Next Article in Journal
Nutrient-Sensing Ghrelin Receptor in Macrophages Modulates Bisphenol A-Induced Intestinal Inflammation in Mice
Previous Article in Journal
Phylogenetic Analysis of Some Species of the Anopheles hyrcanus Group (Diptera: Culicidae) in China Based on Complete Mitochondrial Genomes
Previous Article in Special Issue
Cloning, Expression Analysis and SNP Screening of the kiss1 Gene in Male Schizothorax biddulphi
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Mn-XRN1 Has an Inhibitory Effect on Ovarian Reproduction in Macrobrachium nipponense

1
National Demonstration Center for Experimental Fisheries Science Education, Shanghai Ocean University, Shanghai 201306, China
2
Wuxi Fisheries College, Nanjing Agricultural University, Wuxi 214081, China
3
Key Laboratory of Freshwater Fisheries and Germplasm Resources Utilization, Ministry of Agriculture, Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi 214081, China
*
Authors to whom correspondence should be addressed.
Genes 2023, 14(7), 1454; https://doi.org/10.3390/genes14071454
Submission received: 7 June 2023 / Revised: 13 July 2023 / Accepted: 14 July 2023 / Published: 16 July 2023
(This article belongs to the Special Issue Fish and Shellfish Genetics and Breeding)

Abstract

XRN1 is an exoribonuclease that degrades mRNA in the cytoplasm along the 5′–3′ direction. A previous study indicated that it may be involved in the reproduction of Macrobrachium nipponense. Quantitative real-time PCR was used to detect the spatiotemporal expression pattern of Mn-XRN1. At the tissue level, Mn-XRN1 was significantly expressed in the ovary. During development, Mn-XRN1 was significantly expressed at the CS stage of the embryo, on the 10th day post-larval and in the O2 stage of ovarian reproduction. The in situ hybridization results showed the location of Mn-XRN1 in the ovary. The expression of Mn-VASA was significantly increased after in vivo injection of Mn-XRN1 dsRNA. This suggests that Mn-XRN1 negatively regulates the expression of Mn-VASA. Furthermore, we counted the number of M. nipponense at various stages of ovarian reproduction on different days after RNAi. The results showed that ovarian development was significantly accelerated. In general, the results of the present study indicate that Mn-XRN1 has an inhibitory effect on the ovarian maturation of M. nipponense. The inhibitory effect might be through negative regulation of Mn-VASA.

1. Introduction

M. nipponense is an economically important freshwater aquaculture species in China due to the advantages of good stress resistance and rapid growth [1]. However, the rapid sexual maturity of M. nipponense has been a constraint on increased production. Female prawns have a short maturation cycle and can generally lay eggs two to three times per year [2]. Faster sexual maturity allows females to spend most of their energy on ovarian development, resulting in smaller individuals [3]. Furthermore, rapid sexual maturation leads to inbreeding and multigenerational coexistence, which in turn affects the germplasm [4,5]. The sex regulation mechanism of M. nipponense is currently unclear. Only by understanding this mechanism can we regulate the speed of sexual maturity in M. nipponense, thereby solving the problems of yield and germplasm caused by rapid sexual maturity. Therefore, we analyzed the gonadal transcriptome of M. nipponense and screened for a significantly expressed gene, Mn-XRN1, in the RNA degradation and ribosomal pathways.
XRN1 is an important and conserved ribonuclease that degrades RNA in the 5′-3′ direction in the cytoplasm [6]. It is well-known that eukaryotic messenger RNA (mRNA) has two complete stability determinants, 5′7-methylguanosine cap and 3′ poly(A)tail, that protect transcripts from exonucleases and enhance translational initiation. Therefore, in order for degradation to begin, either of these two structures must be destroyed, or the mRNA must undergo internal cleavage by intranuclear dissolution attack [7]. This coincides with the three pathways by which XRN1 degrades mRNA in eukaryotes (Figure 1). (1) Deenylation-dependent degradation occurs. The mRNA degradation process involves several steps. First, the mRNA is dealkenylated by the CCR4–CAF1–NOT1 complex or PARN enzyme to eliminate most of the 3′poly(A) [8,9]. Then, the 5′ cap is hydrolyzed by a cap-removing complex containing DCP2, and, finally, the mRNA is degraded by XRN1 in the 5′–3′ direction [7,10,11,12,13]. (2) Independent of deenylated degradation, such as nonsense-mediated decline (NMD), occurs. NMD targets and certain long noncoding RNAs can bypass deenylation, directly remove the 5′ cap, and then be degraded by XRN1 in the 5′–3′ direction [14,15,16]. (3) Nuclear cracking-dependent degradation also occurs. The mRNA is lysed internally, producing unprotected 5′ and 3′ fragments. The 3′ fragments are degraded by XRN1 [17,18,19]. In addition, XRN1 is involved in various aspects of RNA metabolism, such as RNA silencing, rRNA maturation, and transcription termination [11,20].
XRN1 has been well studied in terms of degradation mechanisms. However, the reproduction-related functions of XRN1 have been poorly studied. In yeast, mutations in XRN1 lead to larger cells, increased doubling time, and defective spore production [21,22]. Knocking down the XRN1 gene in Caenorhabditis elegans results in a failure of abdominal closure, eventually leading to death of the embryo in the twofold stage of development [23]. Pacman is the homologue of XRN1 in Drosophila. Mutations of Pacman in Drosophila can lead to a variety of developmental phenotypic defects, including decreased fertility, dull wings, and bristle defects [24,25]. Saccharomyces cerevisiae cells lacking Xrn1p exhibit increased chromosome loss, nucleosome defects, and impaired spindle isolation in cellular processes associated with microtubule function [26]. Furthermore, XRN1 may be essential for proper bone formation in humans. Mutations in XRN1 can lead to osteosarcoma, which is produced by mesenchymal-derived cells that are unable to differentiate correctly to produce an unmineralized portion of the bone matrix called osteoids [27,28].
The present study focused on female M. nipponense, to determine the potential function of Mn-XRN1 in the reproduction of M. nipponense, and to identify the regulatory relationship with other genes. We used real-time fluorescence quantitative PCR to analyze the expression of Mn-XRN1 in different tissues, different developmental stages, and different ovarian reproduction stages of M. nipponense. In situ hybridization (ISH) was used to determine the location of the Mn-XRN1 gene. The expression of the Mn-XRN1 gene was knocked-down using RNA interference (RNAi) technology. Following RNAi, we counted the number of each ovarian stage in M. nipponense to observe the effect on ovarian development after Mn-XRN1 knockdown.

