA R: TTCGAATGACAACAATAATGTGC  | 60 | 3 | 222–234 | 
| Af40b | (TC)8 | F: TCCTCAAGCACATTATTGTTGTCA R: AGGAAGGAACGAACGAAGGG  | 60 | 3 | 345–353 | 
| Af75 | (AT)10 | F: ATGGTCTGGTGTGGGTTGTT R: TAGAGCCACCAAGTGCTCCT  | 60 | 4 | 224–240 | 
| Af181 | (AT)29 | F: CGATGTGGGTGTGTCAAGTC R: GGCATGAATTGGTAAGTGGAG  | 60 | 2 | 441, 443 | 
| Af341 | (TCT)8 | F: CACCCTTCCGCTACCTCAT R: GTAGGCGTGAGAGGGTCGT  | 50 | 2 | 169, 172 | 
| Af518 | (AGAT)7 | F: TCAGCTGCTTTGTGAGAAGG R: CCAACGTTTAAGAGAGGCATAA  | 50 | 2 | 199, 203 | 
| Af880 | (GTT)7 | F: CGTCTTGACCCAAGGCTTTA R: GCTCCCACTTGCTCAAGAAC  | 60 | 2 | 251, 254 | 
| Af1110 | (AT)5 | F: TTGGACACGAAACCGTATCA R: CAAACTGCCGGTATCCTCTC  | 60 | 2 | 207, 211 | 
| Af1148 | (ATA)8 | F: TTGTTGTTGCGACACAAGAAAT R: TGATAGTGTCCCTCACAACACAC  | 50 | 2 | 208, 211 | 
| Af1793 | (TGG)5 | F: GGGGTAACGTCGGTTTACATT R: CCTTAACCTCGTCATTACCAACC  | 60 | 3 | 72–78 | 
| Locus | GenBank 1 | NA 1 | Allele Size Range (bp) | Ho 1 | He 1 | FIS 1 | p-Value 1 | 
|---|---|---|---|---|---|---|---|
| Af1a | PQ073196 | 1 | 177 | 0.000 | 0.000 | - | - | 
| Af1b | PQ073196 | 3 | 254–260 | 0.500 | 0.543 | 0.078 | 0.335 | 
| Af1e | PQ073196 | 1 | 245 | 0.000 | 0.000 | - | - | 
| Af22c | PQ073197 | 3 | 268–274 | 0.557 | 0.448 | −0.264 | 0.345 | 
| Af40a | PQ073198 | 4 | 222–234 | 0.300 | 0.508 | 0.410 | 0.007 | 
| Af40b | PQ073198 | 10 | 331–355 | 0.433 | 0.851 | 0.491 | 0.000 * | 
| Af75 | PQ073199 | 3 | 234–242 | 0.067 | 0.066 | −0.009 | 1.000 | 
| Af518 | PQ073200 | 3 | 191–203 | 0.100 | 0.159 | 0.370 | 0.165 | 
| Af880 | PQ073201 | 3 | 245–251 | 0.233 | 0.215 | −0.086 | 1.000 | 
| Af1110 | PQ073202 | 3 | 207–211 | 0.167 | 0.214 | 0.220 | 0.325 | 
| Af1148 | PQ073203 | 4 | 205–214 | 0.300 | 0.364 | 0.177 | 0.040 | 
| Af1793 | PQ073204 | 2 | 72,78 | 0.100 | 0.097 | −0.036 | 1.000 | 
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.  | 
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Heras, S.; Abras, A.; Palahí, A.; García-Marín, J.-L.; Roldán, M.I. Genomic Analysis of the Giant Red Shrimp (Aristaeomorpha foliacea) Using Next-Generation Sequencing: Set of Tools for Population Studies. Genes 2024, 15, 1360. https://doi.org/10.3390/genes15111360
Heras S, Abras A, Palahí A, García-Marín J-L, Roldán MI. Genomic Analysis of the Giant Red Shrimp (Aristaeomorpha foliacea) Using Next-Generation Sequencing: Set of Tools for Population Studies. Genes. 2024; 15(11):1360. https://doi.org/10.3390/genes15111360
Chicago/Turabian StyleHeras, Sandra, Alba Abras, Aleix Palahí, Jose-Luis García-Marín, and María Inés Roldán. 2024. "Genomic Analysis of the Giant Red Shrimp (Aristaeomorpha foliacea) Using Next-Generation Sequencing: Set of Tools for Population Studies" Genes 15, no. 11: 1360. https://doi.org/10.3390/genes15111360
APA StyleHeras, S., Abras, A., Palahí, A., García-Marín, J.-L., & Roldán, M. I. (2024). Genomic Analysis of the Giant Red Shrimp (Aristaeomorpha foliacea) Using Next-Generation Sequencing: Set of Tools for Population Studies. Genes, 15(11), 1360. https://doi.org/10.3390/genes15111360
        
                                                