2. Materials and Methods

2.1. Animals

Healthy female M. nipponense of consistent weight required for the present study were obtained from the Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences (120°13′44″ E, 31°28′22″ N). They were cultured in tanks with circulating water and fed with snail meat twice per day.

2.2. Bioinformatics Analysis

The cDNA fragment of the target gene Mn-XRN1 was obtained from the M. nipponense transcriptome cDNA library in our laboratory. The ORF Finder (https://www.ncbi.nlm.nih.gov/orffinder/ (accessed on 20 June 2022)) was used to predict the Mn-XRN1 open reading frame and the BLAST tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi#alnHdr_317467911 (accessed on 23 June 2022)) was used for comparison to analyze sequence. Based on the known cDNA fragment, we used the Primer-BLAST (https://www.ncbi.nlm.nih.gov/tools/primer-blast/ (accessed on 12 July 2022)) to design the specific primers which were used to verify Mn-XRN1. The specific primers are listed in Table 1 and were sent to the Shanghai Exsyn-bio Technology Company for sequencing. The phylogenetic tree was constructed based on amino acid sequence using MEGA5.1 software and the online website iTOL (https://itol.embl.de/ (accessed on 15 August 2022). Multiple sequence alignment of Mn-XRN1 amino acids was performed by DNAMAN 6.0 software. The three-dimensional protein structure of Mn-XRN1 was constructed by the online website (https://swissmodel.expasy.org/ (accessed on 17 August 2022). The online program Expasy (https://web.expasy.org/protparam/ (accessed on 20 August 2022)) was used to calculate the protein molecular weight and isoelectric point. The conserved domain of the protein was analyzed by InterpPro (https://www.ebi.ac.uk/interpro/ (accessed on 25 August 2022)).

2.3. RNA Extraction and cDNA Synthesis

An RNAiso Plus kit (Takara, Otsu City, Shiga Prefecture, Japan) was used to extract RNA from the whole tissues of the prawns. An electrophoresis apparatus (Bio-Rad, Hercules, CA, USA) was used to detect the quality of the RNA. Reverse transcriptase M-MLV kits (Takara) were used to synthesize the first strand of cDNA.

2.4. The qPCR Analysis

The Bio-Rad iCycler iQ5 Real-Time PCR System (Bio-Rad, Hercules, CA, USA) was used to detect the expression levels of genes in different tissues. The reaction system and procedures are referred to in a previous study [29]. All primers used for qRT-PCR are listed in Table 1. The 2−△△Ct method was used to calculate the expression level of all genes required for this study. EIF (eukaryotic translation initiation factor 5A) was used as the reference gene [30].

2.5. In Situ Hybridization (ISH)

M. nipponense ovarian tissues at five different stages of reproduction were collected. Probes were designed according to known sequences. Three ISH experiments were performed on each tissue to analyze the mRNA locations of Mn-XRN1. The detailed steps are described in previous studies [5,29].

2.6. RNA Interference (RNAi)

The potential function of Mn-XRN1 was explored using RNAi. The specific RNAi primers, which are shown in Table 1, were designed by the snap Dragon programs (https://www.flyrnai.org/snapdragon (accessed on 5 September 2022)). The Transcript AidTM T7 High Yield Transcription kit (Fermentas, Inc., Waltham, USA) was used to synthesize the Mn-XRN1 dsRNA. The Mn-XRN1 dsRNA was injected into the pericardial cavity. Each prawn was injected with 12 μg/g Mn-XRN1 dsRNA [31]. On the 5th and 10th day after injection, supplementary injection was performed to maintain the interfering effect [31]. A total of 300 female prawns in the second period (O2 period) of ovarian development were carefully selected and divided into six groups. These groups were divided into three experimental groups and three control groups. The GFP dsRNA was injected into control groups.

3. Results

3.1. Sequence Analysis of Mn-XNR1

The full-length cDNA sequence of Mn-XRN1 was 12,128 base pairs (bp) long. Its ORF was 4872 bp long and encoded 1623 amino acids. The lengths of the 5′ untranslated region (UTR) and the 3′−UTR were 125 bp and 7131 bp, respectively. The molecular weight and theoretical isoelectric point of the protein were 185.60176 kDa and 6.33, respectively. According to the prediction results, Mn-XRN1 had two highly conserved regions: CR1 and CR2. The residue orders were 1−354 and 425−594, respectively. Following the CR2 domain, this domain was called D. The D domain was divided into D1, D2, D3, and D4. The residue sequences corresponding to D1 domain and D3 domain were 652−837 and 901−1030, respectively. The D2 domain contained two residue fragments, 837−882 and 1054−1070. Finally, D4 domain included three residue fragments, 883−900, 1031−1053, and 1071−1158 (Figure 2).
The results of amino acid sequence comparison between M. nipponense and other crustaceans showed that M. nipponense had 55.30%, 54.67%, 55.11%, and 53.85% homology with P. monodon, F. chinensis, L. vannamei, and P. trituberculatus, respectively (Figure 3).
The phylogenetic tree was divided into two main branches. One was an insect, the other was a crustacean, and there was a separate mollusk. M. nipponense was one of the crustacean clades (Figure 4).
The three-dimensional protein structure of Mn-XRN1 compared with the three-dimensional structure of L. vannamei, P. monodon, and F. chinensis is shown in Figure 5. The results showed that M. nipponense and other species shared the same CR1 and CR2 domains. The three-dimensional spatial structure of proteins had high similarity. The CR1 and CR2 domains were connected by a CR1–CR2 linker structure.

3.2. Spatial–Temporal Expression Analysis of Mn-XRN1

At the organizational level, we analyzed the expression of Mn-XRN1 in different tissues of M. nipponense (Figure 6A). The highest expression of Mn-XRN1 occurred in the ovaries, followed by the heart. Mn-XRN1 was least expressed in muscle. The expression of Mn-XRN1 in the ovaries and muscles differed by 18-fold (p < 0.05).
Next, the expression modes of Mn-XRN1 at different embryonic and metamorphic developmental stages were examined. The embryonic period starts from early oogenesis to the pre-hatch stage. During embryonic development, maximum expression of Mn-XRN1 in the CS stage was observed (Figure 6B). Mn-XRN1 mRNA levels then decreased significantly after the CS stage and remained at a low level (p < 0.05).
The metamorphic developmental period begins at the L1 stage and ends at the PL25 stage. The expression of Mn-XRN1 showed a downward trend from L1 to L10 stages (Figure 6C). At the L15 stage, the expression increased suddenly and significantly. In PL10 to PL25 stages, the expression of Mn-XRN1 was higher than that of the larval development stages and reached a maximum in the PL10 stage (p < 0.05).
The mRNA expression level of Mn-XRN1 in the ovary showed a trend of first increasing and then decreasing, and reached a maximum in O2 stage (Figure 6D). The mRNA expression of Mn-XRN1 in the O1, O3, and O4 stages was not much different, but it decreased significantly in the O5 stage (p < 0.05).

3.3. Localization of Mn-XRN1 in the Ovaries

In situ hybridization was used to detect the location of Mn-XRN1 mRNA in different stages of the ovary (Figure 7). The ISH results showed that the signal of Mn-XRN1 was stronger in the yolk granules and follicular cells. More signals were gathered in the nucleus in the O2 period. Mn-XRN1 signals were also detected in the cytoplasmic membrane and nucleus of oocytes.

3.4. Effects of Mn-XRN1 Gene Silencing after RNAi on Ovarian Reproduction

Based on the previous expression pattern of the Mn-XRN1 gene in different tissues, we used RNAi to determine the function of the Mn-XRN1 gene. On the 1st, 5th, and 13th days after injection, the interference efficiency reached 20.24%, 53.51%, and 48.11%, respectively (Figure 8A). After RNAi, the proportion of ovarian maturity after the O2 phase was greater than that of the control group at the same periods (Figure 8B). The interference efficiency results were consistent with the observation of ovarian maturation. There were significant differences between the experimental and control groups.
After RNAi silenced Mn-XRN1, we found a significant increase in the expression of Mn-VASA, a member of the Dead Box family, in the ribosomal pathway. Compared with the control group, the differences in Mn-VASA gene expression on days 1, 5, and 13 in the experimental group were 62.78%, 214.99%, and 754.37%, respectively (Figure 8C). The expression of Mn-VASA in the control group gradually decreased with the reproduction of the ovaries.

4. Discussion

XRN1 has a single active site with a narrow inlet that removes secondary structures as the RNA crosses the gap [32]. The 5′ orientation of XRN1 has a series of conservative domains: CR1, CR2, and D. The D Domain can be divided into D1, D2, D3, and D4 [32,33]. These conserved domains have been found in XRN1 of yeast, C. elegans, mice, and other creatures, and have high homology. They play an important role in XRN1’s correct degradation of various RNA substrates [34]. Domain CR1 contains seven strictly conserved acidic residues that coordinate metal ions for catalysis; domain CR2 restricts access to the active site, ensuring that XRN1 is the only exoribonuclease; domain D1 is essential for XRN1 nuclease activity and may play an active role in determining or stabilizing the conformation of the N-terminal fragment. This may be a key factor in XRN1 catalysis; domains D2–D4 may have an impact in ensuring the correct conformation of domain D1, thereby indirectly enhancing the stability of the N-terminal fragment conformation [32]. In the present research, we obtained and verified the sequence of Mn-XRN1 from M. nipponense for the first time, and compared the amino acid sequence with other species. The phylogenetic tree and amino acid sequence alignment results showed that M. nipponense had high homology with crustaceans and was more conserved than other crustaceans. This dovetails with the trend revealed by our previous findings. Compared to other crustaceans, M. nipponense appeared earlier in evolution and had a more conserved genome [35].
We used qRT-PCR to analyze the expression of Mn-XRN1 in M. nipponense. At the tissue level, Mn-XRN1 was significantly expressed in the ovaries. This result showed that Mn-XRN1 might play a key role in the regulation of ovarian reproduction. During the embryonic stage, highly expressed genes directly participate in embryonic development or prepare for future physiology [36]. The expression of Mn-XRN1 peaked at the cleavage stage of embryonic development. This suggested that Mn-XRN1 might be involved in the process of oocyte mitosis. L1 is the first day after hatching, and L15 is the critical day of metamorphosis before the post-larval developmental stages of M. nipponense [37,38]. The relatively high expression of L1 and L15 meant that Mn-XRN1 was associated with post-membrane development and metamorphosis. The post-larval developmental periods have been shown to be a critical period for gonad differentiation and development in M. nipponense. According to histological observations, M. nipponense began to develop gonadal primordium at PL10. After PL10, the gonads began to differentiate and develop [39]. The mRNA expression level of Mn-XRN1 in the PL10–PL20 stage was higher than that in the previous stage and reached a maximum in the PL10 stage, indicating that Mn-XRN1 might be involved in activating and promoting the gonadal differentiation and development in M. nipponense.
Ovarian reproduction in M. nipponense can be divided into five stages: O1, undeveloped stage; O2, developmental stage; O3, near mature stage; O4, mature stage; and O5, declining stage [3]. The mRNA expression of Mn-XRN1 reaches the maximum at O2 stage. These results indicated that Mn-XRN1 may be associated with yolk deposition. In Drosophila, Pacman is also involved in eggogenesis of female nurse cells and within the yolk [40]. On the other hand, the follicular cavity derived from follicular cells is formed in O2 stage [5]. One plausible explanation is that Mn-XRN1 may be involved in activating ovarian development, especially follicle production. ISH results showed detection of Mn-XRN1 signaling in oocytes and follicles of O1, O2, and O5 stages. The ISH result provided a new basis for the viewpoint that Mn-XRN1 may be involved in ovarian maturation and follicle formation in M. nipponense.
RNAi is a technology that inhibits gene expression by using short double-stranded RNA molecules, and is widely used in gene function research in M. nipponense [41,42,43,44,45]. We used RNAi technology to further explore the functionality of Mn-XRN1. On the 1st, 5th, and 13th days after RNAi with Mn-XRN1, the expression of Mn-XRN1 in the ovary of the experimental group decreased significantly compared with the control group. This indicated that Mn-XRN1 dsRNA can effectively inhibit the expression of Mn-XRN1 in this study. Initially, the ovary of M. nipponense in the experimental group and the control group was in the O2 stage. On the 5th, 10th, and 13th days after dsRNA injection, the proportion of ovaries developing to the stage after O2 was greater than that of the control group. The results showed that, after Mn-XRN1 silencing, the ovarian reproduction of M. nipponense was significantly accelerated. Therefore, Mn-XRN1 had an inhibitory effect on ovarian reproduction. In the search for regulatory relationships with other related genes, we found that the gene Mn-VASA was significantly regulated by Mn-XRN1 in the ribosome genesis pathway. After silencing of the Mn-XRN1 gene, the expression of Mn-VASA gene increased significantly, indicating that Mn-VASA was regulated by negative feedback from Mn-XRN1. VASA is thought to be involved in the assembly and transport of vitellin mRNA in follicular cells during secondary yolk genesis [46]. Based on the existing research results, we propose that in M. nipponense, Mn-XRN1 inhibits the production of vitellinogen by inhibiting the expression of the gene Mn-VASA, which is responsible for the production and transport of vitellinogen, thereby controlling development of the ovaries.

5. Conclusions

In summary, we identified the 5′−3′ direction ribonuclease exonuclease gene Mn-XRN1 in M. nipponense. The results of this study indicated that Mn-XRN1 was associated with early physical changes in M. nipponense, such as post-membrane development and metamorphosis. It may also play an important role in gonadal differentiation. In terms of ovarian reproduction, we found that Mn-XRN1 was associated with yolk deposition and follicle production. Further RNAi results showed that Mn-XRN1 inhibited ovarian development. More importantly, we found that the gene Mn-VASA was strongly inhibited by Mn-XRN1. Mn-VASA was associated with the synthesis of vitellinogen. Finally, we proposed a viewpoint that Mn-XRN1 might inhibit the production of vitellinogen by inhibiting the expression of Mn-VASA, thereby controlling ovarian maturation. This study enriched the understanding of molecular mechanism of female sexual maturation during the breeding period of M. nipponense and provided new insights for studying sexual maturity in crustaceans.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/genes14071454/s1.

Author Contributions

Conceptualization, H.F., T.C. and S.J. (Shubo Jin); methodology, T.C.; resources, S.J. (Sufei Jiang) and Y.X.; data curation, H.Y., H.Q. and W.Z.; writing—original draft preparation, T.C.; writing—review and editing, H.F., T.C. and S.J. (Shubo Jin); visualization, T.C. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by grants from Central Public-Interest Scientific Institution Basal Research Fund (NO.2023JBFM04, 2020TD36); Seed Industry Revitalization Project of Jiangsu Province (JBGS (2021) 118); Jiangsu Agricultural Industry Technology System; the earmarked fund for CARS-48; the New cultivar breeding Major Project of Jiangsu province (PZCZ201745); the Natural Science Foundation of Jiangsu Province (BK20221207). Thanks for the Jiangsu Province Platform for the Conservation and Utilization of Agricultural Germplasm.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data are available in the manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Jin, S.; Zhang, W.; Xiong, Y.; Fu, H. Recent progress of male sexual differentiation and development in the oriental river prawn (Macrobrachium nipponense): A review. Rev. Aquac. 2023, 15, 305–317. [Google Scholar] [CrossRef]
  2. Jin, S.; Hu, Y.; Fu, H.; Sun, S.; Jiang, S.; Xiong, Y.; Qiao, H.; Zhang, W.; Gong, Y.; Wu, Y. Analysis of testis metabolome and transcriptome from the oriental river prawn (Macrobrachium nipponense) in response to different temperatures and illumination times. Comp. Biochem. Physiol. Part D Genom. Proteom. 2020, 34, 100662. [Google Scholar] [CrossRef] [PubMed]
  3. Qiao, H.; Fu, H.; Xiong, Y.; Jiang, S.; Zhang, W.; Sun, S.; Jin, S.; Gong, Y.; Wang, Y.; Shan, D.; et al. Molecular insights into reproduction regulation of female Oriental River prawns Macrobrachium nipponense through comparative transcriptomic analysis. Sci. Rep. 2017, 7, 12161. [Google Scholar] [CrossRef]
  4. Li, X.; Yang, H.; Gao, X.; Zhang, H.; Chen, N.; Miao, Z.; Liu, X.; Zhang, X. The pathogenicity characterization of non-O1 Vibrio cholerae and its activation on immune system in freshwater shrimp Macrobrachium nipponense. Fish Shellfish. Immunol. 2019, 87, 507–514. [Google Scholar] [CrossRef] [PubMed]
  5. Li, F.; Qiao, H.; Fu, H.; Sun, S.; Zhang, W.; Jin, S.; Jiang, S.; Gong, Y.; Xiong, Y.; Wu, Y.; et al. Identification and characterization of opsin gene and its role in ovarian maturation in the oriental river prawn Macrobrachium nipponense. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2018, 218, 1–12. [Google Scholar] [CrossRef]
  6. Stevens, A. 5′-Exoribonuclease 1: Xrn1. In Methods in Enzymology; Elsevier: Amsterdam, The Netherlands, 2001; Volume 342, pp. 251–259. [Google Scholar]
  7. Grishok, A.; Pasquinelli, A.E.; Conte, D.; Li, N.; Parrish, S.; Ha, I.; Baillie, D.L.; Fire, A.; Ruvkun, G.; Mello, C.C. Genes and mechanisms related to RNA interference regulate expression of the small temporal RNAs that control C. elegans developmental timing. Cell 2001, 106, 23–34. [Google Scholar] [CrossRef]
  8. Chang, J.H.; Xiang, S.; Xiang, K.; Manley, J.L.; Tong, L. Structural and biochemical studies of the 5′→ 3′ exoribonuclease Xrn1. Nat. Struct. Mol. Biol. 2011, 18, 270–276. [Google Scholar] [CrossRef]
  9. Coller, J.; Parker, R. Eukaryotic mRNA decapping. Annu. Rev. Biochem. 2004, 73, 861–890. [Google Scholar] [CrossRef]
  10. Jones, C.I. Post-Transcriptional Gene Regulation by the Exoribonuclease Pacman. Ph.D. Thesis, University of Brighton, Brighton, UK, 2011. [Google Scholar]
  11. Li, Y.; Kiledjian, M. Regulation of mRNA decapping. Wiley Interdiscip. Rev. RNA 2010, 1, 253–265. [Google Scholar] [CrossRef]
  12. Valencia-Sanchez, M.A.; Liu, J.; Hannon, G.J.; Parker, R. Control of translation and mRNA degradation by miRNAs and siRNAs. Genes Dev. 2006, 20, 515–524. [Google Scholar] [CrossRef]
  13. Orban, T.I.; Izaurralde, E. Decay of mRNAs targeted by RISC requires XRN1, the Ski complex, and the exosome. RNA 2005, 11, 459–469. [Google Scholar] [CrossRef] [PubMed]
  14. Muhlrad, D.; Parker, R. The yeast EDC1 mRNA undergoes deadenylation-independent decapping stimulated by Not2p, Not4p, and Not5p. EMBO J. 2005, 24, 1033–1045. [Google Scholar] [CrossRef] [PubMed]
  15. Parker, R.; Song, H. The enzymes and control of eukaryotic mRNA turnover. Nat. Struct. Mol. Biol. 2004, 11, 121–127. [Google Scholar] [CrossRef] [PubMed]
  16. Goldstrohm, A.C.; Wickens, M. Multifunctional deadenylase complexes diversify mRNA control. Nat. Rev. Mol. Cell Biol. 2008, 9, 337–344. [Google Scholar] [CrossRef]
  17. Souret, F.F.; Kastenmayer, J.P.; Green, P.J. AtXRN4 degrades mRNA in Arabidopsis and its substrates include selected miRNA targets. Mol. Cell 2004, 15, 173–183. [Google Scholar] [CrossRef]
  18. Newbury, S. Control of mRNA stability in eukaryotes. Biochem. Soc. Trans. 2006, 34, 30–34. [Google Scholar] [CrossRef]
  19. Zhang, Z.; Simons, A.M.; Prabhu, V.P.; Chen, J. Strand exchange protein 1 (Sep1) from Saccharomyces cerevisiae does not promote branch migration in vitro. J. Biol. Chem. 1998, 273, 4950–4956. [Google Scholar] [CrossRef]
  20. Grima, D.P.; Sullivan, M.; Zabolotskaya, M.V.; Browne, C.; Seago, J.; Wan, K.C.; Okada, Y.; Newbury, S.F. The 5′–3′ exoribonuclease pacman is required for epithelial sheet sealing in Drosophila and genetically interacts with the phosphatase puckered. Biol. Cell 2008, 100, 687–701. [Google Scholar] [CrossRef]
  21. Muhlrad, D.; Decker, C.J.; Parker, R. Deadenylation of the unstable mRNA encoded by the yeast MFA2 gene leads to decapping followed by 5′→ 3′digestion of the transcript. Genes Dev. 1994, 8, 855–866. [Google Scholar] [CrossRef]
  22. Bashirullah, A.; Cooperstock, R.L.; Lipshitz, H.D. Spatial and temporal control of RNA stability. Proc. Natl. Acad. Sci. USA 2001, 98, 7025–7028. [Google Scholar] [CrossRef]
  23. Decker, C.J.; Parker, R. Mechanisms of mRNA degradation in eukaryotes. Trends Biochem. Sci. 1994, 19, 336–340. [Google Scholar] [CrossRef] [PubMed]
  24. Lin, M.-D.; Jiao, X.; Grima, D.; Newbury, S.F.; Kiledjian, M.; Chou, T.-B. Drosophila processing bodies in oogenesis. Dev. Biol. 2008, 322, 276–288. [Google Scholar] [CrossRef] [PubMed]
  25. Zabolotskaya, M.V.; Grima, D.P.; Lin, M.-D.; Chou, T.-B.; Newbury, S.F. The 5′–3′ exoribonuclease Pacman is required for normal male fertility and is dynamically localized in cytoplasmic particles in Drosophila testis cells. Biochem. J. 2008, 416, 327–335. [Google Scholar] [CrossRef]
  26. Solinger, J.A.; Pascolini, D.; Heyer, W.-D. Active-site mutations in the Xrn1p exoribonuclease of Saccharomyces cerevisiae reveal a specific role in meiosis. Mol. Cell. Biol. 1999, 19, 5930–5942. [Google Scholar] [CrossRef] [PubMed]
  27. Laurence, N.; Epelman, M.; Markowitz, R.I.; Jaimes, C.; Jaramillo, D.; Chauvin, N.A. Osteoid osteomas: A pain in the night diagnosis. Pediatr. Radiol. 2012, 42, 1490–1501. [Google Scholar] [CrossRef]
  28. Zhang, K.; Dion, N.; Fuchs, B.; Damron, T.; Gitelis, S.; Irwin, R.; O’Connor, M.; Schwartz, H.; Scully, S.P.; Rock, M.G.; et al. The human homolog of yeast SEP1 is a novel candidate tumor suppressor gene in osteogenic sarcoma. Gene 2002, 298, 121–127. [Google Scholar] [CrossRef]
  29. Jin, S.; Fu, H.; Jiang, S.; Xiong, Y.; Sun, S.; Qiao, H.; Zhang, W.; Gong, Y.; Wu, Y. Molecular cloning, expression, and in situ hybridization analysis of forkhead box protein L2 during development in Macrobrachium nipponense. J. World Aquac. Soc. 2018, 49, 429–440. [Google Scholar] [CrossRef]
  30. Hu, Y.; Fu, H.; Qiao, H.; Sun, S.; Zhang, W.; Jin, S.; Jiang, S.; Gong, Y.; Xiong, Y.; Wu, Y. Validation and evaluation of reference genes for quantitative real-time PCR in Macrobrachium Nipponense. Int. J. Mol. Sci. 2018, 19, 2258. [Google Scholar] [CrossRef]
  31. Jiang, F.; Fu, H.; Qiao, H.; Zhang, W.; Jiang, S.; Xiong, Y.; Sun, S.; Gong, Y.; Jin, S. The RNA interference regularity of transformer-2 gene of oriental river prawn Macrobrachium nipponense. Chin. Agric. Sci. Bull. 2014, 30, 32–37. [Google Scholar]
  32. Nagarajan, V.K.; Jones, C.I.; Newbury, S.F.; Green, P.J. XRN 5′-3′ exoribonucleases: Structure, mechanisms and functions. Biochim. Biophys. Acta 2013, 1829, 590–603. [Google Scholar] [CrossRef]
  33. Chang, J.H.; Xiang, S.; Tong, L. Structures of 5′–3′ exoribonucleases. In The Enzymes; Elsevier: Amsterdam, The Netherlands, 2012; Volume 31, pp. 115–129. [Google Scholar]
  34. Geisler, S.; Coller, J. XRN1: A major 5′ to 3′ exoribonuclease in eukaryotic cells. Enzymes 2012, 31, 97–114. [Google Scholar] [PubMed]
  35. Jin, S.; Bian, C.; Jiang, S.; Han, K.; Xiong, Y.; Zhang, W.; Shi, C.; Qiao, H.; Gao, Z.; Li, R.; et al. A chromosome-level genome assembly of the oriental river prawn, Macrobrachium nipponense. GigaScience 2021, 10, giaa160. [Google Scholar] [CrossRef] [PubMed]
  36. Zhang, X.; Kang, X.; Wu, H.; Silver, K.; Zhang, J.; Ma, E.; Zhu, K.Y. Transcriptome-wide survey, gene expression profiling and exogenous chemical-induced transcriptional responses of cytochrome P450 superfamily genes in migratory locust (Locusta migratoria). Insect Biochem. Mol. Biol. 2018, 100, 66–77. [Google Scholar] [CrossRef]
  37. Zhang, Y.; Fu, H.; Qiao, H.; Jin, S.; Jiang, S.; Xiong, Y.; Gong, Y.; Zhang, X. Molecular cloning and expression analysis of transformer-2 gene during development in Macrobrachium nipponense (de Haan 1849). J. World Aquac. Soc. 2013, 44, 338–349. [Google Scholar] [CrossRef]
  38. Zhang, Y.; Qiao, H.; Zhang, W.; Sun, S.; Jiang, S.; Gong, Y.; Xiong, Y.; Jin, S.; Fu, H. Molecular cloning and expression analysis of two sex-lethal homolog genes during development in the oriental river prawn, Macrobrachium nipponense. Genet. Mol. Res. 2013, 12, 4698–4711. [Google Scholar] [CrossRef] [PubMed]
  39. Jin, S.; Zhang, W.; Xiong, Y.; Jiang, S.; Qiao, H.; Gong, Y.; Wu, Y.; Fu, H. Identification of Important Genes Involved in the Sex-Differentiation Mechanism of Oriental River Prawn, Macrobrachium nipponense, During the Gonad Differentiation and Development Period. Front. Genet. 2022, 13, 797796. [Google Scholar] [CrossRef]
  40. Jones, C.I.; Zabolotskaya, M.V.; Newbury, S.F. The 5′→ 3′ exoribonuclease XRN1/Pacman and its functions in cellular processes and development. Wiley Interdiscip. Rev. RNA 2012, 3, 455–468. [Google Scholar] [CrossRef]
  41. Kusaba, M. RNA interference in crop plants. Curr. Opin. Biotechnol. 2004, 15, 139–143. [Google Scholar] [CrossRef]
  42. Jones, H.D. Wheat transformation: Current technology and applications to grain development and composition. J. Cereal Sci. 2005, 41, 137–147. [Google Scholar] [CrossRef]
  43. Smith, C.A.; Roeszler, K.N.; Ohnesorg, T.; Cummins, D.M.; Farlie, P.G.; Doran, T.J.; Sinclair, A.H. The avian Z-linked gene DMRT1 is required for male sex determination in the chicken. Nature 2009, 461, 267–271. [Google Scholar] [CrossRef]
  44. Li, F.; Bai, H.; Xiong, Y.; Fu, H.; Jiang, S.; Jiang, F.; Jin, S.; Sun, S.; Qiao, H.; Zhgang, W. Molecular characterization of insulin-like androgenic gland hormone-binding protein gene from the oriental river prawn Macrobrachium nipponense and investigation of its transcriptional relationship with the insulin-like androgenic gland hormone gene. Gen. Comp. Endocrinol. 2015, 216, 152–160. [Google Scholar] [CrossRef] [PubMed]
  45. Tautz, D.; Pfeifle, C. A non-radioactive in situ hybridization method for the localization of specific RNAs in Drosophila embryos reveals translational control of the segmentation gene hunchback. Chromosoma 1989, 98, 81–85. [Google Scholar] [CrossRef] [PubMed]
  46. Qiu, G.-F.; Chen, Y.; Cui, Z.; Zhu, X.-L. Localization of germline marker vasa homolog RNA to a single blastomere at early cleavage stages in the oriental river prawn Macrobrachium nipponense: Evidence for germ cell specification by preformation. Gene 2013, 513, 53–62. [Google Scholar] [CrossRef] [PubMed]
Figure 1. The degradation mechanism of XRN1 in eukaryotes.
Figure 1. The degradation mechanism of XRN1 in eukaryotes.
Genes 14 01454 g001
Figure 2. The nucleotide and speculated amino acid sequences of the Mn-XRN1 gene in M. nipponense. The conserved domain CR1 is marked in blue and the conserved domain CR2 is marked in red. Domain D1 is marked with a thick black underline. Domain D2 is framed with a border. Domain D3 is marked with a dashed line. The orange area is domain D4. The starting codon ATG is marked with a blue underline. The stop codon TAG is in bold and marked with a sliding line, and the stop codon TAG in the amino acid sequence is indicated by an asterisk (*) (Supplementary Materials).
Figure 2. The nucleotide and speculated amino acid sequences of the Mn-XRN1 gene in M. nipponense. The conserved domain CR1 is marked in blue and the conserved domain CR2 is marked in red. Domain D1 is marked with a thick black underline. Domain D2 is framed with a border. Domain D3 is marked with a dashed line. The orange area is domain D4. The starting codon ATG is marked with a blue underline. The stop codon TAG is in bold and marked with a sliding line, and the stop codon TAG in the amino acid sequence is indicated by an asterisk (*) (Supplementary Materials).
Genes 14 01454 g002
Figure 3. The Mn-XRN1 predicted amino acid sequence versus the sequence of other species. The predicted amino acid sequence of Mn-XRN1 in M. nipponense (OQ973288) was compared with XRN1 from P. monodon (XP_037803351.1), F. chinensis (XP_047471890.1), L. vannamei (XP_027206575.1), and P. trituberculatus (XP_045106121.1) by the DNAMAN program. CR1 domain, CR2 domain, D1 domain, D2 domain, D3 domain, and D4 domain are marked with orange underline, black underline, green underline, an orange box, a green box, and black dashed lines, respectively.
Figure 3. The Mn-XRN1 predicted amino acid sequence versus the sequence of other species. The predicted amino acid sequence of Mn-XRN1 in M. nipponense (OQ973288) was compared with XRN1 from P. monodon (XP_037803351.1), F. chinensis (XP_047471890.1), L. vannamei (XP_027206575.1), and P. trituberculatus (XP_045106121.1) by the DNAMAN program. CR1 domain, CR2 domain, D1 domain, D2 domain, D3 domain, and D4 domain are marked with orange underline, black underline, green underline, an orange box, a green box, and black dashed lines, respectively.
Genes 14 01454 g003
Figure 4. A phylogenetic tree of XRN1 amino acid sequences. GenBank accession numbers are shown in different colors covering the area. Mn-XRN1 is marked with a red arrow.
Figure 4. A phylogenetic tree of XRN1 amino acid sequences. GenBank accession numbers are shown in different colors covering the area. Mn-XRN1 is marked with a red arrow.
Genes 14 01454 g004
Figure 5. The 3D-structures of Mn-XRN1 and XRN1 predicted by SWISS-MODEL. (A) displays the 3D-structure of the gene Mn-XRN1 of M. nipponense. (BD) display the 3D-structures of the gene XRN1 in P. monodon, F. chinensis, and L. vannamei, respectively. The CR1 and CR2 domains are marked with red ellipses. The CR1–CR2 linker is marked with a red arrow.
Figure 5. The 3D-structures of Mn-XRN1 and XRN1 predicted by SWISS-MODEL. (A) displays the 3D-structure of the gene Mn-XRN1 of M. nipponense. (BD) display the 3D-structures of the gene XRN1 in P. monodon, F. chinensis, and L. vannamei, respectively. The CR1 and CR2 domains are marked with red ellipses. The CR1–CR2 linker is marked with a red arrow.
Genes 14 01454 g005
Figure 6. The mRNA expression level of Mn-XRN1 in the different tissue of M. nipponense (A). E: eyes, Br: brain, H: heart, He: hepatopancreas, G: gills, M: muscles, O: ovary. The mRNA expression level of Mn-XRN1 in the different periods of embryos (B). CS: cleavage stage, BS: blastula stage, GS: gastrula stage, NS: nauplius stage, ZS: zoea stage. Expression modes of Mn-XRN1 at different stages of ontogeny (C). L1: the 1st-day after hatching, PL1: the 1st-day after larvae, and so on. The mRNA expression level of Mn-XRN1 in the different reproduction periods of the ovaries (D). O1: undeveloped period, O2: developing period, O3: nearly ripe period, O4: ripe period, O5: spent period. Statistical analysis was carried out using the one-way ANOVA method. Data are shown as mean ± SEM(n = 6). Bars marked with different letters represent significant differences in data (p < 0.05).
Figure 6. The mRNA expression level of Mn-XRN1 in the different tissue of M. nipponense (A). E: eyes, Br: brain, H: heart, He: hepatopancreas, G: gills, M: muscles, O: ovary. The mRNA expression level of Mn-XRN1 in the different periods of embryos (B). CS: cleavage stage, BS: blastula stage, GS: gastrula stage, NS: nauplius stage, ZS: zoea stage. Expression modes of Mn-XRN1 at different stages of ontogeny (C). L1: the 1st-day after hatching, PL1: the 1st-day after larvae, and so on. The mRNA expression level of Mn-XRN1 in the different reproduction periods of the ovaries (D). O1: undeveloped period, O2: developing period, O3: nearly ripe period, O4: ripe period, O5: spent period. Statistical analysis was carried out using the one-way ANOVA method. Data are shown as mean ± SEM(n = 6). Bars marked with different letters represent significant differences in data (p < 0.05).
Genes 14 01454 g006
Figure 7. Histological section of various ovary periods in M. nipponense. OC: oocyte; N: nucleus; CM: cytoplasmic membrane; Y: yolk granule; scale bars: ×400.
Figure 7. Histological section of various ovary periods in M. nipponense. OC: oocyte; N: nucleus; CM: cytoplasmic membrane; Y: yolk granule; scale bars: ×400.
Genes 14 01454 g007
Figure 8. The mRNA expression levels of Mn-XRN1 and Mn-VASA after RNAi. (A) Mn-XRN1; (B) Mn-VASA. Data are shown as mean ± SEM. The significance was tested with Student’s t-test (n = 6) and differences were considered significant when p < 0.05 (*). On different days after injection, a proportion of ovaries developed more than the second stage of M. nipponense (C).
Figure 8. The mRNA expression levels of Mn-XRN1 and Mn-VASA after RNAi. (A) Mn-XRN1; (B) Mn-VASA. Data are shown as mean ± SEM. The significance was tested with Student’s t-test (n = 6) and differences were considered significant when p < 0.05 (*). On different days after injection, a proportion of ovaries developed more than the second stage of M. nipponense (C).
Genes 14 01454 g008
Table 1. Primers designed in this study.
Table 1. Primers designed in this study.
Primer NameLength (bp)Primer Sequence (5′–3′) Forward/ReverseUsage
Mn-XRN1-V11017AAGGAGGCTGTAGATGCTGAAAA
AATACTCTCTCTTATGCTGGCGG
For Mn-XRN1 verify
Mn-XRN1-V2624GTATCCGTGTCTGAGCGAGGTC
AAGTGAGGTTCGTGGGAGGTC
For Mn-XRN1 verify
Mn-XRN1-V3640ATCGGGGAGAAGTCTTACCTACAG
CCACTGTTCAAATAGCCCCCT
For Mn-XRN1 verify
Mn-XRN1-V4620ATATAATTGACGACTGGGTGCTC
TGACCACGAACATATCCCG
For Mn-XRN1 verify
Mn-XRN1-V5659AAGAGTTCCGCCAGCATAAGAGA
GCACAACCCCTTCAAGATTTT
For Mn-XRN1 verify
Mn-XRN1-V6412CTGTTGTCCTCATACCTTTCATTG
GGTTTGGTGTCCTGTTCAGTGATG
For Mn-XRN1 verify
Mn-XRN1-V7270TGCACCGCGAACCAAAGT
TTGTCCGCCGAAGGTGG
For Mn-XRN1 verify
Mn-XRN1-V8363ACACATACCCCATAAGTTCCACA
GTTGCGTACACCAGAATTTCAGT
For Mn-XRN1 verify
Mn-XRN1-V9338GAGGTGCTGGAAGGATACAAGAA
TCTCCCAAACTACCATAGCAAGG
For Mn-XRN1 verify
Mn-XRN1-V10397ACAGTCTTCCTTCTTCCACCTTC
TTACAACAGCCTCATCCAGACAA
For Mn-XRN1 verify
Mn-XRN1-V11380CAGAGCAGAAGGGAGAAAAGGAT
ATGAATACCGATTACAGTCCCCG
For Mn-XRN1 verify
Mn-XRN1-V12238CGGGGACTGTAATCGGTATTCAT
TTATTCCACACAGAGGGTCTTGG
For Mn-XRN1 verify
Mn-XRN1-V13245CCAAGACCCTCTGTGTGGAATAA
GACTTGGTAACTGATTGGGGTCT
For Mn-XRN1 verify
Mn-XRN1-V14408AGACCCCAATCAGTTACCAAGTC
CAGGTATTGCTTCAGTGCCAAAA
For Mn-XRN1 verify
Mn-XRN1-V15483TTTTGGCACTGAAGCAATACCTG
TCTGTTACGAATGACCTGAGTGG
For Mn-XRN1 verify
Mn-XRN1-V16231CCACTCAGGTCATTCGTAACAGA
CATGAAGGGCTGACCAAAATTCA
For Mn-XRN1 verify
Mn-XRN1-q238CGGGGACTGTAATCGGTATTCAT
TTATTCCACACAGAGGGTCTTGG
For RT-qPCR
Mn-XRN1-d352TAATACGACTCACTATAGGGCACTGAAGCAATACCTGCGA
TAATACGACTCACTATAGGGAAGATCGGCACTCAGCTGT
For Mn-XRN1 dsRNA
GFP-d533TAATACGACTCACTATAGGGAGTGGAGAGGGTGAAGG
TAATACGACTCAC
TAATACGACTCACTATAGGGAGGGCAGATTGTGTGGAC
For GFP dsRNA
EIF179CATGGATGTACCTGTGGTGAAAC
CTGTCAGCAGAAGGTCCTCATTA
For RT-qPCR
Mn-XRN1 sense ProbeTGGATTGTAATCTGGCTGACTCTTGGTGTAFor Mn-XRN1 ISH analysis
Mn-XRN1 anti-sense ProbeTACACCAAGAGTCAGCCAGATTACAATCCAFor Mn-XRN1 ISH analysis
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chen, T.; Yuan, H.; Qiao, H.; Jiang, S.; Zhang, W.; Xiong, Y.; Fu, H.; Jin, S. Mn-XRN1 Has an Inhibitory Effect on Ovarian Reproduction in Macrobrachium nipponense. Genes 2023, 14, 1454. https://doi.org/10.3390/genes14071454

AMA Style

Chen T, Yuan H, Qiao H, Jiang S, Zhang W, Xiong Y, Fu H, Jin S. Mn-XRN1 Has an Inhibitory Effect on Ovarian Reproduction in Macrobrachium nipponense. Genes. 2023; 14(7):1454. https://doi.org/10.3390/genes14071454

Chicago/Turabian Style

Chen, Tianyong, Huwei Yuan, Hui Qiao, Sufei Jiang, Wenyi Zhang, Yiwei Xiong, Hongtuo Fu, and Shubo Jin. 2023. "Mn-XRN1 Has an Inhibitory Effect on Ovarian Reproduction in Macrobrachium nipponense" Genes 14, no. 7: 1454. https://doi.org/10.3390/genes14071454

APA Style

Chen, T., Yuan, H., Qiao, H., Jiang, S., Zhang, W., Xiong, Y., Fu, H., & Jin, S. (2023). Mn-XRN1 Has an Inhibitory Effect on Ovarian Reproduction in Macrobrachium nipponense. Genes, 14(7), 1454. https://doi.org/10.3390/genes14071454

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop